Effect of a freeze-dried coffee solution in a high-fat diet-induced obesity model in rats: Impact on inflammatory response, lipid profile, and gut microbiota

Marilia Hermes Cavalcanti; João Paulo Santos Roseira; Eliana dos Santos Leandro; Sandra Fernandes Arruda

doi:10.1371/journal.pone.0262270

. 2022 Jan 26;17(1):e0262270. doi: 10.1371/journal.pone.0262270

Effect of a freeze-dried coffee solution in a high-fat diet-induced obesity model in rats: Impact on inflammatory response, lipid profile, and gut microbiota

Marilia Hermes Cavalcanti ^1,^¤a,^*,^#, João Paulo Santos Roseira ^2,^¤b,^#, Eliana dos Santos Leandro ^1,^3,^¤a,^#, Sandra Fernandes Arruda ^1,^3,^¤a,^#

Editor: Baochuan Lin⁴

PMCID: PMC8791513 PMID: 35081143

Abstract

Coffee beans contain high polyphenol content, which have the potential to modulate the intestinal microbiota, and possibly attenuate weight gain and the associated dyslipidemia. This study investigated the effect of freeze-dried coffee solution (FCS) consumption on physiological parameters, lipid profile, and microbiota of Wistar rats fed a high-fat diet (HF) or control diet (CT). FCS combined with a high-fat diet increased the fecal and cecal Bifidobacterium spp. population and decreased the cecal Escherichia coli population and intestinal Il1b mRNA level. Regardless of the diet type, FCS increased the serum high-density lipoprotein cholesterol (HDL-C); however, it did not affect body weight, food intake, low-density lipoprotein, triglycerides, fecal bile acids, and intestinal Il6 mRNA levels. The high-fat diet increased weight gain, hepatic cholesterol and triglycerides, fecal bile acids, and the fecal and cecal Lactobacillus spp. population, and reduced food intake, the fecal E. coli population, and intestinal Il6 mRNA level. The results suggest that FCS consumption exhibits positive health effects in rats fed a high-fat diet by increasing Bifidobacterium spp. population and HDL-C reverse cholesterol transport, and by reducing Il1b mRNA level. However, FCS administration at a dose of 0.39 g/100 g diet over an eight-week period was not effective in controlling food intake, and consequently, preventing weight gain in rats of high-fat diet-induced obesity model.

Introduction

Coffee beverages are consumed worldwide. The United States and Brazil are the largest consumers of coffee, accounting for 28% of the total consumption of green coffee beans in the world. Brazilians consume an average of 5.8 kg of coffee per year, whereas the average global coffee consumption is 1.3 kg/person [1]. Coffea arabica L. and Coffea canephora Pierre are commercially significant species of coffee in the world; C. arabica alone represents 65% of the global coffee production [2].

Many potential health benefits have been associated with regular coffee consumption. A meta-analysis study suggested that regular coffee consumption of 0.5–5 cups/day was associated with a reduced risk of metabolic syndrome (MetS) [3]. Data obtained from the 2012–2015 Korea National Health and Nutrition Examination Survey also showed that moderate coffee consumption (3–4 times/day) was inversely associated with MetS in adults; however, no association was observed with heavy coffee consumption (≥ 5 times/day) [4]. Adult male Wistar rats fed a high-carbohydrate and high-fat diet for 16 weeks supplemented with 5% spent coffee grounds during the last eight weeks showed lower body weight, plasma triglycerides, and non-esterified fatty acids than in those not fed coffee [5]. A 24-week placebo control trial conducted in overweight and insulin-resistant individuals found that consuming four cups/day of coffee did not affect dyslipidemia biomarkers, although it promoted moderate loss of fatty mass [6].

Considering high content of polyphenols (chlorogenic acids, alkaloids, polyphenols, caffeine, and trigonelline) in coffee beans, many health benefits associated with coffee consumption have been attributed to these compounds. The complex structure of dietary polyphenols makes them a substrate for intestinal microbiota, as 95% of these compounds reach the large intestine and therefore interact with the gut microbiome [7]. A recent review study suggested that polyphenols act as prebiotics, inhibiting the growth of pathogenic bacteria without affecting or stimulating beneficial bacteria [8]. Cowan et al. [9] observed protective effect of coffee on the gut microbiota of rats fed a high-fat diet, where coffee attenuated the typical increase in the Firmicutes/Bacteroidetes ratio observed in obesity models.

Since early studies have observed that germ-free mice gained less weight and fat mass compared to those harboring a gut microbiota when fed a high-fat diet, besides being resistant to developing obesity when fed a high-fat diet, the gut microbiota has been indicated as a potential environmental factor in the etiology of obesity and its comorbidities such as dyslipidemia [10, 11]. Compared to lean mice, the ob/ob animal obesity model presented a reduction in Bacteroidetes and a proportional increase in Firmicutes [12]. A similar profile was observed in individuals with obesity [13], with the presence of fewer numbers of Bacteroides, representing the most abundant genus in the Bacteroidetes phylum in humans [14], than that in non-obese individuals [15]. Moreover, low counts of some Bifidobacterium and Enterococcus species were associated with weight gain and dyslipidemia [13, 16]. Some Lactobacillus species were associated with weight gain, whereas others such as Lactobacillus paracasei and Lactobacillus plantarum were considered probiotic strains that promoted weight loss [13, 16, 17].

The metabolism of bile acids by gut bacteria also seems to mediate the relationship between weight gain and serum lipid profile of the host and the gut microbiome composition [18]. An increase in the activity of bacterial bile salt hydrolase enzymes, which deconjugate glycine-and taurine-conjugated bile acids to generate unconjugated bile acids, was associated with a reduction in weight gain, serum cholesterol, and liver triglycerides in mice with the typical microbiota. Therefore, it has been suggested the gut microbiota modifies the host’s lipid metabolism, and consequently, improves obesity and metabolic syndrome through bacterial bile salt hydrolase enzymes [19].

Most studies evaluating the benefits of coffee in rats fed a high-fat diet used coffee extracts, instant coffee, or purified bioactive components of coffee. To date, there are no studies available that have evaluated the effect of incorporating coffee into food with the aim of preventing obesity in rats. Freeze drying has been considered the best method for preserving the chemical properties of foods. Freeze-dried coffee solution is a new product that can be incorporated into different foods. Therefore, this study was aimed to investigate the effect of a freeze-dried coffee solution mixed with a high-fat diet on physiological parameters, lipid profile, and microbiota of rats in a high-fat diet-induced obesity model.

Materials and methods

Preparation of freeze-dried coffee solution

A 10% ground coffee solution, consisting of a blend of C. arabica grains (Ponto Aralto, Jundiaí, SP, Brazil), was prepared by filtration using 100% cellulose filter paper (Original, no. 103, Melitta^®, São Paulo, SP, Brazil) and water at 90°C. The coffee solution was freeze-dried using an industrial freeze dryer (Beta 2–8 LSC PLUS Martin Christ, Nova Analítica Ltda, São Paulo, SP, Brazil) and stored at −80°C until further use. The amount of coffee solution added to the diet of the rats was estimated based on the Brazilian population’s average consumption of 163 mL of coffee [20] and 1,290 g of food per day. Considering adult rats consume an average of 25 g of food per day, the equivalent average coffee intake was estimated to be 3.15 mL/day, corresponding to 126 mL coffee/kg diet. After freeze-drying process, 126 mL of 10% coffee solution yielded 3.9 g of powder. The freeze-dried coffee solution (FCS) was added to the diet at a proportion of 3.9 g/kg of diet. Previous characterization of a commercial coffee brand of C. arabica species (Ponto Aralto, Jundiaí, SP, Brazil) found 19.93, 4.22, 5.14, 9.63 and 18.99 mg of caffeine, 3-, 4-, 5-, and total caffeoylquinic acid/g, respectively [21].

Ethics statement

The experimental protocol was approved by the Animal Care and Use Committee of the University of Brasília (protocol no. 25/2018, approved on 05/08/2018) in accordance with the Brazilian National Council for Animal Experimentation Control (CONCEA) and the Guide for the Care and Use of Laboratory Animals [22].

Animals

Twenty-eight male Wistar rats (Institute of Biomedical Sciences, University of São Paulo, SP, Brazil), 21-days old with an average body weight of 67.37 ± 6.04 g, were housed individually in stainless steel cages in a room under 12/12 h light/dark cycle at 22 ± 1°C. The diet was provided from 12 pm to 8 am, and rats had free access to water.

The animals were fed the AIN-93G control diet [23] for seven days for acclimatization; the rats were then assigned to the following experimental groups (seven rats/group) and fed the corresponding diets for a period of 56 days: control group (CT-): AIN-93G diet; high-fat group (HF-): AIN-93G diet with 58% of fat; coffee group (CF+): AIN-93G diet with 3.9 g of FCS/kg of diet; and high-fat + coffee group (HF+): AIN-93G diet with 58% of fat (51.9% of lard and 6.1% of soy oil) and 3.9 g of FCS/kg of diet. The fat percentage was determined according to the Research Diets, Inc. diet-induced obesity model (D12492, Research Diets, Inc., New Brunswick, NJ, USA). Food intake was recorded daily, and the body weight was recorded weekly.

During the experimental period, the feces of each animal were collected daily, pooled in the same tube for a week, and stored at −80°C. This provided eight-week fecal samples from each animal at the end of the experimental period. These samples were analyzed at the first and eighth week of the treatment.

At the end of the treatment period, after a 7 h fasting period, the animals were anesthetized under 3% isoflurane (BioChimico, Rio de Janeiro, RJ, Brazil) and euthanized by exsanguination via cardiac puncture. The large intestine (from the ileocecal valve to the rectum) and cecum were excised. The remaining fecal content in the large intestine and cecum content were collected in sterile tubes and stored at −80° C. Subsequently, the large intestine was washed with 0.9% saline solution at 4°C, immediately frozen in liquid nitrogen, and stored at −80°C until further analysis.

Lipid profile

Total cholesterol (CLT), high-density lipoprotein (HDL) cholesterol, low-density lipoprotein (LDL) cholesterol, and triglyceride (TG) concentrations were measured in the serum and liver using commercial enzymatic/colorimetric assay kits (BioClin, Belo Horizonte, MG, Brazil), according to the manufacturer’s protocol. Total lipid extraction from the liver was performed as described by Vieira et al. [24]. Briefly, 50 mg of the liver was homogenized in 1 mL of isopropanol and centrifuged at 2000 g for 10 min at 4°C. The supernatant was removed and stored at −80°C until further analysis.

Bile acid concentration in feces

Aliquots from the feces samples of the first and eighth week of the treatment was freeze-dried at −45°C for 48 h. The freeze-dried samples were macerated in a porcelain mortar using liquid nitrogen. Total bile acid was extracted in ethanol as described by Kanamoto et al. [25] and Tamura et al. [26], and the total bile acid content was measured by fluorometry using a commercial assay kit (Sigma-Aldrich, St. Louis, MO, USA), following the manufacturer’s instructions.

Determination of fecal microbiota composition

Extraction of DNA from fecal sample and cecum content

The DNA from the fecal samples was extracted using QIAamp PowerFecal DNA kit (Qiagen, Hilden, RP, Germany), according to the manufacturer’s protocol, with the following modifications: 150 mg of the fecal sample was used and the samples were homogenized using a cell/tissue disruptor (L-beader 6, Cotia, São Paulo, SP, Brazil) following a schedule of 2 cycles of 2500 rpm for 15 s for cecum content and 3 cycles of 2500 rpm for 15 s for fecal sample. The samples were placed on ice for 30 s between each cycle.

The DNA samples were quantified by determining the absorbance at 260 nm using the equation A_{260 nm} × 50 × dilution factor, whereas DNA purity was assessed by determining the absorbance ratios A_{260 nm}/A_{280 nm} (approximately 1.8–2.0) and A_{260 nm}/A_{230 nm} (approximately 2.0) [27] and quality of DNA was evaluated by agarose gel electrophoresis.

Real-time PCR analysis

The gut microbiota composition of Bifidobacterium spp., Lactobacillus spp., Escherichia coli, Bacteroides spp., and Enterococcus was evaluated using quantitative real-time polymerase chain reaction (qPCR, StepOnePlus System, Applied Biosystems, Foster City, CA, USA). Every analysis was performed in triplicate using 5 µL of Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA), 2 µL of sample DNA or standard, 0.2 µL of sense and antisense oligonucleotides (100 nM; Table 1), and water to a final assay volume of 10 μL. The initial DNA denaturation occurred at 95°C for 20 s, followed by 40 cycles of denaturation at 95°C for 3 s, annealing of oligonucleotides, and extension at 59–60°C for 30 s.

Table 1. Primers and reaction conditions for the bacterial genera analyzed by RT-qPCR.

Microorganisms	Primer sequence (5’- 3’)	T (ºC)	Reference
E. coli	`CATGCCGCGTGTATGAAGAA` (F)	59	[28]
	`CGGGTAACGTCAATGAGCAAA` (R)
Enterococcus spp.	`CCCTTATTGTTAGTTGCCATCATT` (F)	60	[29]
	`ACTCGTTGTACTTCCCATTGT` (R)
Bifidobacterium spp.	`AGGGTTCGATTCTGGCTCAG` (F)	60	[30]
	`CATCCGGCATTACCACCC` (R)
Lactobacillus spp.	`TGGATGCCTTGGCACTAGGA` (F)	60	[31]
	`AAATCTCCGGATCAAAGCTTACTTAT` (R)
Bacteroides spp.	`GAGAGGAAGGTCCCCCAC` (F)	60	[32]
	`CGCTACTTGGCTGGTTCAG` (R)

Open in a new tab

F: forward primer; R: reverse primer; T: annealing temperature.

Standard curves were constructed for each experiment using five sequential dilutions of bacterial genomic DNA from pure cultures ranging from 200 ng to 0.064 ng. The results were expressed as log10 of 16S rRNA copy number per gram of feces as described by Talarico et al. [33]. The different strains used were obtained from the American Type Culture Collection (ATCC) (E. coli ATCC 25992; E. faecalis ATCC 19433; Bacteroides ATCC 25285), commercial culture (Bifidobacterium spp. BL 04), and the Tropical Cultures Collection (L. plantarum UnB SBR64.1 MK5114407).

Determination of mRNA levels of pro-inflammatory genes

RNA extraction and cDNA synthesis

Total RNA was extracted from the large intestine using TRIzol reagent (Invitrogen Inc., Burlington, ON, Canada), according to the manufacturer’s protocol. Total RNA sample was quantified by measuring the absorbance at 260 nm (A_{260 nm} × 40 × dilution factor), and its purity was evaluated by the absorbance ratios A_{260 nm}/A_{280 nm} and A_{260 nm}/A_{230 nm} [27]. The integrity of the RNA bands was verified by agarose gel electrophoresis.

cDNA synthesis was performed using High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Foster City, CA, USA).

Quantification of transcriptional levels of pro-inflammatory genes Il1b, Il6, and Tnfa

The transcript levels of interleukin 1 beta (Il1b), interleukin 6 (Il6), and tumor necrosis factor alpha (Tnfa) in the large intestine were determined by RT-qPCR. The reaction was performed using 2.0 μL of cDNA (final concentration of 20 ng), 5.0 μL of Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA), and 0.2 μM/L (final concentration) of each primer (Table 2), to a final volume of 10 μL. The RT-qPCR reactions were performed at 95°C for 20 s followed by 40 cycles of 95°C for 3 s and 60°C for 30 s. The primers used are shown in Table 2. All samples were assayed in triplicate, normalized to the housekeeping gene β-actin, and the amplification specificity of each amplicon was analyzed using the dissociation curve. The relative quantification of each target gene mRNA level was determined using the 2−ΔΔCT method [34].

Table 2. Sequences of primers used for RT-qPCR assay of Il1b, Il6, Tnfa and Actb.

Gene	Primer sequence (5’- 3’)	Reference
Interleukin 1 beta (Il1b)	`CACCTCTCAAGCAGAGCACAG` (F)	[35]
	`GGGTTCCATGGTGAAGTCAAC` (R)
Interleukin 6 (Il6)	`GCCAGAGTCATTCAGAGCAATA` (F)	[36]
	`GTTGGATGGTCTTGGTCCTTAG` (R)
Tumor necrosis factor alpha (Tnfa)	`AAATGGGCTCCCTCTCATCAGTTC` (F)	[35]
	`GTCGTAGCAAACCACCAAGCAGA` (R)
β Actin (Actb)	`GTCGTACCACTGGCATTGTG` (F)	[37]
	`CTCTCAGCTGTGGTGGTGAA` (R)

Open in a new tab

F: forward primer; R: reverse primer.

Statistical analysis

The data obtained from microbial populations and bile acids were analyzed according to a completely randomized 2 × 2 × 2 factorial design, considering two diets (CT and HF) with (+) or without (−) the addition of coffee and two treatment periods (the first and eighth week).

The variables from the other experiments were analyzed according to a completely randomized 2 × 2 factorial design (diet and coffee). Homogeneity of the variances between treatments was assumed, and after analysis of variance, significant interactions between the factors were unfolded and compared using the F test and Tukey test. The box plot method was used to remove outliers, and the initial weights of animals were used as covariates. A critical probability level of 0.05 was adopted for type I errors using PROC MIXED from SAS version 9.4 (SAS Institute Inc., Cary, NC, USA).

Results

Effect of freeze-dried coffee solution consumption on food intake and body weight

The effect of FCS on food intake and body weight gain was examined in rats fed the control or a high-fat diet (Table 3). The addition of FCS to the control (CT+) or a high-fat diet (HF+) did not significantly affect food intake or body weight gain (P > 0.05). However, the rats fed a high-fat diet (HF-) showed lower (P < 0.05) total and daily food intake and higher weight gain than those in rats fed the control diet (CT-).

Table 3. Food intake, final body weight, and average daily weight gain of rats fed the control or a high-fat diet with or without FCS.

Diet	FCS		Mean ± S.E.	Two-way ANOVA P values
	(-)	(+)		Diet	FCS	Diet × FCS
	Total Food Intake (g/56 days)
CT	1,020.51 ± 32.95	1,063.63 ± 33.00	1,042.07 ± 23.22^a	0.001	0.989	0.218
HF	893.98 ± 35.46	851.76 ± 32.83	872.87 ± 24.16^b
Mean	957.25 ± 24.20	957.69 ± 23.26
	Food Intake (g/d)
CT	18.22 ± 0.59	18.99 ± 0.59	18.61 ± 0.41^a	0.001	0.990	0.219
HF	15.96 ± 0.63	15.21 ± 0.59	15.59 ± 0.43^b
Mean	17.09 ± 0.43	17.10 ± 0.42
	FBW (g)
CT	386.20 ± 15.06	390.84 ± 15.14	388.52 ± 10.64^b	0.004	0.648	0.447
HF	459.93 ± 15.06	441.31 ± 15.03	450.62 ± 10.64^a
Mean	423.07 ± 10.67	416.08 ± 10.67
	ADG (g/d)
CT	4.80 ± 0.27	4.88 ± 0.27	4.84 ± 0.19^b	0.004	0.648	0.447
HF	6.12 ± 0.27	5.78 ± 0.27	5.95 ± 0.19^a
Mean	5.46 ± 0.19	5.33 ± 0.19

Open in a new tab

Values are expressed as the mean ± S.E. (n = 7 in each group). Means in a column without a common letter differ significantly (P <0.05), according to the F test. CT (-): rats fed the control diet AIN-93G; CT (+): rats fed the control diet AIN-93G + FCS; HF (-): rats fed a high-fat diet; HF (+): rats fed a high-fat diet + FCS; FBW: final body weight; ADG: average daily weight gain.

Hepatic and serum lipid concentration

The hepatic and serum lipid profiles were determined in rats fed the control or a high-fat diet, with or without the addition of FCS (Table 4). FCS intake caused a significant (P < 0.05) increase in serum HDL concentration, independent of the diet type. The high-fat diet promoted an increase in CLT and TG in the liver compared to the control diet.

Table 4. Serum and hepatic lipid profile of rats fed the control or a high-fat diet with or without FCS.

Diet	FCS		Mean ± S.E.	Two-way ANOVA P values
	(-)	(+)		Diet	FCS	Diet×FCS
	CLT serum (mg/dL)
CT	70.22 ± 6.11	71.06 ± 7.53	70.64 ± 5.25	0.562	0.730	0.627
HF	67.67 ± 9.67	61.63 ± 7.83	64.65 ± 6.81
Mean	68.94 ± 5.13	66.34 ± 4.96
	CLT liver (mg/dL)
CT	8.90 ± 2.44	15.14 ± 2.52	12.02 ± 1.83^b	0.015	0.101	0.409
HF	18.57 ± 2.65	20.78 ± 2.37	19.68 ± 1.83^a
Mean	13.74 ± 1.69	17.96 ± 1.69
	TG serum (mg/dL)
CT	111.20 ± 16.30	96.71 ± 17.85	103.95 ± 12.57	0.869	0.362	0.965
HF	108.84 ± 17.21	92.90 ± 15.48	100.87 ± 11.78
Mean	110.02 ± 10.97	94.80 ± 11.69
	TG liver (mg/dL)
CT	79.34 ± 19.21	123.83 ± 19.82	101.59 ± 14.43^b	0.038	0.171	0.377
HF	146.69 ± 20.91	157.12 ± 18.69	151.91 ± 14.43^a
Mean	113.03 ± 13.31	140.46 ± 13.31
	HDL serum (mg/dL)
CT	63.62 ± 7.95	86.88 ± 8.15	75.26 ± 5.94	0.863	0.007	0.730
HF	59.26 ± 8.89	88.06 ± 7.67	73.66 ± 5.94
Mean	61.44 ± 5.55^B	87.47 ± 5.55^A
	HDL liver (mg/dL)
CT	7.53 ± 0.52	7.77 ± 0.54	7.65 ± 0.39	0.415	0.695	0.940
HF	8.06 ± 0.56	8.23 ± 0.50	8.14 ± 0.39
Mean	7.80 ± 0.36	8.00 ± 0.36
	LDL serum (mg/dL)
CT	21.70 ± 3.58	19.87 ± 3.44	20.79 ± 2.57	0.790	0.669	0.358
HF	17.33 ± 3.69	22.13 ± 3.40	19.73 ± 2.57
Mean	19.51 ± 2.39	21.00 ± 2.39
	LDL liver (mg/dL)
CT	4.55 ± 0.64	5.35 ± 0.61	4.95 ± 0.47	0.538	0.743	0.326
HF	4.69 ± 0.62	4.29 ± 0.64	4.49 ± 0.47
Mean	4.62 ± 0.42	4.82 ± 0.42

Open in a new tab

Values are expressed as the mean ± S.E. (n = 5 in each group). CT (-): rats fed the control diet AIN-93G; CT (+): rats fed the control diet AIN-93G + FCS; HF (-) rats fed a high-fat diet; HF (+) rats fed a high-fat diet + FCS. Means in the same row without a common capital letter A, B differ (P < 0.05) and means in the same column without a common lowercase letter a, b differ (P < 0.05), according to the F test. CLT, total cholesterol; TG, triglyceride; HDL, high-density lipoprotein cholesterol; LDL, low-density lipoprotein cholesterol.

Bile acid concentration in feces

The concentration of bile acids was determined in the feces of the rats fed the control and a high-fat diet, with or without the addition of FCS, at the first and eighth week of the treatment (Fig 1). Independent of the presence or absence of FCS in the diet, the concentration of bile acids in the rat feces was affected by the diet type and treatment duration (weeks). In the first and eighth week of the treatment, the fecal concentration of bile acids was significantly (P < 0.05) higher in the rats fed a high-fat diet than in the rats fed the control diet. The rats fed a high-fat diet also showed a significantly (P < 0.05) higher concentration of bile acids in their feces in the eighth week of the treatment than in the first week.

Fig 1 — Values are least-square means of diet × treatment time interaction of bile acid concentration in feces ± S.E. (n = 5 in each group). CT: rats fed the control diet AIN-93G; HF: rats fed a high-fat diet. Means without a common capital letter A, B differ (P < 0.05) in relation to the effect of diet type on treatment duration and means without a common lowercase letter a, b differ (P < 0.05) in relation to the effect of treatment duration on diet type, according to the F test.

Determination of fecal microbiota composition

The absolute quantification of specific groups of bacteria was determined in the feces of the rats fed the control or a high-fat diet, with or without the addition of FCS (Figs 2–5). The P-values of the statistical analyses are presented in S1 Table.

Fig 5 — Rats were fed the control or a high-fat diet, with or without FCS, after first and eighth week of the treatment. Data represent the mean log10 16S rRNA gene copy number per gram of feces. Values are expressed as the mean ± S.E. (n = 5 in each group). Within the same bacterial strain, means in the same column without a common letter differ significantly (P < 0.05), according to the F test.

The fecal population of Bacteroides spp. only showed a diet × FCS × time interaction effect (Fig 2). In the first week of treatment, the population of Bacteroides spp. in feces of the rats fed a high-fat diet (HF-) was significantly (P < 0.05) lower than that in the other groups of rats, whereas the addition of FCS to high-fat diet (HF+) normalized the fecal Bacteroides spp. concentration (CT- × HF+; P > 0.05).

In the eighth week of the treatment, there was no significant effect of FCS addition on the population of Bacteroides spp. in feces of the rats fed the control or a high-fat diet.

The fecal population of Bifidobacterium spp. presented a diet × FCS interaction effect (Fig 3). The addition of FCS to high-fat diet (HF+) significantly increased (P < 0.05) the population of Bifidobacterium spp. in the rat feces compared to that in the rats fed a high-fat diet without FCS (HF-). The addition of FCS to the control diet did not affect the population of Bifidobacterium spp. (P > 0.05).

The high-fat diet significantly affected (P < 0.05) the populations of Lactobacillus spp. and E. coli in the feces of rats, regardless of the presence of FCS or the treatment duration (Fig 4). The Lactobacillus spp. population was significantly (P < 0.05) higher and E. coli population was significantly (P < 0.05) lower in the feces of rats fed a high-fat diet (HF) than those in the feces of rats fed the control diet.

Fig 4 — Data represent the mean log10 16S rRNA gene copy number per gram of feces. Values are expressed as the mean ± S.E. (n = 5 in each group). Within the same bacterial strain, means in the same column without a common letter differ significantly (P < 0.05), according to the F test.

The treatment duration (weeks) with the experimental diet significantly affected (P < 0.05) the populations of Lactobacillus spp., Enterococcus spp., and E. coli, regardless of the dietary fat content or the addition of FCS to the diet (Fig 5). The populations of Lactobacillus spp., Enterococcus spp., and E. coli were significantly (P < 0.05) higher in the feces of rats in the first week of treatment with the experimental diet than those in the eighth week.

Microbiota composition of the cecum content

The populations of Enterococcus spp., Bifidobacterium spp., and E. coli present in the rat cecum content were significantly affected (P < 0.05) by the addition of FCS to the diet (Table 5). Compared to the control diet alone (CT-), the Enterococcus spp. population in the cecum content was significantly increased (P < 0.05) with the addition of FCS to the control diet (CT+). Compared to the high-fat diet alone (HF-), the population of Bifidobacterium spp. significantly increased (P < 0.05) when FCS was added to the high-fat diet (HF+); however, no difference was observed in the Bifidobacterium spp. population when FCS was added to the control diet. The E. coli population in the cecum content showed a significant increase (P < 0.05) when FCS was added to the control diet, while a significant reduction (P < 0.05) was observed when FCS was mixed with the high-fat diet, compared to the CT- and HF- diets, respectively. The Enterococcus spp. population was not significantly affected (P > 0.05) by the diet type in which FCS was incorporated. Compared to the control diet (CT-), the high-fat diet (HF-) promoted an increase in the Enterococcus spp. population in the cecum content and did not affect Bifidobacterium spp. and E. coli populations.

Table 5. Bacterial populations in the cecum content of rats fed the control or a high-fat diet with or without FCS.

Diet	FCS		Mean ± S.E.	Two-way ANOVA P values
	(-)	(+)		Diet	FCS	Diet×FCS
	log10 16S rRNA gene copy number per gram of feces
	Bacteroides spp.
CT	4.68 ± 0.10	4.78 ± 0.10	4.73 ± 0.07	0.610	0.486	0.784
HF	4.64 ± 0.11	4.69 ± 0.10	4.67 ± 0.08
Mean	4.66 ± 0.07	4.73 ±0.07
	Lactobacillus spp.
CT	3.51 ± 0.14	3.85 ± 0.12	3.68 ± 0.10^b	0.001	0.338	0.167
HF	4.41 ± 0.16	4.33 ± 0.12	4.37 ± 0.10^a
Mean	3.96 ± 0.09	4.09 ± 0.09
	Enterococcus spp.
CT	0.27 ± 0.14^Bb	0.70 ± 0.11^Aa	0.49 ± 0.10	0.037	0.194	0.036
HF	0.93 ± 0.13^Aa	0.81 ± 0.11^Aa	0.87 ± 0.09
Mean	0.61 ± 0.08	0.75 ± 0.07
	Bifidobacterium spp.
CT	1.77 ± 0.25^Aa	2.12 ± 0.26^Aa	1.94 ± 0.19	0.370	0.001	0.015
HF	1.33 ± 0.28^Ba	3.09 ± 0.24^Ab	2.21 ± 0.19
Mean	1.55 ± 0.17	2.61 ± 0.17
	E. coli
CT	1.82 ± 0.20^Ba	3.02 ± 0.21^Aa	2.42 ± 0.15	0.003	0.263	0.003
HF	1.73 ± 0.22^Aa	0.98 ± 0.19^Bb	1.36 ± 0.15
Mean	1.78 ± 0.13	2.00 ± 0.13

Open in a new tab

Values are expressed as the mean ± S.E. (n = 5 in each group). CT (-): rats fed the control diet AIN-93G; CT (+): rats fed the control diet AIN-93G + FCS; HF (-): rats fed a high-fat diet; HF (+): rats fed a high-fat diet + FCS. Means in the same row without a common capital letter A, B differ significantly (P < 0.05), and means in the same column without a common lowercase letter a, b differ significantly (P < 0.05), according to the F test.

The populations of Bacteroides spp. and Lactobacillus spp. in the cecum content were not significantly affected (P > 0.05) by the addition of FCS, independent of the diet type. However, the high-fat diet promoted a significant increase (P < 0.05) in the population of Lactobacillus spp. in the rat cecum content.

Expression of pro-inflammatory genes in the large intestine

The mRNA expression levels of Il1b, Il6, and Tnfa were evaluated in rats fed the control and a high-fat diet, with and without FCS (Table 6). Compared to the high-fat diet alone (HF-), the addition of FCS to the high-fat diet (HF+) downregulated (P < 0.05) the mRNA expression of Il1b in the large intestine, whereas no difference was observed between the CT- and CT+ groups. Regarding mRNA expression level of Il6 in the large intestine, addition of FCS increased this level regardless of the diet type, whereas the high-fat diet promoted a decrease in the level, independent of whether or not FCS was used. In contrast, Tnfa mRNA level in the large intestine was not significantly affected (P > 0.05) by the diet type or the presence of FCS.

Table 6. Quantification of Il1b, Il6, and Tnfa mRNA levels in the large intestine of rats fed the control or a high-fat diet with or without FCS.

Diet	FCS		Mean ± S.E.	Two-way ANOVA P values
	(-)	(+)		Diet	FCS	Diet×FCS
	mRNA Il1b
CT	1.00 ± 0.09^Aa	1.19 ± 0.09^Aa	1.10 ± 0.06	0.068	0.049	0.006
HF	1.21 ± 0.10^Aa	0.63 ± 0.10^Bb	0.91 ± 0.07
Mean	1.11 ± 0.06	0.91 ± 0.06
	mRNA Il6
CT	1.02 ± 0.23	1.62 ± 0.21	1.32 ± 0.16^a	0.025	0.018	0.825
HF	0.53 ± 0.19	1.04 ± 0.21	0.90 ± 0.14^b
Mean	0.78 ± 0.15^B	1.33 ± 0.15^A
	mRNA Tnfa
CT	0.97 ± 0.22	0.87 ± 0.22	0.92 ± 0.15	0.849	0.580	0.287
HF	0.72 ± 0.18	1.05 ± 0.18	0.88 ± 0.13
Mean	0.85 ± 0.14	0.96 ± 0.14

Open in a new tab

Values are expressed as the mean ± S.E. (n = 6 in each group). CT (-): rats fed the control diet AIN-93G; CT (+): rats fed the control diet AIN-93G + FCS; HF (-): rats fed a high-fat diet; HF (+): rats fed a high-fat diet + FCS. Means in the same row without a common capital letter A, B differ significantly (P < 0.05), and means in the same column without a common lowercase letter a, b differ significantly (P < 0.05), according to the F test.

Discussion

This study evaluated the effect of FCS when mixed with the diet on the physiological parameters, lipid profile, bile acid concentration, and microbiota of rats in a high-fat diet-induced obesity model.

Several studies have shown the effectiveness of coffee extract in reducing body weight gain in rats fed a high-fat diet [9, 38–42]. Polyphenols, which are present in high concentration in coffee, can inhibit digestive enzymes [43], and consequently, inhibit macronutrient absorption and reduce body weight gain [44, 45]. Contrary to these observations, in the present study, the consumption of FCS for 56 days did not change body weight of rats in the control group or high-fat diet group. This result suggests that in a treatment model for preventing obesity, FCS should be co-administered during the development of obesity for a longer duration to observe its effect on body weight. A previous study that monitored obesity induction over 83 days by feeding rats a high-fat diet showed that although rats on the high-fat diet had a higher body weight than that of the control rats after 21 days of treatment, statistically significant difference was observed only after 83 days [46]. This reinforces the hypothesis that the rats were in a pre-obese state in the present study. Furthermore, several studies that have observed significant effects of coffee on body weight [9, 39, 41] used an obesity treatment model instead of an obesity prevention model of the present study.

The higher body weight of the rats fed the high-fat diet despite their lower food intake was associated with the higher energy density of the high-fat diet (5.30 kcal/g) than that of the control diet (3.95 kcal/g). Although the dietary intake of rats fed the high-fat diet was 16% less than that of the control rats, their energy intake was 13% greater. Similar results have been reported in other studies [47–49]. The authors suggest that the decrease in food intake promoted by the high-fat diet may be attributed to a compensatory mechanism that maintains energy balance homeostasis and consequently controls the excess body weight gain induced by high caloric density of the diet.

Several other factors such as coffee bean species (C. arabica and C. canephora var. Robusta), roasting process (time × temperature) [50], and method used to prepare the beverage influence coffee polyphenol content. Rendón et al. [51] showed that filtered coffee beverages have lower diterpene content than unfiltered beverages. According to Cruz et al. [52], variations in the biological activity of coffee may be related to differences in its chemical composition.

In the present study, the coffee solution was freeze-dried to enable its incorporation into a high-fat diet. Although this process may promote alterations in the chemical composition, such modifications can be considered minimal, as freeze-drying is the most recommended method for preserving polyphenol compounds [53, 54]. Moreover, the dose of FCS used in the present study was 0.39 g/100 g of diet, which is equivalent to 163 mL/day or 1.5 cups/day of coffee, the average coffee intake of the Brazilian population [20]. When testing two doses of coffee extract (40% and 60% v/v), Maki et al. [55] observed a significant reduction in body weight gain and amelioration of some biochemical markers in the mice treated with the high dose (60%) of coffee extract. Therefore, it is possible that the dose of FCS used in the present study was insufficient to reduce the body weight of rats.

Regarding the lipid profile, there is no consensus concerning the effect of coffee [41, 56–58]. In the present study, the consumption of FCS did not affect most lipid profile markers in the serum and liver, since the levels of cholesterol, TG, and LDL were similar between the control and high-fat diet groups, with and without the addition of FCS. Similar to our results, Karabudak et al. [59] demonstrated no significant association between Turkish or instant coffee consumption and serum lipid profile in subjects. The authors suggested that the preparation method and the amount of coffee consumed are important aspects that influence the serum lipid response. The cause of these differences is not clear but may be associated with the amount of coffee administered, different routes of coffee administration (gavage or mixed with the diet), and different treatment protocols, as some studies have employed an obesity treatment protocol rather than an obesity prevention protocol. Ilmiawati et al. [42] observed a decrease in serum CLT and TG levels with low doses of a green coffee extract; however, only high doses of green coffee extract (> 20 mg/kg body weight/day) were able to decrease LDL level and increase HDL level in the serum.

Although FCS did not decrease the levels of CLT or LDL, an atherogenic lipoprotein, coffee consumption promoted a significant increase in the serum HDL level. This result shows that coffee has atheroprotective property, as HDL lipoproteins remove excess cholesterol from the tissues by reverse cholesterol transport [60]. This is also in line with the marginal increase in CLT in the liver observed with coffee treatment (1.31-fold compared to no coffee; P = 0.100). Similar to our results, Feyisa et al. [56] observed that rats fed coffee had higher HDL-C concentration than that in other rats. Some studies, most of which used purified compounds, showed that some polyphenols found in coffee (caffeic, ferulic, and phenolic acids) as well as in other foods stimulated reverse cholesterol transport by promoting HDL formation and cholesterol efflux [61, 62].

Contrarily, no change was observed in the serum lipid profile and only the hepatic concentrations of cholesterol and TG increased in rats fed the high-fat diet. We hypothesized that the obesity induction time was not sufficient to surpass systemic homeostasis; therefore, excess cholesterol was taken up by the liver through LDL receptors mediated by the SCAP-SREBP pathway [63], which caused an increase in hepatic cholesterol, while serum levels remained the same compared to the control rats. The higher bile acid excretion in stools observed in the first week of treatment, which was even greater in the eighth week, in rats fed the high-fat diet regardless of FCS consumption, supports the hypothesis that systemic homeostasis was maintained until 56 days of treatment.

Bile acids are amphipathic sterols secreted in the duodenum. They are the main constituents of bile and are responsible for emulsifying fat and facilitating digestion and absorption [64]. As expected, the high-fat diet promoted an increase in the total bile acid content in the rat feces. Lin et al. [65] observed lower concentrations of conjugated bile acids and higher levels of unconjugated bile acids in the feces of rats fed a high-fat diet than those in other rats. Gut microbiota can hydrolyze conjugated bile acids into secondary bile acids, which are associated with colon cancer [66, 67]. Although coffee and its polyphenolic compounds can decrease dietary lipid digestion by reducing the synthesis and action of bile acids [60, 68], in the present study, FCS did not affect total bile acid excretion in the feces.

Certain strains of the genus Bifidobacterium are involved in anti-obesity activity and are therefore found in low number in obese individuals. The FCS-induced increase in Bifidobacterium spp. population in the feces and cecal content only in rats fed the high-fat diet suggests that the consumption of FCS during obesity development and progression may have a protective effect; additionally, these rats presented lower mRNA level of Il1b in the large intestine than those fed the high-fat diet. These effects may be associated with high polyphenol content of coffee (chlorogenic acids, caffeine, cafestol, and kahweol), which have anti-inflammatory properties [69, 70]. Some studies have shown that polyphenols in foods have prebiotic effect, favoring the Bifidobacterium spp. population in the gut [71, 72]. Fermentation products of coffee components may inhibit the growth of other microorganisms in the colon, and consequently, favor an increase in the Bifidobacterium spp. population in rats fed coffee combined with a high-fat diet. Nakayama and Oishi [30] showed an increase in the Bifidobacterium spp. population in the feces of rats fed coffee extract, thus corroborating our results.

Although the genus Lactobacillus has many health benefits, some subspecies appeared to be positively associated with body weight gain [73]. The high body weight gain observed in rats fed the high-fat diet in the present study may be associated with the presence of some subspecies of the genus Lactobacillus, generally observed in obese organisms, since a significant increase in the Lactobacillus spp. population was observed in the feces of these rats. Similar to our results, Cowan et al. [9] did not observe any effect of coffee intake on the fecal population of Lactobacillus spp.

E. coli is generally found in the human gastrointestinal tract, either as commensal, probiotic, or pathogenic bacteria [74], comprising less than 0.1% of the total bacterial count in the gut microbiota [75]. The present study observed a reduction in the fecal E. coli population in rats fed the high-fat diet, independent of the presence or absence of FCS in the diet. Corroborating our findings, Million et al. [76] suggested that the absence of E. coli was an independent predictor of weight gain, as they found E. coli in the feces of patients with weight loss. In vitro studies have shown that phenolic compound extracts modulated E. coli growth [77–79]. Therefore, in the present study, coffee polyphenols or the products of their hydrolysis or reduction may have stimulated the growth of E. coli in the cecum of rats fed the control diet. In line with data from the literature, Lactobacillus spp., E. coli, and Enterococcus spp. populations decreased in the feces with increase in the treatment duration, independent of the diet type. Considering the high density and immense diversity of microorganisms in the gastrointestinal tract, particularly in the colon, the release and/or production of different secondary metabolites by these microorganisms (organic acids and short-chain fatty acids) may explain the reduction in some bacterial strains, since these compounds act as antimicrobial agents [80, 81]. Therefore, the longer treatment duration may have increased the antimicrobial action of some metabolites against Lactobacillus, E. coli, and Enterococcus, reducing these bacterial populations in the feces.

Lachnospira, Roseburia, Butyrivibrio, Ruminoccus, Fecalibacterium, and Fusobacteria constitute the cecal microbiota [82]. However, in the present study, E. coli, Enterococcus spp., Lactobacillus spp., Bacteroides spp., and Bifidobacterium spp. were identified in the cecum. According to Liu et al. [44], Enterococcus spp. and Bifidobacterium spp. hydrolyze food polyphenols. Therefore, the observed increase in the populations of Bifidobacterium spp. and Enterococcus spp. in the cecum of rats fed FCS mixed with the control diet and FCS mixed with the high-fat diet compared to rats fed the control and high-fat diets alone, respectively, may be associated with polyphenols present in FCS. In addition to the effect of FCS, it is likely that some fecal strains of Bifidobacterium spp. are resistant to bile acids, which results in an increase in its population. In some strains such as B. longum and B. brevis, resistance mechanisms to bile acids involving bile efflux systems have already been identified [83–85].

Considering the increase in the levels of pro-inflammatory cytokines such as IL-6, IL-1β, and TNF-α in obese individuals [86] and the decrease in the serum level of IL-6 after consumption of four or more cups of coffee/day [87], we determined the mRNA level of Il6 in the large intestine of rats to investigate a possible coffee × fecal microbiota × gut inflammatory response interaction. Despite the high polyphenol content in coffee, Il6 mRNA level was increased after coffee consumption regardless of the diet type, whereas the high-fat diet decreased Il6 mRNA level in the large intestine. The high-fat diet-induced decrease in Il6 mRNA level in the large intestine may be related to the inhibition of the E. coli population observed in these rats compared to the control. According to Kittana et al. [88], a greater population of commensal E. coli was observed in the intestinal tissues of humans during inflammation. In addition, they demonstrated that some strains of E. coli in the intestine are associated with high secretion of IL-6.

Despite being reported that foods rich in polyphenols inhibit pro-inflammatory cytokine secretion [89], in the present study, coffee promoted an increase in Il6 mRNA level in the large intestine regardless of the diet type. This contradiction may be attributed to differences in the tissue response. Most studies evaluated systemic inflammation by measuring serum levels of these cytokines, while in the present study, we evaluated the inflammatory response in the large intestine. According to Juge-Aubry et al. [90], IL-6 may be involved in anti-inflammatory activity, since it can decrease TNF-α and interferon gamma (IFNγ) levels during inflammation, and therefore, control inflammation and inhibit tissue damage. Caro-Gómez et al. [91] observed increased expression level of hepatic IL-6 in rats fed green coffee extract. They suggested that IL-6 can control obesity-associated inflammation by favoring macrophage polarization towards the M2 phenotype, which acts in the resolution phase of inflammation and in repairing damaged tissues.

Conclusions

The results suggest that the consumption of FCS may promote positive health effects in rats fed a high-fat diet by increasing the populations of Bifidobacterium, improving HDL-C reverse cholesterol transport, and reducing Il1b mRNA level. However, FCS administration at a dose equivalent to the regular average coffee intake of the Brazilian population over an eight-week period was not effective in controlling food intake, and consequently, preventing weight gain in rats of high-fat diet-induced obesity model. Therefore, coffee, being associated with a wide range of health benefits, must be consumed as filtered beverage regularly in moderate amount (3–5 cups/day).

Supporting information

S1 Table. P-values from the statistical analysis of data of microbial composition and bile acid concentration in the feces of rats fed the control diet without FCS [CT (-)], control diet + FCS [CT (+)], high-fat diet [HF (-)], or high-fat diet + FCS [(HF +)].

D: diet; FCS: freeze-dried coffee solution; T: time; SEM: standard error of the mean.

(DOCX)

Click here for additional data file.^{(15.5KB, docx)}

S1 Graphical abstract

(TIF)

Click here for additional data file.^{(545KB, tif)}

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

The author Marilia Hermes Cavalcanti received financial scholarship for the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) (code 001) and financial aid for the research by Fundação de Apoio a Pesquisa do Distrito Federal (FAP-DF). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.De Melo Pereira GV, de Carvalho Neto DP, Magalhães Júnior AI, do Prado FG, Pagnoncelli MGB, Karp SG, et al. Chemical composition and health properties of coffee and coffee by-products. Adv Food Nutr Res. 2020;91: 65–96. doi: 10.1016/bs.afnr.2019.10.002 . [DOI] [PubMed] [Google Scholar]
2.Lashermes P, Andrade AC, Etienne H. Genomics of Coffee One of the World’s Largest Traded Commodities. In: Moore Paul H, editor. Genomics of tropical crop plants. New York: Springer; 2008. pp. 203–226. doi: 10.1007/978-0-387-71219-2_9 [DOI] [Google Scholar]
3.Shang F, Li X, Jiang X. Coffee consumption and risk of the metabolic syndrome: A meta-analysis. Diabetes Metab. 2016;42(2): 80–87. doi: 10.1016/j.diabet.2015.09.001 . [DOI] [PubMed] [Google Scholar]
4.Kim Y, Je Y. Moderate coffee consumption is inversely associated with the metabolic syndrome in the Korean adult population. Br J Nutr. 2018;120(11): 1279–1287. doi: 10.1017/S0007114518002635 . [DOI] [PubMed] [Google Scholar]
5.Bhandarkar NS, Mouatt P, Goncalves P, Thomas T, Brown L, Panchal SK. Modulation of gut microbiota by spent coffee grounds attenuates diet-induced metabolic syndrome in rats. FASEB J. 2020;34(3): 4783–4797. doi: 10.1096/fj.201902416RR Epub 2020 Feb 10. . [DOI] [PubMed] [Google Scholar]
6.Alperet DJ, Rebello SA, Khoo EY, Tay Z, Seah SS, Tai BC, et al. The effect of coffee consumption on insulin sensitivity and other biological risk factors for type 2 diabetes: a randomized placebo-controlled trial. Am J Clin Nutr. 2020;111(2): 448–458. doi: 10.1093/ajcn/nqz306 . [DOI] [PubMed] [Google Scholar]
7.Moco S, Martin FP, Rezzi S. Metabolomics view on gut microbiome modulation by polyphenol-rich foods. J Proteome Res. 2012;11(10): 4781–4790. doi: 10.1021/pr300581s . [DOI] [PubMed] [Google Scholar]
8.Wan MLY, Co VA, El-Nezami H. Dietary Polyphenol Impact On Gut Health And Microbiota. Crit Rev Food Sci Nutr. 2020;1–22. doi: 10.1080/10408398.2020.1744512 . [DOI] [PubMed] [Google Scholar]
9.Cowan TE, Palmnäs MS, Yang J, Bomhof MR, Ardell KL, Reimer RA, et al. Chronic coffee consumption in the diet-induced obese rat: impact on gut microbiota and serum metabolomics. J Nutr Biochem. 2014;25(4): 489–495. doi: 10.1016/j.jnutbio.2013.12.009 . [DOI] [PubMed] [Google Scholar]
10.Bäckhed F, Ding H, Wang T, Hooper LV, Koh GY, Nagy A, et al. The gut microbiota as an environmental factor that regulates fat storage. Proc Natl Acad Sci U S A.;101(44): 15718–23. doi: 10.1073/pnas.0407076101 . [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Bäckhed F, Manchester JK, Semenkovich CF, Gordon JI. Mechanisms underlying the resistance to diet-induced obesity in germ-free mice. Proc Natl Acad Sci U S A. 2007;104(3): 979–984. doi: 10.1073/pnas.0605374104 . [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Ley RE, Bäckhed F, Turnbaugh P, Lozupone CA, Knight RD, Gordon JI. Obesity alters gut microbial ecology. Proc Natl Acad Sci U S A. 2005;102(31): 11070–11075. Epub 2005 Jul 20. doi: 10.1073/pnas.0504978102 . [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Crovesy L, Masterson D, Rosado EL. Profile of the gut microbiota of adults with obesity: a systematic review. Eur J Clin Nutr. 2020;74(9): 1251–1262. doi: 10.1038/s41430-020-0607-6 . [DOI] [PubMed] [Google Scholar]
14.Arumugam M, Raes J, Pelletier E, Le Paslier D, Yamada T, Mende DR, et al. Enterotypes of the human gut microbiome. Nature. 2011;473: 174–180. doi: 10.1038/nature09944 . [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Ley RE, Turnbaugh PJ, Klein S, Gordon JI. Microbial ecology: Human gut microbes associated with obesity. Nature. 2006;444: 1022–1023. doi: 10.1038/4441022a . [DOI] [PubMed] [Google Scholar]
16.Azad M, Sarker M, Li T, Yin J. Probiotic Species in the Modulation of Gut Microbiota: An Overview. Biomed Res Int. 2018; 1–8. doi: 10.1155/2018/9478630 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Drissi F, Merhej V, Angelakis E, El Kaoutari A, Carrie`re F, Henrissat B, et al. Comparative genomics analysis of Lactobacillus species associated with weight gain or weight protection. Nutr Diabetes. 2014; 1–8. doi: 10.1038/nutd.2014.6 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Staley C, Weingarden AR., Khoruts A, Sadowsky MJ. Interaction of Gut Microbiota with Bile Acid Metabolism and its Influence on Disease States. Appl Microbiol Biotechnol. 2017;101(1): 47–64. doi: 10.1007/s00253-016-8006-6 . [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Joyce SA, MacSharry J, Casey PG., Kinsella M, Murphy EF, Shanahan F, et al. Regulation of Host Weight Gain and Lipid Metabolism by Bacterial Bile Acid Modification in the Gut. Proc Natl Acad Sci U S A. 2014; 111(20): 7421–7426. doi: 10.1073/pnas.1323599111 . [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Sousa AG, Da Costa THM. Usual coffee intake in Brazil: Results from the National Dietary Survey 2008–9. Br J Nutr. 2015;113: 1615–1620. doi: 10.1017/S0007114515000835 . [DOI] [PubMed] [Google Scholar]
21.Reis CEG, Paiva CLRDS, Amato AA, Lofrano-Porto A, Wassell S, Bluck LJC, et al. Decaffeinated coffee improves insulin sensitivity in healthy men. Br J Nutr. 2018;119: 1029–1038. doi: 10.1017/S000711451800034X . [DOI] [PubMed] [Google Scholar]
22.National Research Council (US), Committee for the Update of the Guide for the Care and Use of Laboratory Animals. Guide for the Care and Use of Laboratory Animals. 8th ed. Washington (DC): The National Academy Press (US); 2011. 220 p. ISBN-13: 978-0-309-15400-0ISBN-10: 0-309-15400-6. doi: 10.1258/la.2010.010031 [DOI] [Google Scholar]
23.Reeves PG, Nielsen FH, George C. Fahey J. AIN-93 Purified Diets for Laboratory Rodents: Final Report of the American Institute of Nutrition Ad Hoc Writing Committee on the Reformulation of the AIN-76A Rodent Diet. J Nutr. 1993;123: 1939–1951. doi: 10.1093/jn/123.11.1939 . [DOI] [PubMed] [Google Scholar]
24.Vieira VJ, Valentine RJ, Wilund KR, Woods JA. Effects of diet and exercise on metabolic disturbances in high-fat diet-fed mice. Cytokine. 2009;46: 339–345. doi: 10.1016/j.cyto.2009.03.006 . [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Kanemoto R, Kimura S, Okamura G. Cholesterol lowering effect of soybean lipophilic proteins associated with phospholipids in rat. Soy Protein Res. 2007;10: 83–87. [Google Scholar]
26.Tamura M, Nakagawa H, Hori S, Suzuki T, Hirayama K. Plasma quercetin metabolites are affected by intestinal microbiota of human microbiota-associated mice fed with a quercetin-containing diet. J Clin Biochem Nutr. 2019;65(3): 232–239. doi: 10.3164/jcbn.19-45 . [DOI] [PMC free article] [PubMed] [Google Scholar]
27.De-Souza MT, Brigido M de M, Maranhão AQ. Técnicas básicas em biologia molecular. 2nd ed. Brasília: EDU—University of Brasilia Press; 2016. [Google Scholar]
28.Huijsdens XW, Linskens RK, Mak M, Meuwissen SGM, Vandenbroucke-Grauls CMJE, Savelkoul PHM. Quantification of bacteria adherent to gastrointestinal mucosa by real-time PCR. J Clin Microbiol. 2002;40: 4423–4427. doi: 10.1128/JCM.40.12.4423-4427.2002 . [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Rinttilä T, Kassinen A, Malinen E, Krogius L, Palva A. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J Appl Microbiol. 2004;97: 1166–1177. doi: 10.1111/j.1365-2672.2004.02409.x . [DOI] [PubMed] [Google Scholar]
30.Nakayama T, Oishi K. Influence of coffee (Coffea arabica) and galacto-oligosaccharide consumption on intestinal microbiota and the host responses. FEMS Microbiol Lett. 2013;343: 161–168. doi: 10.1111/1574-6968.12142 . [DOI] [PubMed] [Google Scholar]
31.Haarman M, Knol J. Quantitative real-time PCR analysis of fecal Lactobacillus species in infants receiving a prebiotic infant formula. Appl Environ Microbiol. 2006;72: 2359–2365. doi: 10.1128/AEM.72.4.2359-2365.2006 . [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Layton A, McKay L, Williams D, Garrett V, Gentry R, Sayler G. Development of Bacteroides 16S rRNA gene taqman-based real-time PCR assays for estimation of total, human, and bovine fecal pollution in water. Appl Environ Microbiol. 2006;72: 4214–4224. doi: 10.1128/AEM.01036-05 . [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Talarico ST, Santos FE, Brandt KG, Martinez MB, Taddei CR. Anaerobic bacteria in the intestinal microbiota of Brazilian children. Clinics. 2017;72: 154–160. doi: 10.6061/clinics/2017(03)05 . [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001;25: 402–408. doi: 10.1006/meth.2001.1262 . [DOI] [PubMed] [Google Scholar]
35.Peinnequin A, Mouret C, Birot O, Alonso A, Mathieu J, Clarençon D, et al. Rat pro-inflammatory cytokine and cytokine related mRNA quantification by real-time polymerase chain reaction using SYBR green. BMC Immunol. 2004;5: 1–10. doi: 10.1186/1471-2172-5-1 . [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Di Liddo R, Bertalot T, Schuster A, Schrenk S, Tasso A, Zanusso I, et al. Anti-inflammatory activity of Wnt signaling in enteric nervous system: In vitro preliminary evidences in rat primary cultures. J Neuroinflammation. 2015;12: 1–19. doi: 10.1186/s12974-015-0248-1 . [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Wang Q, Du F, Qian Z-M, Ge XH, Zhu L, Yung WH, et al. Lipopolysaccharide Induces a Significant Increase in Expression of Iron Regulatory Hormone Hepcidin in the Cortex and Substantia Nigra in Rat Brain. Endocrinology. 2008;149: 3920–3925. doi: 10.1210/en.2007-1626 . [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Choi BK, Park SB, Lee DR, Lee HJ, Jin YY, Yang SH, et al. Green coffee bean extract improves obesity by decreasing body fat in high-fat diet-induced obese mice. Asian Pac J Trop Med. 2016;9: 635–643. doi: 10.1016/j.apjtm.2016.05.017 . [DOI] [PubMed] [Google Scholar]
39.Alristina AD, Adi AC, Ismawati R. The Effect of Green Coffee Bean Extract on The Weight Rats with High Fat Diet. Health Notions. 2018;2: 446–449. Available from: http://heanoti.com/index.php/hn/article/view/hn20408/163. [Google Scholar]
40.Rustandi F, Aman IGM, Pinatih GNI. Administration of bali arabica (Coffea arabica) coffee extracts decreases abdominal fat and body weight in obese wistar rats (Rattus norvegicus). Indones J Anti-Aging Med. 2019;3. Available from: https://ijaam-unud.org/ojs/index.php/ijaam/article/view/97. [Google Scholar]
41.Vitaglione P, Mazzone G, Lembo V, D’Argenio G, Rossi A, Guido M, et al. Coffee prevents fatty liver disease induced by a high-fat diet by modulating pathways of the gut-liver axis. J Nutr Sci. 2019;8: 1–11. doi: 10.1017/jns.2019.10 . [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Ilmiawati C, Fitri F, Rofinda ZD, Reza M. Green coffee extract modifies body weight, serum lipids and TNF-α in high-fat diet-induced obese rats. BMC Res Notes. 2020;13: 1–5. doi: 10.1186/s13104-019-4871-2 . [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Murase T, Yokoi Y, Misawa K, Ominami H, Suzuki Y, Shibuya Y, et al. Coffee polyphenols modulate whole-body substrate oxidation and suppress postprandial hyperglycaemia, hyperinsulinaemia and hyperlipidaemia. Br J Nutr. 2012;107: 1757–1765. doi: 10.1017/S0007114511005083 . [DOI] [PubMed] [Google Scholar]
44.Liu J, He Z, Ma N, Chen ZY. Beneficial Effects of Dietary Polyphenols on High-Fat Diet-Induced Obesity Linking with Modulation of Gut Microbiota. J Agric Food Chem. 2020; 33–47. doi: 10.1021/acs.jafc.9b06817 . [DOI] [PubMed] [Google Scholar]
45.Farias-Pereira R, Park CS, Park Y. Mechanisms of action of coffee bioactive components on lipid metabolism. Food Sci Biotechnol. Food SciBiotechnol. 2019; 1287–1296. doi: 10.1007/s10068-019-00662-0 . [DOI] [PMC free article] [PubMed] [Google Scholar]
46.An Y, Xu W, Li H, Lei H, Zhang L, Hao F, et al. High-fat diet induces dynamic metabolic alterations in multiple biological matrices of rats. J Proteome Res. 2013;12: 3755–3768. doi: 10.1021/pr400398b . [DOI] [PubMed] [Google Scholar]
47.Mercer JG, Archer ZA. Putting the diet back into diet-induced obesity: Diet-induced hypothalamic gene expression. Eur J Pharmacol. 2008; 31–37. doi: 10.1016/j.ejphar.2007.11.077 . [DOI] [PubMed] [Google Scholar]
48.La Fleur SE, Van Rozen AJ, Luijendijk MCM, Groeneweg F, Adan RAH. A free-choice high-fat high-sugar diet induces changes in arcuate neuropeptide expression that support hyperphagia. Int J Obes. 2010;34: 537–546. doi: 10.1038/ijo.2009.257 . [DOI] [PubMed] [Google Scholar]
49.de Carvalho Marchesin J, Celiberto LS, Orlando AB, de Medeiros AI, Pinto RA, Zuanon JAS, et al. A soy-based probiotic drink modulates the microbiota and reduces body weight gain in diet-induced obese mice. J Funct Foods. 2018;48: 302–313. doi: 10.1016/j.jff.2018.07.010 [DOI] [Google Scholar]
50.Farah A, Duarte G. Bioavailability and Metabolism of Chlorogenic Acids from Coffee. In: Preedy VR, editor. Coffee in Health and Disease Prevention. Amsterdam: Elsevier Inc.; 2014. pp. 789–801. doi: [DOI] [Google Scholar]
51.Rendón MY, dos Santos Scholz MB, Bragagnolo N. Is cafestol retained on the paper filter in the preparation of filter coffee? Food Res Int. 2017;100: 798–803. doi: 10.1016/j.foodres.2017.08.013 . [DOI] [PubMed] [Google Scholar]
52.da Cruz RG, Vieira TMF de S, de LIRA SP. Potential antioxidant of brazilian coffee from the region of cerrado. Food Sci Technol. 2018;38: 447–453. doi: 10.1590/1678-457x.08017 [DOI] [Google Scholar]
53.Nora CD, Müller CDR, de Bona GS, Rios A de O, Hertz PF, Jablonski A, et al. Effect of processing on the stability of bioactive compounds from red guava (Psidium cattleyanum Sabine) and guabiju (Myrcianthes pungens). J Food Compos Anal. 2014;34: 18–25. doi: 10.1016/j.jfca.2014.01.006 [DOI] [Google Scholar]
54.Wojdyło A, Figiel A, Legua P, Lech K, Carbonell-Barrachina ÁA, Hernández F. Chemical composition, antioxidant capacity, and sensory quality of dried jujube fruits as affected by cultivar and drying method. Food Chem. 2016;207: 170–179. doi: 10.1016/j.foodchem.2016.03.099 . [DOI] [PubMed] [Google Scholar]
55.Maki C, Funakoshi-Tago M, Aoyagi R, Ueda F, Kimura M, Kobata K, et al. Coffee extract inhibits adipogenesis in 3T3-L1 preadipocyes by interrupting insulin signaling through the downregulation of IRS1. PLoS One. 2017;12: 1–19. doi: 10.1371/journal.pone.0173264 . [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Feyisa TO, Melka DS, Menon M, Labisso WL, Habte ML. Investigation of the effect of coffee on body weight, serum glucose, uric acid and lipid profile levels in male albino Wistar rats feeding on high-fructose diet. Lab Anim Res. 2019;35: 1–8. doi: 10.1186/s42826-019-0005-1 . [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Shokouh P, Jeppesen PB, Christiansen CB, Mellbye FB, Hermansen K, Gregersen S. Efficacy of Arabica Versus Robusta Coffee in Improving Weight, Insulin Resistance, and Liver Steatosis in a Rat Model of Type-2 Diabetes. Nutrients. 2019;11: 2074. doi: 10.3390/nu11092074 . [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Duarte SM da S, Abreu CMP de, Menezes HC de, Paula FB de A, Pereira RGFA, Gouvêa CMCP. Peeled coffee brew effect in the antioxidant activity hematological and biochemical parameters in rats. Food Sci Technol. 2009;29: 703–708. doi: 10.1590/s0101-20612009000400001 [DOI] [Google Scholar]
59.Karabudak E, Türközü D, Köksal E. Association between coffee consumption and serum lipid profile. Exp Ther Med. 2015;9: 1841–1846. doi: 10.3892/etm.2015.2342 Epub 2015 Mar 11. . [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Fielding CJ, Fielding PE. Molecular physiology of reverse cholesterol transport. J Lipid Res. 1995; 211–228. doi: 10.1016/s0022-2275(20)39898-9 . [DOI] [PubMed] [Google Scholar]
61.Millar CL, Duclos Q, Blesso CN. Effects of dietary flavonoids on reverse cholesterol transport, HDL metabolism, and HDL function. Adv Nutr. 2017;8(2): 226–239. doi: 10.3945/an.116.014050 . [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Burke MF, Khera AV, Rader DJ. Polyphenols and cholesterol efflux: Is coffee the next red wine? Cir Res. 2010;106(4): 627–629. doi: 10.1161/CIRCRESAHA.109.215855 . [DOI] [PMC free article] [PubMed] [Google Scholar]
63.Luo J, Yang H, Song BL. Mechanisms and regulation of cholesterol homeostasis. Nat Rev Mol Cell Biol. 2020;21(4): 225–245. doi: 10.1038/s41580-019-0190-7 . [DOI] [PubMed] [Google Scholar]
64.Yokota A, Fukiya S, Islam KBMS, Ooka T, Ogura Y, Hayashi T, et al. Is bile acid a determinant of the gut microbiota on a high-fat diet? Gut Microbes. 2012;3: 455–459. doi: 10.4161/gmic.21216 . [DOI] [PubMed] [Google Scholar]
65.Lin H, An Y, Tang H, Wang Y. Alterations of Bile Acids and Gut Microbiota in Obesity Induced by High Fat Diet in Rat Model. J Agric Food Chem. 2019;67: 3624–3632. doi: 10.1021/acs.jafc.9b00249 . [DOI] [PubMed] [Google Scholar]
66.Ajouz H, Mukherji D, Shamseddine A. Secondary bile acids: An underrecognized cause of colon cancer. World J Surg Oncol. 2014;12: 1–5. doi: 10.1186/1477-7819-12-1 . [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Ocvirk S, O’Keefe SJ. Influence of Bile Acids on Colorectal Cancer Risk: Potential Mechanisms Mediated by Diet-Gut Microbiota Interactions. Cur Nutr Rep. 2017;6(4): 315–322. doi: 10.1007/s13668-017-0219-5 . [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Ontawong A, Duangjai A, Muanprasat C, Pasachan T, Pongchaidecha A, Amornlerdpison D, et al. Lipid-lowering effects of Coffea arabica pulp aqueous extract in Caco-2 cells and hypercholesterolemic rats. Phytomedicine. 2019;52: 187–197. doi: 10.1016/j.phymed.2018.06.021 . [DOI] [PubMed] [Google Scholar]
69.Santos RMM, Lima DRA. Coffee consumption, obesity and type 2 diabetes: a mini-review. Eur J Nutr. 2016;55(4): 1345–1358. doi: 10.1007/s00394-016-1206-0 . [DOI] [PubMed] [Google Scholar]
70.Li Y, Rahman SU, Huang Y, Zhang Y, Ming P, Zhu L, et al. Green tea polyphenols decrease weight gain, ameliorate alteration of gut microbiota, and mitigate intestinal inflammation in canines with high-fat-diet-induced obesity. J Nutr Biochem. 2020;78: 108324–108332. doi: 10.1016/j.jnutbio.2019.108324 . [DOI] [PubMed] [Google Scholar]
71.Jin J-S, Touyama M, Hisada T, Benno Y. Effects of green tea consumption on human fecal microbiota with special reference to Bifidobacterium species. Microbiol Immunol. 2012;56: 729–739. doi: 10.1111/j.1348-0421.2012.00502.x . [DOI] [PubMed] [Google Scholar]
72.Kim YA, Keogh JB, Clifton PM. Polyphenols and Glycemic Control. Nutrients. 2016;8(1): 1–27. doi: 10.3390/nu8010017 . [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Cao SY, Zhao CN, Xu XY, Tang GY, Corke H, Gan RY, et al. Dietary plants, gut microbiota, and obesity: Effects and mechanisms. Trends Food Sci Tech. 2019;92: 194–204. doi: 10.1016/j.tifs.2019.08.004 [DOI] [Google Scholar]
74.Rossi E, Cimdins A, Lüthje P, Brauner A, Sjöling Å, Landini P, et al. “It’s a gut feeling”—Escherichia coli biofilm formation in the gastrointestinal tract environment. Cr Rev Microbiol. 2018;44(1): 1–30. pp. 1–30. doi: 10.1080/1040841X.2017.1303660 . [DOI] [PubMed] [Google Scholar]
75.Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, Sargent M, et al. Diversity of the human intestinal microbial flora. Science. 2005;308: 1635–1638. doi: 10.1126/science.1110591 . [DOI] [PMC free article] [PubMed] [Google Scholar]
76.Million M, Thuny F, Angelakis E, Casalta JP, Giorgi R, Habib G, et al. Lactobacillus reuteri and Escherichia coli in the human gut microbiota may predict weight gain associated with vancomycin treatment. Nutr Diabetes. 2013;3: e87–e87. doi: 10.1038/nutd.2013.28 . [DOI] [PMC free article] [PubMed] [Google Scholar]
77.Dadi PK, Ahmad M, Ahmad Z. Inhibition of ATPase activity of Escherichia coli ATP synthase by polyphenols. Int J Biol Macromol. 2009;45: 72–79. doi: 10.1016/j.ijbiomac.2009.04.004 . [DOI] [PubMed] [Google Scholar]
78.Pagliarulo C, De Vito V, Picariello G, Colicchio R, Pastore G, Salvatore P, et al. Inhibitory effect of pomegranate (Punica granatum L.) polyphenol extracts on the bacterial growth and survival of clinical isolates of pathogenic Staphylococcus aureus and Escherichia coli. Food Chem. 2016;190: 824–831. doi: 10.1016/j.foodchem.2015.06.028 . [DOI] [PubMed] [Google Scholar]
79.Karar MGE, Pletzer D, Jaiswal R, Weingart H, Kuhnert N. Identification, characterization, isolation and activity against Escherichia coli of quince (Cydonia oblonga) fruit polyphenols. Food Res Int. 2014;65: 121–129. doi: 10.1016/j.foodres.2013.10.040 [DOI] [Google Scholar]
80.Al-Assal K, Martinez AC, Torrinhas RS, Cardinelli C, Waitzberg D. Gut microbiota and obesity. Clin Nutr Exp. 2018;20: 60–64. doi: 10.1016/j.yclnex.2018.03.001 [DOI] [Google Scholar]
81.Matsumoto M, Kibe R, Ooga T, Aiba Y, Kurihara S, Sawaki E, et al. Impact of intestinal microbiota on intestinal luminal metabolome. Sci Rep. 2012;2: 1–10. doi: 10.1038/srep00233 . [DOI] [PMC free article] [PubMed] [Google Scholar]
82.Jandhyala SM, Talukdar R, Subramanyam C, Vuyyuru H, Sasikala M, Reddy DN. Role of the normal gut microbiota. World J Gastroenterol. 2015;21: 8787–8803. doi: 10.3748/wjg.v21.i29.8787 . [DOI] [PMC free article] [PubMed] [Google Scholar]
83.Price CE, Reid SJ, Driessen AJM, Abratt VR. The Bifidobacterium longum NCIMB 702259T ctr gene codes for a novel cholate transporter. Appl Environ Microbiol. 2006;72: 923–926. doi: 10.1128/AEM.72.1.923-926.2006 . [DOI] [PMC free article] [PubMed] [Google Scholar]
84.Ruiz L, Zomer A, O’Connell-Motherway M, van Sinderen D, Margolles A. Discovering novel bile protection systems in Bifidobacterium breve UCC2003 through functional genomics. Appl Environ Microbiol. 2012;78: 1123–1131. doi: 10.1128/AEM.06060-11 . [DOI] [PMC free article] [PubMed] [Google Scholar]
85.Ruiz L, O’Connell-Motherway M, Zomer A, de los Reyes-Gavilán CG, Margolles A, van Sinderen D. A bile-inducible membrane protein mediates bifidobacterial bile resistance. Microb Biotechnol. 2012;5: 523–535. doi: 10.1111/j.1751-7915.2011.00329.x . [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Fernández-Real JM, Ricart W. Insulin resistance and chronic cardiovascular inflammatory syndrome. Endocr Rev. 2003;24: 278–301. doi: 10.1210/er.2002-0010 . [DOI] [PubMed] [Google Scholar]
87.Hang D, Kværner AS, Ma W, Hu Y, Tabung FK, Nan H, et al. Coffee consumption and plasma biomarkers of metabolic and inflammatory pathways in US health professionals. Am J Clin Nutr. 2019;109: 635–647. doi: 10.1093/ajcn/nqy295 . [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Kittana H, Gomes-Neto JC, Heck K, Geis AL, Segura Muñoz RR, Cody LA, et al. Commensal Escherichia coli Strains can promote intestinal inflammation via differential interleukin-6 production. Front Immunol. 2018;9: 2318–2330. doi: 10.3389/fimmu.2018.02318 . [DOI] [PMC free article] [PubMed] [Google Scholar]
89.Wang S, Moustaid-Moussa N, Chen L, Mo H, Shastri A, Su R, et al. Novel insights of dietary polyphenols and obesity. J Nutr Biochem. 2014;25: 1–18. doi: 10.1016/j.jnutbio.2013.09.001 . [DOI] [PMC free article] [PubMed] [Google Scholar]
90.Juge-Aubry CE, Henrichot E, Meier CA. Adipose tissue: A regulator of inflammation. Best Pract Res Cli Endocrinol Metab. 2005;19: 547–566. doi: 10.1016/j.beem.2005.07.009 . [DOI] [PubMed] [Google Scholar]
91.Caro-Gómez E, Sierra J, Escobar J, Álvarez-Quintero R, Naranjo M, Medina S, et al. Green Coffee Extract Improves Cardiometabolic Parameters and Modulates Gut Microbiota in High-Fat-Diet-Fed ApoE-/- Mice. Nutrients. 2019;11: 497–518. doi: 10.3390/nu11030497 . [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0262270.r001

Decision Letter 0

Jane Foster

14 Sep 2021

PONE-D-21-14462Effect of freeze-dried coffee solution in a high-fat diet-induced obesity model in rats: biochemical and inflammatory impacts and effects on gut microbiotaPLOS ONE

Dear Dr. Cavalcanti,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

In addition to the reviewer's comments found below. Please also address the following editorial comments:

Abstract should be revised and detailed methods removed.
Rationale for targeted bacterial taxa should be provided in the introduction.
Table 1, 2 – why are the values for the 2 treatments averaged? This data should be removed. Please provide ANOVA data (F and df) for main effects. What posthoc comparison was used?

Please submit your revised manuscript by Oct 29 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Jane Foster, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

"Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: No

Reviewer #3: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: 1. INTRODUCTION 1: Paragraph of introduction should reveal the strength and interest topic as a background why this topic coffee: constituents and health benefit discussed. The tradition of coffee consumption can be the reason for this discussion (include: what, who, where, when, why and how). Introduction should decide about specific topic that will be discussed on the paper. Started from general facts and issues as a background, to the specific issues.

2. INTRODUCTION 2: Paragraph should be arranged in a continuous and related way, for example in one paragraph what is an explanatory sentence is really explaining the main sentence. The main sentence explains about obesity in rat, but experiment only made the rats severe dyslipidemia. Explaining about do they severe obesity after given high fat diet. the research should show that the coffee method serving affected to the body weight. You need to concern with body weight (as your reason for obesity) or only dylipedemia by testing profil lipid level on your research.

3. METHOD: animal weight before experiment were in similar condition (normal)

4. Conclusion: Add more about the negativity of excessive coffee consumption in the last line so readers know about the importance of limiting coffee consumption in addition to the benefits that might arise. Add more about contraindication of coffee consumption (positivity and negativity) for each methods as a suggestion for readers which method of the coffee they will consume.

Reviewer #2: The abstract is too long, please short it.

Most of the data show that FCS was not effective in controlling obesity. I doubt that the consumption of FCS may have no positive health effect in rats fed with a high-fat diet.

Reviewer #3: In this study, freeze-dried coffee solution consumption was used to investigate physiological parameters, lipid profile, and microbiota during obesity induction in rats by a high-fat diet. The language of the manuscript is not very good and needs to be strengthened. References must be refreshed, some of them are too old. Results seem to be free from apparent manipulation, it is necessary to compare yours with similar studies. The sequence number of the figure is confused. How to conduct dietary intervention for animals? How to determine that the provided feed has been completely consumed by the animal? How to determine the amount of freeze-dried coffee added? Why choose 3.9 g?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Arie Dwi Alristina

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: PONE-D-21-14462.pdf

Click here for additional data file.^{(1.6MB, pdf)}

PLoS One. 2022 Jan 26;17(1):e0262270. doi: 10.1371/journal.pone.0262270.r002

Author response to Decision Letter 0

21 Oct 2021

Brasilia, October 18, 2021

To: Jane Foster, PhD

Academic Editor

PLOS ONE

Subject: Revised version of the manuscript PONE-D-21-14462

Dear Ph.D. Jane Foster,

Thank you for the opportunity to submit a revised version of our manuscript “Effect of a freeze-dried coffee solution in a high-fat diet-induced obesity model in rats: biochemical and inflammatory impacts and effects on gut microbiota”. Below are the responses to each point brought up by reviewers #1, #2, and #3. Some changes made were marked in the revised manuscript copy and the answers to some reviewer’s questions are presented below. We appreciate and thank the reviewers for their comments and suggestions.

Yours sincerely,

Marilia Hermes Cavalcanti

Postgraduate Program in Human Nutrition, Faculty of Health Sciences, Campus Universitário Darcy Ribeiro, Universidade de Brasília, Brasília, POBox 70910-900, Brazil. Phone +(55) - 61 - 31070092 e-mail: mariliaunb@outlook.com

In addition to the reviewer's comments found below. Please also address the following editorial comments:

1. Abstract should be revised and detailed methods removed.

The abstract was revised.

2. Rationale for targeted bacterial taxa should be provided in the introduction.

A summary paragraph describing the rationale for the targets bacterial taxa were included in the introduction section. Page 4, line 79-92 (file ‘Manuscript’).

3. Table 1, 2 – why are the values for the 2 treatments averaged? This data should be removed. Please provide ANOVA data (F and df) for main effects. What posthoc comparison was used?

We consider that these comments refer to tables 3 and 4, not to tables 1 and 2 which present the sequence of primers. The values presented in tables 3 and 4 refer to the least-square means estimated by the SAS for the combination of factors and each studied factor (coffee and diet). After performing the analysis of variance using the F test, when analyzing the p-value of the variables expressed in tables 3 and 4, it was found that there was no significant effect for the interaction of the studied factors (coffee ᵡ diet). There was only a significant effect (p < 0.05) for one of the factors or there was no significant effect (p >0.05) for the factors studied on the variables presented in tables 3 and 4. Therefore, the letters that indicate the differences of only one factor must be overwritten in the estimated least-squares means for each factor, regardless of the interaction. As within each factor, there are only two levels (coffee, with (+) or without (-) and diet, control (CT+) or high-fat diet (HF+), the F test itself demonstrates the difference, there is no need for a posthoc test, as shown in tables 3 and 4.

Reviewers' comments:

Reviewer #1:

1. INTRODUCTION 1: Paragraph of introduction should reveal the strength and interest topic as a background why this topic coffee: constituents and health benefit discussed. The tradition of coffee consumption can be the reason for this discussion (include: what, who, where, when, why, and how). Introduction should decide about specific topic that will be discussed on the paper. Started from general facts and issues as a background, to the specific issues.

The introduction has been extensively modified and organized according to the reviewer suggestions.

2. INTRODUCTION 2: Paragraph should be arranged in a continuous and related way, for example in one paragraph what is an explanatory sentence is really explaining the main sentence. The main sentence explains about obesity in rat, but experiment only made the rats severe dyslipidemia. Explaining about do they severe obesity after given high fat diet. the research should show that the coffee method serving affected to the body weight. You need to concern with body weight (as your reason for obesity) or only dyslipidemia by testing profile lipid level on your research.

The introduction has been extensively modified and organized according to the reviewer suggestions.

3. METHOD: animal weight before experiment were in similar condition (normal)

The animals used in the experiment had an initial mean body weight of 67.37 ± 6.04g. The precision of an experiment can be increased considerably by equalizing potential sources of error between the different treatments to be compared. Thus, the alternative is to measure the factors that are relevant to the precision of the experiment in order to try to correct the influence exerted on the response variable (Fisher, 1934).

In this context, analysis of covariance allows adjusting the effect of a response variable that was influenced by a variable or an uncontrolled source of variation, combining two widely applied procedures: analysis of variance (ANOVA) and regression (Fisher, 1934). The variable measured in the initial condition of the experimental unit is an auxiliary variable, also called a concomitant variable or covariate (Cochran, 1957). It is important to emphasize that the covariate needs to be correlated with the response variable and it must be ensured that it is not affected by the treatment so that this analysis can be used. As an example, there is the situation in which there are animals with different initial weights and a response variable of interest is the final weight of the animals (Fisher, 1934).

Thus, the consideration of some predictable effects, such as the initial weight of the animal, is intended to allow the animals to be compared and evaluated under equal conditions, since the final weight of the animals, in this study, is a variable response of interest.

The use of covariates in studies allows to increase the precision of randomized experiments, clarify the nature of treatment effects, adjust regressions in multiple classifications, among other advantages (Cochran, 1957).

In the materials and methods section, page 11 line 255-256 (file ‘Manuscript’) is described that the animals' initial weight was used as a covariate in the statistical analysis.

Cochran, W. G., 1957. Analysis of covariance: Its nature and uses. Biometrics 13 (3): 261–281.

Fisher, R. A., 1934. Statistical Methods for Research Workers. Oliver and Boyld Ltd.

This reviewer suggestion was included on page 28 line 595-599 (file ‘Manuscript’).

Reviewer #2:

1. The abstract is too long, please short it.

During the building of the manuscript in PDF format, there was an error, and the abstract was presented twice. This may have caused some confusion about the length of the abstract as it contains 210 words. Anyway, the abstract was shortened, especially in the introduction and the methods were removed.

2. Most of the data show that FCS was not effective in controlling obesity. I doubt that the consumption of FCS may have no positive health effect in rats fed with a high-fat diet.

The consumption of FCS promoted some positive health effects as described in the manuscript. FCS consumption increased Bifidobacterium populations and HDL-c reverse cholesterol transport to tissues and reduced Il1b mRNA levels.

The lack of a significant effect of coffee on body weight gain of rats fed with a high-fat diet seems to be explained by the reduced food intake presented by the high-fat diet rats during the 8-week treatment period, associated with the short period of treatment (8 weeks) and the studied sample composed by newly weaned rats. These variables seem to have attenuated weight gain and dyslipidemia and may justify the lack of some positive health effects of coffee. The growth curve of the rats (figure presented in the file 'Response to Reviewers') clearly shows that only after 3 weeks of treatment high-fat fed rats begin to present a significantly higher body weight gain than control rats. Also is possible to note that only after 7 weeks of treatment the growth curve of the HF (+) group no longer appears superimposed to that of HF (-) group, suggesting that a longer time of treatment could exacerbate the obesity state and consequently the possible positive effect of coffee on body weight.

The literature shows that the treatment with coffee for periods longer than 8 weeks [Cowan et al 2014, Vitaglione et al, 2019] and samples composed of adult animals instead of newly weaned animals [Ilmiawati et al 2020, Rustandi et al, 2019] seem to promote a more pronounced obesity state and a consequently higher impact of coffee on body weight and lipid profile.

Cowan, T. E., Palmnäs, M. S., Yang, J., Bomhof, M. R., Ardell, K. L., Reimer, R. A., Vogel, H. J., Shearer, J. Chronic coffee consumption in the diet-induced obese rat: impact on gut microbiota and serum metabolomics. The Journal of nutritional biochemistry. 2014; v. 25, n. 4, p. 489–495.

Vitaglione P, Mazzone G, Lembo V, D'Argenio G, Rossi A, Guido M, Savoia M, Salomone F, Mennella I, De Filippis F, Ercolini D, Caporaso N, Morisco F. Coffee prevents fatty liver disease induced by a high-fat diet by modulating pathways of the gut-liver axis. J Nutr Sci. 2019 Apr 22;8:e15. doi: 10.1017/jns.2019.10. PMID: 31037218; PMCID: PMC6477661.

Ilmiawati C, Fitri F, Rofinda ZD, Reza M. Green coffee extract modifies body weight, serum lipids, and TNF-α in high-fat diet-induced obese rats. BMC Res Notes 2020;13. https://doi.org/10.1186/s13104-020-05052-y

Rustandi F, Aman IGM, Pinatih GNI. Administration of bali arabica (Coffea arabica) coffee extracts decreases abdominal fat and body weight in obese Wistar rats (Rattus norvegicus). Indones J Anti-Aging Med 2019;3

Figure (in the file 'Response to Reviewers'): Body weight of rats treated with control (CT) or high-fat (HF) diet added (+) or not (-) of coffee. CT (-) control diet AIN-93G; CT (+) control diet + coffee; HF (-) high-fat diet; HF (+) high-fat diet + coffee. Values are means ± S.E., n = 7/group. * P < 0.05 for control vs. high-fat diet.

Reviewer #3:

1. The language of the manuscript is not very good and needs to be strengthened.

The language of the manuscript was revised by a native English speaker specialized in editing research manuscripts. The two certificate of English editing (first and second reviews) is attached in the file 'Response to Reviewers'.

2. References must be refreshed, some of them are too old.

We try to refresh the references. The older references, such as 29 and 40, refer to traditional methodologies that have not been updated so far.

3. The sequence number of the figure is confused.

The sequence number of the figure was corrected in the text.

5. How to conduct dietary intervention for animals? How to determine that the provided feed has been completely consumed by the animal?

Daily, in the afternoon, the amount of feed to be provided was weighed and in the morning of the next day, feed rest was weighed. The difference between the amount of feed provided and the amount of feed rest was considered as feed intake.

This data was described in the text on page 6, line 148-149 (file ‘Manuscript’).

7. How to determine the amount of freeze-dried coffee added? Why choose 3.9 g?

The requested explanations were included in the manuscript in the section material and methods subitem “2.1. Preparation of freeze-dried coffee solution” on page 5, line 119-128 (file ‘Manuscript’).

The amount of coffee solution added to rats’ diet was defined considering the estimated average usual daily coffee intake of 163mL and the usual food amount of 1,290g consumed by the Brazilian population. Considering a mean daily amount of food consumed by an adult rat of 25g, the equivalent dose estimated for rats’ average coffee intake would be 3.15mL/day, resulting in a 126mL coffee/kg diet. After the freeze-drying process, 126mL of 10% coffee solution yielded 3.9g of powder. The freeze-dried coffee solution was mixed with the other diet components until obtaining a homogenous mixture, and subsequently hydrated and pelleted.

Attachment

Submitted filename: Reviewer Answer 16102021.docx

Click here for additional data file.^{(188KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0262270.r003

Decision Letter 1

Baochuan Lin

1 Dec 2021

PONE-D-21-14462R1Effect of a freeze-dried coffee solution in a high-fat diet-induced obesity model in rats: biochemical and inflammatory impacts and effects on gut microbioPLOS ONE

Dear Dr. Cavalcanti,

The revised manuscript showed significant improvement, however, there are still several issues that need to be addressed. Please see specific comments below. In addition, the quality of the language needs to be improved. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services. If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.

Specific comments:

1. Line 38, replace "Independently" with "Regardless".

2. Line 126, change "Coffea arabica" to "C. arabica".

3. Line 127 - 128, there are 4 numbers here with only 3 caffeoylquinic acid listed. Please clarify.

4. Line 132, replace "n°" with "no."

5. Line 176 - 177, change "San Luis" to "St. Louis".

6. Line 199, This is confusing. Is 10μl the total reaction volume? Please rephrase for clarity.

7. Line 211 - 214, please follow scientific nomenclature rules and use abbreviation here since these bacteria were mentioned earlier. For example: E. coli, E. faecalis, B. lactis, & L. plantarum.

8. Line 407, change "independently" to "independent"

9. Line 445, change “Coffeea” to “C.”

10. Line 530, change "pathogen bacteria" to pathogenic bacteria"

11. Line 558 - 559, replace “Bifidobacterium” to “B.”

12. Line 597 - 599, the statement "..., while some health..." was not supported by the data presented, please delete.

Please submit your revised manuscript by Jan 15 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Baochuan Lin, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #4: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #4: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #4: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #4: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #4: Yes

**********

6. Review Comments to the Author

Reviewer #4: The authors have determined the effect of FCS on on the physiological parameters, lipid profile, and microbiota in the HF-diet-fed rats. For this version, the comments are addressed carefully and is recommended for publication.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #4: No

PLoS One. 2022 Jan 26;17(1):e0262270. doi: 10.1371/journal.pone.0262270.r004

Author response to Decision Letter 1

20 Dec 2021

Dear PhD Baochuan Lin,

Thank you by the opportunity to submit a revised version of our manuscript “Effect of freeze-dried coffee solution in a high-fat diet-induced obesity model in rats: biochemical and inflammatory impacts and effects on gut microbiota”. Below are the responses to each specific comment brought up. All changes made were marked on the revised manuscript copy, and the answers to editor questions are presented below. According to editor suggestion, the manuscript was copy edited for language usage, spelling, and grammar by Editage (editage.com.br). In the file "Response to Reviewers" is the Editing Certificate issued by Editage.

Yours sincerely,

Marilia Cavalcanti, M.Sc.

Corresponding author

Editor specific comments:

Specific comments:

1. Line 38, replace "Independently" with "Regardless". Accepted.

2. Line 126, change "Coffea arabica" to "C. arabica". Accepted.

3. Line 127 - 128, there are 4 numbers here with only 3 caffeoylquinic acid listed. Please clarify. It was revised.

4. Line 132, replace "n°" with "no." It was revised.

5. Line 176 - 177, change "San Luis" to "St. Louis". Accepted.

6. Line 199, This is confusing. Is 10μl the total reaction volume? Please rephrase for clarity. It was revised.

7. Line 211 - 214, please follow scientific nomenclature rules and use abbreviation here since these bacteria were mentioned earlier. For example: E. coli, E. faecalis, B. lactis, & L. plantarum. It was revised.

8. Line 407, change "independently" to "independent" It was revised.

9. Line 445, change “Coffeea” to “C.” Accepted.

10. Line 530, change "pathogen bacteria" to pathogenic bacteria" It was revised.

11. Line 558 - 559, replace “Bifidobacterium” to “B.” Accepted.

12. Line 597 - 599, the statement "..., while some health..." was not supported by the data presented, please delete. It was deleted.

Attachment

Submitted filename: Letter Editor.docx

Click here for additional data file.^{(674.7KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0262270.r005

Decision Letter 2

Baochuan Lin

21 Dec 2021

Effect of a freeze-dried coffee solution in a high-fat diet-induced obesity model in rats: impact on inflammatory response, lipid profile, and gut microbiota

PONE-D-21-14462R2

Dear Dr. Cavalcanti,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Baochuan Lin, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0262270.r006

Acceptance letter

Baochuan Lin

17 Jan 2022

PONE-D-21-14462R2

Effect of a freeze-dried coffee solution in a high-fat diet-induced obesity model in rats: impact on inflammatory response, lipid profile, and gut microbiota

Dear Dr. Cavalcanti:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Baochuan Lin

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

D: diet; FCS: freeze-dried coffee solution; T: time; SEM: standard error of the mean.

(DOCX)

Click here for additional data file.^{(15.5KB, docx)}

S1 Graphical abstract

(TIF)

Click here for additional data file.^{(545KB, tif)}

Attachment

Submitted filename: PONE-D-21-14462.pdf

Click here for additional data file.^{(1.6MB, pdf)}

Attachment

Submitted filename: Reviewer Answer 16102021.docx

Click here for additional data file.^{(188KB, docx)}

Attachment

Submitted filename: Letter Editor.docx

Click here for additional data file.^{(674.7KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0262270.ref001] 1.De Melo Pereira GV, de Carvalho Neto DP, Magalhães Júnior AI, do Prado FG, Pagnoncelli MGB, Karp SG, et al. Chemical composition and health properties of coffee and coffee by-products. Adv Food Nutr Res. 2020;91: 65–96. doi: 10.1016/bs.afnr.2019.10.002 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref002] 2.Lashermes P, Andrade AC, Etienne H. Genomics of Coffee One of the World’s Largest Traded Commodities. In: Moore Paul H, editor. Genomics of tropical crop plants. New York: Springer; 2008. pp. 203–226. doi: 10.1007/978-0-387-71219-2_9 [DOI] [Google Scholar]

[pone.0262270.ref003] 3.Shang F, Li X, Jiang X. Coffee consumption and risk of the metabolic syndrome: A meta-analysis. Diabetes Metab. 2016;42(2): 80–87. doi: 10.1016/j.diabet.2015.09.001 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref004] 4.Kim Y, Je Y. Moderate coffee consumption is inversely associated with the metabolic syndrome in the Korean adult population. Br J Nutr. 2018;120(11): 1279–1287. doi: 10.1017/S0007114518002635 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref005] 5.Bhandarkar NS, Mouatt P, Goncalves P, Thomas T, Brown L, Panchal SK. Modulation of gut microbiota by spent coffee grounds attenuates diet-induced metabolic syndrome in rats. FASEB J. 2020;34(3): 4783–4797. doi: 10.1096/fj.201902416RR Epub 2020 Feb 10. . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref006] 6.Alperet DJ, Rebello SA, Khoo EY, Tay Z, Seah SS, Tai BC, et al. The effect of coffee consumption on insulin sensitivity and other biological risk factors for type 2 diabetes: a randomized placebo-controlled trial. Am J Clin Nutr. 2020;111(2): 448–458. doi: 10.1093/ajcn/nqz306 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref007] 7.Moco S, Martin FP, Rezzi S. Metabolomics view on gut microbiome modulation by polyphenol-rich foods. J Proteome Res. 2012;11(10): 4781–4790. doi: 10.1021/pr300581s . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref008] 8.Wan MLY, Co VA, El-Nezami H. Dietary Polyphenol Impact On Gut Health And Microbiota. Crit Rev Food Sci Nutr. 2020;1–22. doi: 10.1080/10408398.2020.1744512 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref009] 9.Cowan TE, Palmnäs MS, Yang J, Bomhof MR, Ardell KL, Reimer RA, et al. Chronic coffee consumption in the diet-induced obese rat: impact on gut microbiota and serum metabolomics. J Nutr Biochem. 2014;25(4): 489–495. doi: 10.1016/j.jnutbio.2013.12.009 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref010] 10.Bäckhed F, Ding H, Wang T, Hooper LV, Koh GY, Nagy A, et al. The gut microbiota as an environmental factor that regulates fat storage. Proc Natl Acad Sci U S A.;101(44): 15718–23. doi: 10.1073/pnas.0407076101 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref011] 11.Bäckhed F, Manchester JK, Semenkovich CF, Gordon JI. Mechanisms underlying the resistance to diet-induced obesity in germ-free mice. Proc Natl Acad Sci U S A. 2007;104(3): 979–984. doi: 10.1073/pnas.0605374104 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref012] 12.Ley RE, Bäckhed F, Turnbaugh P, Lozupone CA, Knight RD, Gordon JI. Obesity alters gut microbial ecology. Proc Natl Acad Sci U S A. 2005;102(31): 11070–11075. Epub 2005 Jul 20. doi: 10.1073/pnas.0504978102 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref013] 13.Crovesy L, Masterson D, Rosado EL. Profile of the gut microbiota of adults with obesity: a systematic review. Eur J Clin Nutr. 2020;74(9): 1251–1262. doi: 10.1038/s41430-020-0607-6 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref014] 14.Arumugam M, Raes J, Pelletier E, Le Paslier D, Yamada T, Mende DR, et al. Enterotypes of the human gut microbiome. Nature. 2011;473: 174–180. doi: 10.1038/nature09944 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref015] 15.Ley RE, Turnbaugh PJ, Klein S, Gordon JI. Microbial ecology: Human gut microbes associated with obesity. Nature. 2006;444: 1022–1023. doi: 10.1038/4441022a . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref016] 16.Azad M, Sarker M, Li T, Yin J. Probiotic Species in the Modulation of Gut Microbiota: An Overview. Biomed Res Int. 2018; 1–8. doi: 10.1155/2018/9478630 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref017] 17.Drissi F, Merhej V, Angelakis E, El Kaoutari A, Carrie`re F, Henrissat B, et al. Comparative genomics analysis of Lactobacillus species associated with weight gain or weight protection. Nutr Diabetes. 2014; 1–8. doi: 10.1038/nutd.2014.6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref018] 18.Staley C, Weingarden AR., Khoruts A, Sadowsky MJ. Interaction of Gut Microbiota with Bile Acid Metabolism and its Influence on Disease States. Appl Microbiol Biotechnol. 2017;101(1): 47–64. doi: 10.1007/s00253-016-8006-6 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref019] 19.Joyce SA, MacSharry J, Casey PG., Kinsella M, Murphy EF, Shanahan F, et al. Regulation of Host Weight Gain and Lipid Metabolism by Bacterial Bile Acid Modification in the Gut. Proc Natl Acad Sci U S A. 2014; 111(20): 7421–7426. doi: 10.1073/pnas.1323599111 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref020] 20.Sousa AG, Da Costa THM. Usual coffee intake in Brazil: Results from the National Dietary Survey 2008–9. Br J Nutr. 2015;113: 1615–1620. doi: 10.1017/S0007114515000835 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref021] 21.Reis CEG, Paiva CLRDS, Amato AA, Lofrano-Porto A, Wassell S, Bluck LJC, et al. Decaffeinated coffee improves insulin sensitivity in healthy men. Br J Nutr. 2018;119: 1029–1038. doi: 10.1017/S000711451800034X . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref022] 22.National Research Council (US), Committee for the Update of the Guide for the Care and Use of Laboratory Animals. Guide for the Care and Use of Laboratory Animals. 8th ed. Washington (DC): The National Academy Press (US); 2011. 220 p. ISBN-13: 978-0-309-15400-0ISBN-10: 0-309-15400-6. doi: 10.1258/la.2010.010031 [DOI] [Google Scholar]

[pone.0262270.ref023] 23.Reeves PG, Nielsen FH, George C. Fahey J. AIN-93 Purified Diets for Laboratory Rodents: Final Report of the American Institute of Nutrition Ad Hoc Writing Committee on the Reformulation of the AIN-76A Rodent Diet. J Nutr. 1993;123: 1939–1951. doi: 10.1093/jn/123.11.1939 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref024] 24.Vieira VJ, Valentine RJ, Wilund KR, Woods JA. Effects of diet and exercise on metabolic disturbances in high-fat diet-fed mice. Cytokine. 2009;46: 339–345. doi: 10.1016/j.cyto.2009.03.006 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref025] 25.Kanemoto R, Kimura S, Okamura G. Cholesterol lowering effect of soybean lipophilic proteins associated with phospholipids in rat. Soy Protein Res. 2007;10: 83–87. [Google Scholar]

[pone.0262270.ref026] 26.Tamura M, Nakagawa H, Hori S, Suzuki T, Hirayama K. Plasma quercetin metabolites are affected by intestinal microbiota of human microbiota-associated mice fed with a quercetin-containing diet. J Clin Biochem Nutr. 2019;65(3): 232–239. doi: 10.3164/jcbn.19-45 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref027] 27.De-Souza MT, Brigido M de M, Maranhão AQ. Técnicas básicas em biologia molecular. 2nd ed. Brasília: EDU—University of Brasilia Press; 2016. [Google Scholar]

[pone.0262270.ref028] 28.Huijsdens XW, Linskens RK, Mak M, Meuwissen SGM, Vandenbroucke-Grauls CMJE, Savelkoul PHM. Quantification of bacteria adherent to gastrointestinal mucosa by real-time PCR. J Clin Microbiol. 2002;40: 4423–4427. doi: 10.1128/JCM.40.12.4423-4427.2002 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref029] 29.Rinttilä T, Kassinen A, Malinen E, Krogius L, Palva A. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J Appl Microbiol. 2004;97: 1166–1177. doi: 10.1111/j.1365-2672.2004.02409.x . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref030] 30.Nakayama T, Oishi K. Influence of coffee (Coffea arabica) and galacto-oligosaccharide consumption on intestinal microbiota and the host responses. FEMS Microbiol Lett. 2013;343: 161–168. doi: 10.1111/1574-6968.12142 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref031] 31.Haarman M, Knol J. Quantitative real-time PCR analysis of fecal Lactobacillus species in infants receiving a prebiotic infant formula. Appl Environ Microbiol. 2006;72: 2359–2365. doi: 10.1128/AEM.72.4.2359-2365.2006 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref032] 32.Layton A, McKay L, Williams D, Garrett V, Gentry R, Sayler G. Development of Bacteroides 16S rRNA gene taqman-based real-time PCR assays for estimation of total, human, and bovine fecal pollution in water. Appl Environ Microbiol. 2006;72: 4214–4224. doi: 10.1128/AEM.01036-05 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref033] 33.Talarico ST, Santos FE, Brandt KG, Martinez MB, Taddei CR. Anaerobic bacteria in the intestinal microbiota of Brazilian children. Clinics. 2017;72: 154–160. doi: 10.6061/clinics/2017(03)05 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref034] 34.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001;25: 402–408. doi: 10.1006/meth.2001.1262 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref035] 35.Peinnequin A, Mouret C, Birot O, Alonso A, Mathieu J, Clarençon D, et al. Rat pro-inflammatory cytokine and cytokine related mRNA quantification by real-time polymerase chain reaction using SYBR green. BMC Immunol. 2004;5: 1–10. doi: 10.1186/1471-2172-5-1 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref036] 36.Di Liddo R, Bertalot T, Schuster A, Schrenk S, Tasso A, Zanusso I, et al. Anti-inflammatory activity of Wnt signaling in enteric nervous system: In vitro preliminary evidences in rat primary cultures. J Neuroinflammation. 2015;12: 1–19. doi: 10.1186/s12974-015-0248-1 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref037] 37.Wang Q, Du F, Qian Z-M, Ge XH, Zhu L, Yung WH, et al. Lipopolysaccharide Induces a Significant Increase in Expression of Iron Regulatory Hormone Hepcidin in the Cortex and Substantia Nigra in Rat Brain. Endocrinology. 2008;149: 3920–3925. doi: 10.1210/en.2007-1626 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref038] 38.Choi BK, Park SB, Lee DR, Lee HJ, Jin YY, Yang SH, et al. Green coffee bean extract improves obesity by decreasing body fat in high-fat diet-induced obese mice. Asian Pac J Trop Med. 2016;9: 635–643. doi: 10.1016/j.apjtm.2016.05.017 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref039] 39.Alristina AD, Adi AC, Ismawati R. The Effect of Green Coffee Bean Extract on The Weight Rats with High Fat Diet. Health Notions. 2018;2: 446–449. Available from: http://heanoti.com/index.php/hn/article/view/hn20408/163. [Google Scholar]

[pone.0262270.ref040] 40.Rustandi F, Aman IGM, Pinatih GNI. Administration of bali arabica (Coffea arabica) coffee extracts decreases abdominal fat and body weight in obese wistar rats (Rattus norvegicus). Indones J Anti-Aging Med. 2019;3. Available from: https://ijaam-unud.org/ojs/index.php/ijaam/article/view/97. [Google Scholar]

[pone.0262270.ref041] 41.Vitaglione P, Mazzone G, Lembo V, D’Argenio G, Rossi A, Guido M, et al. Coffee prevents fatty liver disease induced by a high-fat diet by modulating pathways of the gut-liver axis. J Nutr Sci. 2019;8: 1–11. doi: 10.1017/jns.2019.10 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref042] 42.Ilmiawati C, Fitri F, Rofinda ZD, Reza M. Green coffee extract modifies body weight, serum lipids and TNF-α in high-fat diet-induced obese rats. BMC Res Notes. 2020;13: 1–5. doi: 10.1186/s13104-019-4871-2 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref043] 43.Murase T, Yokoi Y, Misawa K, Ominami H, Suzuki Y, Shibuya Y, et al. Coffee polyphenols modulate whole-body substrate oxidation and suppress postprandial hyperglycaemia, hyperinsulinaemia and hyperlipidaemia. Br J Nutr. 2012;107: 1757–1765. doi: 10.1017/S0007114511005083 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref044] 44.Liu J, He Z, Ma N, Chen ZY. Beneficial Effects of Dietary Polyphenols on High-Fat Diet-Induced Obesity Linking with Modulation of Gut Microbiota. J Agric Food Chem. 2020; 33–47. doi: 10.1021/acs.jafc.9b06817 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref045] 45.Farias-Pereira R, Park CS, Park Y. Mechanisms of action of coffee bioactive components on lipid metabolism. Food Sci Biotechnol. Food SciBiotechnol. 2019; 1287–1296. doi: 10.1007/s10068-019-00662-0 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref046] 46.An Y, Xu W, Li H, Lei H, Zhang L, Hao F, et al. High-fat diet induces dynamic metabolic alterations in multiple biological matrices of rats. J Proteome Res. 2013;12: 3755–3768. doi: 10.1021/pr400398b . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref047] 47.Mercer JG, Archer ZA. Putting the diet back into diet-induced obesity: Diet-induced hypothalamic gene expression. Eur J Pharmacol. 2008; 31–37. doi: 10.1016/j.ejphar.2007.11.077 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref048] 48.La Fleur SE, Van Rozen AJ, Luijendijk MCM, Groeneweg F, Adan RAH. A free-choice high-fat high-sugar diet induces changes in arcuate neuropeptide expression that support hyperphagia. Int J Obes. 2010;34: 537–546. doi: 10.1038/ijo.2009.257 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref049] 49.de Carvalho Marchesin J, Celiberto LS, Orlando AB, de Medeiros AI, Pinto RA, Zuanon JAS, et al. A soy-based probiotic drink modulates the microbiota and reduces body weight gain in diet-induced obese mice. J Funct Foods. 2018;48: 302–313. doi: 10.1016/j.jff.2018.07.010 [DOI] [Google Scholar]

[pone.0262270.ref050] 50.Farah A, Duarte G. Bioavailability and Metabolism of Chlorogenic Acids from Coffee. In: Preedy VR, editor. Coffee in Health and Disease Prevention. Amsterdam: Elsevier Inc.; 2014. pp. 789–801. doi: [DOI] [Google Scholar]

[pone.0262270.ref051] 51.Rendón MY, dos Santos Scholz MB, Bragagnolo N. Is cafestol retained on the paper filter in the preparation of filter coffee? Food Res Int. 2017;100: 798–803. doi: 10.1016/j.foodres.2017.08.013 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref052] 52.da Cruz RG, Vieira TMF de S, de LIRA SP. Potential antioxidant of brazilian coffee from the region of cerrado. Food Sci Technol. 2018;38: 447–453. doi: 10.1590/1678-457x.08017 [DOI] [Google Scholar]

[pone.0262270.ref053] 53.Nora CD, Müller CDR, de Bona GS, Rios A de O, Hertz PF, Jablonski A, et al. Effect of processing on the stability of bioactive compounds from red guava (Psidium cattleyanum Sabine) and guabiju (Myrcianthes pungens). J Food Compos Anal. 2014;34: 18–25. doi: 10.1016/j.jfca.2014.01.006 [DOI] [Google Scholar]

[pone.0262270.ref054] 54.Wojdyło A, Figiel A, Legua P, Lech K, Carbonell-Barrachina ÁA, Hernández F. Chemical composition, antioxidant capacity, and sensory quality of dried jujube fruits as affected by cultivar and drying method. Food Chem. 2016;207: 170–179. doi: 10.1016/j.foodchem.2016.03.099 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref055] 55.Maki C, Funakoshi-Tago M, Aoyagi R, Ueda F, Kimura M, Kobata K, et al. Coffee extract inhibits adipogenesis in 3T3-L1 preadipocyes by interrupting insulin signaling through the downregulation of IRS1. PLoS One. 2017;12: 1–19. doi: 10.1371/journal.pone.0173264 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref056] 56.Feyisa TO, Melka DS, Menon M, Labisso WL, Habte ML. Investigation of the effect of coffee on body weight, serum glucose, uric acid and lipid profile levels in male albino Wistar rats feeding on high-fructose diet. Lab Anim Res. 2019;35: 1–8. doi: 10.1186/s42826-019-0005-1 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref057] 57.Shokouh P, Jeppesen PB, Christiansen CB, Mellbye FB, Hermansen K, Gregersen S. Efficacy of Arabica Versus Robusta Coffee in Improving Weight, Insulin Resistance, and Liver Steatosis in a Rat Model of Type-2 Diabetes. Nutrients. 2019;11: 2074. doi: 10.3390/nu11092074 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref058] 58.Duarte SM da S, Abreu CMP de, Menezes HC de, Paula FB de A, Pereira RGFA, Gouvêa CMCP. Peeled coffee brew effect in the antioxidant activity hematological and biochemical parameters in rats. Food Sci Technol. 2009;29: 703–708. doi: 10.1590/s0101-20612009000400001 [DOI] [Google Scholar]

[pone.0262270.ref059] 59.Karabudak E, Türközü D, Köksal E. Association between coffee consumption and serum lipid profile. Exp Ther Med. 2015;9: 1841–1846. doi: 10.3892/etm.2015.2342 Epub 2015 Mar 11. . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref060] 60.Fielding CJ, Fielding PE. Molecular physiology of reverse cholesterol transport. J Lipid Res. 1995; 211–228. doi: 10.1016/s0022-2275(20)39898-9 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref061] 61.Millar CL, Duclos Q, Blesso CN. Effects of dietary flavonoids on reverse cholesterol transport, HDL metabolism, and HDL function. Adv Nutr. 2017;8(2): 226–239. doi: 10.3945/an.116.014050 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref062] 62.Burke MF, Khera AV, Rader DJ. Polyphenols and cholesterol efflux: Is coffee the next red wine? Cir Res. 2010;106(4): 627–629. doi: 10.1161/CIRCRESAHA.109.215855 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref063] 63.Luo J, Yang H, Song BL. Mechanisms and regulation of cholesterol homeostasis. Nat Rev Mol Cell Biol. 2020;21(4): 225–245. doi: 10.1038/s41580-019-0190-7 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref064] 64.Yokota A, Fukiya S, Islam KBMS, Ooka T, Ogura Y, Hayashi T, et al. Is bile acid a determinant of the gut microbiota on a high-fat diet? Gut Microbes. 2012;3: 455–459. doi: 10.4161/gmic.21216 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref065] 65.Lin H, An Y, Tang H, Wang Y. Alterations of Bile Acids and Gut Microbiota in Obesity Induced by High Fat Diet in Rat Model. J Agric Food Chem. 2019;67: 3624–3632. doi: 10.1021/acs.jafc.9b00249 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref066] 66.Ajouz H, Mukherji D, Shamseddine A. Secondary bile acids: An underrecognized cause of colon cancer. World J Surg Oncol. 2014;12: 1–5. doi: 10.1186/1477-7819-12-1 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref067] 67.Ocvirk S, O’Keefe SJ. Influence of Bile Acids on Colorectal Cancer Risk: Potential Mechanisms Mediated by Diet-Gut Microbiota Interactions. Cur Nutr Rep. 2017;6(4): 315–322. doi: 10.1007/s13668-017-0219-5 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref068] 68.Ontawong A, Duangjai A, Muanprasat C, Pasachan T, Pongchaidecha A, Amornlerdpison D, et al. Lipid-lowering effects of Coffea arabica pulp aqueous extract in Caco-2 cells and hypercholesterolemic rats. Phytomedicine. 2019;52: 187–197. doi: 10.1016/j.phymed.2018.06.021 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref069] 69.Santos RMM, Lima DRA. Coffee consumption, obesity and type 2 diabetes: a mini-review. Eur J Nutr. 2016;55(4): 1345–1358. doi: 10.1007/s00394-016-1206-0 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref070] 70.Li Y, Rahman SU, Huang Y, Zhang Y, Ming P, Zhu L, et al. Green tea polyphenols decrease weight gain, ameliorate alteration of gut microbiota, and mitigate intestinal inflammation in canines with high-fat-diet-induced obesity. J Nutr Biochem. 2020;78: 108324–108332. doi: 10.1016/j.jnutbio.2019.108324 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref071] 71.Jin J-S, Touyama M, Hisada T, Benno Y. Effects of green tea consumption on human fecal microbiota with special reference to Bifidobacterium species. Microbiol Immunol. 2012;56: 729–739. doi: 10.1111/j.1348-0421.2012.00502.x . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref072] 72.Kim YA, Keogh JB, Clifton PM. Polyphenols and Glycemic Control. Nutrients. 2016;8(1): 1–27. doi: 10.3390/nu8010017 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref073] 73.Cao SY, Zhao CN, Xu XY, Tang GY, Corke H, Gan RY, et al. Dietary plants, gut microbiota, and obesity: Effects and mechanisms. Trends Food Sci Tech. 2019;92: 194–204. doi: 10.1016/j.tifs.2019.08.004 [DOI] [Google Scholar]

[pone.0262270.ref074] 74.Rossi E, Cimdins A, Lüthje P, Brauner A, Sjöling Å, Landini P, et al. “It’s a gut feeling”—Escherichia coli biofilm formation in the gastrointestinal tract environment. Cr Rev Microbiol. 2018;44(1): 1–30. pp. 1–30. doi: 10.1080/1040841X.2017.1303660 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref075] 75.Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, Sargent M, et al. Diversity of the human intestinal microbial flora. Science. 2005;308: 1635–1638. doi: 10.1126/science.1110591 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref076] 76.Million M, Thuny F, Angelakis E, Casalta JP, Giorgi R, Habib G, et al. Lactobacillus reuteri and Escherichia coli in the human gut microbiota may predict weight gain associated with vancomycin treatment. Nutr Diabetes. 2013;3: e87–e87. doi: 10.1038/nutd.2013.28 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref077] 77.Dadi PK, Ahmad M, Ahmad Z. Inhibition of ATPase activity of Escherichia coli ATP synthase by polyphenols. Int J Biol Macromol. 2009;45: 72–79. doi: 10.1016/j.ijbiomac.2009.04.004 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref078] 78.Pagliarulo C, De Vito V, Picariello G, Colicchio R, Pastore G, Salvatore P, et al. Inhibitory effect of pomegranate (Punica granatum L.) polyphenol extracts on the bacterial growth and survival of clinical isolates of pathogenic Staphylococcus aureus and Escherichia coli. Food Chem. 2016;190: 824–831. doi: 10.1016/j.foodchem.2015.06.028 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref079] 79.Karar MGE, Pletzer D, Jaiswal R, Weingart H, Kuhnert N. Identification, characterization, isolation and activity against Escherichia coli of quince (Cydonia oblonga) fruit polyphenols. Food Res Int. 2014;65: 121–129. doi: 10.1016/j.foodres.2013.10.040 [DOI] [Google Scholar]

[pone.0262270.ref080] 80.Al-Assal K, Martinez AC, Torrinhas RS, Cardinelli C, Waitzberg D. Gut microbiota and obesity. Clin Nutr Exp. 2018;20: 60–64. doi: 10.1016/j.yclnex.2018.03.001 [DOI] [Google Scholar]

[pone.0262270.ref081] 81.Matsumoto M, Kibe R, Ooga T, Aiba Y, Kurihara S, Sawaki E, et al. Impact of intestinal microbiota on intestinal luminal metabolome. Sci Rep. 2012;2: 1–10. doi: 10.1038/srep00233 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref082] 82.Jandhyala SM, Talukdar R, Subramanyam C, Vuyyuru H, Sasikala M, Reddy DN. Role of the normal gut microbiota. World J Gastroenterol. 2015;21: 8787–8803. doi: 10.3748/wjg.v21.i29.8787 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref083] 83.Price CE, Reid SJ, Driessen AJM, Abratt VR. The Bifidobacterium longum NCIMB 702259T ctr gene codes for a novel cholate transporter. Appl Environ Microbiol. 2006;72: 923–926. doi: 10.1128/AEM.72.1.923-926.2006 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref084] 84.Ruiz L, Zomer A, O’Connell-Motherway M, van Sinderen D, Margolles A. Discovering novel bile protection systems in Bifidobacterium breve UCC2003 through functional genomics. Appl Environ Microbiol. 2012;78: 1123–1131. doi: 10.1128/AEM.06060-11 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref085] 85.Ruiz L, O’Connell-Motherway M, Zomer A, de los Reyes-Gavilán CG, Margolles A, van Sinderen D. A bile-inducible membrane protein mediates bifidobacterial bile resistance. Microb Biotechnol. 2012;5: 523–535. doi: 10.1111/j.1751-7915.2011.00329.x . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref086] 86.Fernández-Real JM, Ricart W. Insulin resistance and chronic cardiovascular inflammatory syndrome. Endocr Rev. 2003;24: 278–301. doi: 10.1210/er.2002-0010 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref087] 87.Hang D, Kværner AS, Ma W, Hu Y, Tabung FK, Nan H, et al. Coffee consumption and plasma biomarkers of metabolic and inflammatory pathways in US health professionals. Am J Clin Nutr. 2019;109: 635–647. doi: 10.1093/ajcn/nqy295 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref088] 88.Kittana H, Gomes-Neto JC, Heck K, Geis AL, Segura Muñoz RR, Cody LA, et al. Commensal Escherichia coli Strains can promote intestinal inflammation via differential interleukin-6 production. Front Immunol. 2018;9: 2318–2330. doi: 10.3389/fimmu.2018.02318 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref089] 89.Wang S, Moustaid-Moussa N, Chen L, Mo H, Shastri A, Su R, et al. Novel insights of dietary polyphenols and obesity. J Nutr Biochem. 2014;25: 1–18. doi: 10.1016/j.jnutbio.2013.09.001 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0262270.ref090] 90.Juge-Aubry CE, Henrichot E, Meier CA. Adipose tissue: A regulator of inflammation. Best Pract Res Cli Endocrinol Metab. 2005;19: 547–566. doi: 10.1016/j.beem.2005.07.009 . [DOI] [PubMed] [Google Scholar]

[pone.0262270.ref091] 91.Caro-Gómez E, Sierra J, Escobar J, Álvarez-Quintero R, Naranjo M, Medina S, et al. Green Coffee Extract Improves Cardiometabolic Parameters and Modulates Gut Microbiota in High-Fat-Diet-Fed ApoE-/- Mice. Nutrients. 2019;11: 497–518. doi: 10.3390/nu11030497 . [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Effect of a freeze-dried coffee solution in a high-fat diet-induced obesity model in rats: Impact on inflammatory response, lipid profile, and gut microbiota

Marilia Hermes Cavalcanti

João Paulo Santos Roseira

Eliana dos Santos Leandro

Sandra Fernandes Arruda

Roles

Abstract

Introduction

Materials and methods

Preparation of freeze-dried coffee solution

Ethics statement

Animals

Lipid profile

Bile acid concentration in feces

Determination of fecal microbiota composition

Extraction of DNA from fecal sample and cecum content

Real-time PCR analysis

Table 1. Primers and reaction conditions for the bacterial genera analyzed by RT-qPCR.

Determination of mRNA levels of pro-inflammatory genes

RNA extraction and cDNA synthesis

Quantification of transcriptional levels of pro-inflammatory genes Il1b, Il6, and Tnfa

Table 2. Sequences of primers used for RT-qPCR assay of Il1b, Il6, Tnfa and Actb.

Statistical analysis

Results

Effect of freeze-dried coffee solution consumption on food intake and body weight

Table 3. Food intake, final body weight, and average daily weight gain of rats fed the control or a high-fat diet with or without FCS.

Hepatic and serum lipid concentration

Table 4. Serum and hepatic lipid profile of rats fed the control or a high-fat diet with or without FCS.

Bile acid concentration in feces

Fig 1. Bile acid concentration in feces.

Determination of fecal microbiota composition

Fig 2. Bacteroides spp. population in fecal samples.

Fig 5. Populations of Lactobacillus spp., E. coli, and Enterococcus spp. in the fecal samples.

Fig 3. Bifidobacterium spp. population in fecal samples.

Fig 4. Populations of Lactobacillus spp. and E. coli in the fecal samples of rats fed the control or a high-fat diet.

Microbiota composition of the cecum content

Table 5. Bacterial populations in the cecum content of rats fed the control or a high-fat diet with or without FCS.

Expression of pro-inflammatory genes in the large intestine

Table 6. Quantification of Il1b, Il6, and Tnfa mRNA levels in the large intestine of rats fed the control or a high-fat diet with or without FCS.

Discussion

Conclusions

Supporting information

Data Availability

Funding Statement

References

Decision Letter 0

Jane Foster

Roles

Author response to Decision Letter 0

Decision Letter 1

Baochuan Lin

Roles

Author response to Decision Letter 1

Decision Letter 2

Baochuan Lin

Roles

Acceptance letter

Baochuan Lin

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases