Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Jan 24.
Published in final edited form as: Curr Biol. 2021 Nov 22;32(2):275–288.e5. doi: 10.1016/j.cub.2021.11.002

Soil bacteria protect fungi from phenazines by acting as toxin sponges

Kurt M Dahlstrom 1,*, Dianne K Newman 1,2,*
PMCID: PMC8792240  NIHMSID: NIHMS1756954  PMID: 34813731

Summary

Many environmentally and clinically important fungi are sensitive to toxic, bacterially-produced, redox-active molecules called phenazines. Despite being vulnerable to phenazine-assault, fungi inhabit microbial communities that contain phenazine producers. Because many fungi cannot withstand phenazine challenge, but some bacterial species can, we hypothesized that bacterial partners may protect fungi in phenazine-replete environments. From a single soil sample we were able to co-isolate several such physically associated pairings. We discovered the novel species Paraburkholderia edwinii and demonstrated it can protect a co-isolated Aspergillus species from phenazine-1-carboxylic acid (PCA) by sequestering it, acting as a toxin sponge; in turn, it also gains protection. When challenged with PCA, P. edwinii changes its morphology, forming aggregates within the growing fungal colony. Further, the fungal partner triggers P. edwinii to sequester PCA and maintains conditions that limit PCA toxicity by promoting an anoxic and highly reducing environment. A mutagenic screen of P. edwinii revealed this protective program depends on the stress-inducible transcriptional repressor HrcA. We show that one relevant stressor in response to PCA challenge is fungal acidification and that acid stress causes P. edwinii to behave as though the fungus were present. Finally, we reveal this phenomenon as widespread among Paraburkholderia with moderate specificity among bacterial and fungal partners, including plant and human pathogens. Our discovery suggests a common mechanism by which fungi can gain access to phenazine-replete environments, and provides a tractable model system for its study. These results have implications for how microbial communities in the rhizosphere as well as in plant and human infection sites negotiate community membership via a chemical dialectic.

Keywords: phenazines, bacteria, fungi, protective partnership, microbial interactions, inter-kingdom

eTOC Blurb

Natural antibiotics play a key role in microbial community composition, but little is known about how communities reach a steady-state membership. Dahlstrom and Newman demonstrate how antibiotic-sensitive fungi may gain access to otherwise hostile environments through a protective bacterial partner acting as a toxin sponge.

Introduction

The presence or absence of particular fungal species in host-associated microbial communities plays a central role in human and plant health13. However, we lack an understanding of how key fungal species are integrated into these communities in the face of rampant chemical warfare. It has long been known that the soil is home to diverse microbes that produce natural products with antibiotic activity. Important amongst these are phenazines, redox active compounds that can restrict fungal growth and have been shown to be responsible for excluding fungi from agriculturally important microbial communities4,5. A recent metagenomic study revealed that phenazine biosynthesis capacity is widespread in agricultural soils and crop microbiomes6. Given that drier soils are also associated with higher rates of phenazine producers colonizing wheat, this suggests that soil fungi may need to contend with higher concentrations of phenazines as the climate shifts7,8. Paradoxically, many fungi that are sensitive to phenazines are routinely found living in close proximity to phenazine-producing bacteria, including pathogenic fungi in the lungs of cystic fibrosis patients, beneficial and phytopathogenic fungi in the rhizosphere, and in oceanic environments including coral912. This pattern of co-habitation indicates there may be a general way fungi are screened for membership in microbial communities that produce phenazines that holds broad relevance. We set out to identify such a putative screening mechanism, a necessary step towards the goal of manipulating these microbial communities for human benefit.

Our drive to understand how particular fungi are recruited or repelled from a microbial community is motivated by the large impact fungal composition can have on the outcome for human and plant health. Fungi in complex polymicrobial infections act as markers of disease severity, particularly in the lungs of patients with cystic fibrosis13. In this environment, Aspergillus fumigatus and Candida albicans are two opportunistic fungal pathogens that are susceptible to phenazines, yet are routinely isolated from patients who are co-infected with the prolific phenazine producing bacterium Pseudomonas aeruginosa9,10. Likewise, fungi play prominent roles in the rhizosphere, where they can help the host plants acquire nutrients and water as well as withstand stress and pathogens14,15; plant-growth promoting fungi such as Trichoderma and Penicillium species are often found in rhizospheres containing phenazine producing bacteria, yet their growth is inhibited by phenazines11,16. Conversely, the ability of phytopathogenic fungi to enter the rhizosphere is of interest due to fungi being responsible for a third of all lost crops annually17. This is despite phenazines being credited as a primary factor in stopping a variety of fungal phytopathogens from infecting food crops, including pseudomonads that can suppress Gaeumannomyces graminis var. tritici and Fusarium oxysporum f sp. radicis-lycopersici, two fungal pathogens of wheat and tomato, respectively4,5. Finally, plant associated mycorrhizal fungi play an outsized role in carbon sequestration: mycorrhizal vegetation sequesters approximately 350 gigatons of carbon a year compared to 29 gigatons stored by nonmycorrhizal vegetation3. Notably, phenazine producers are found in diverse environments beyond food crops, including in forests and grasslands, thus pointing to another niche of consequence where fungi must navigate phenazine assault6.

How do fungi maintain an active presence in microbial communities where they run the risk of encountering phenazines? Recognizing that some soil bacteria can tolerate phenazines well1820, we hypothesized that one mechanism by which fungi might gain navigate such hostile environments is through association with a protective bacterial partner. Precedent for such relationships exists. For example, members of the Burkholderiaceae family form associations with fungi. Trichoderma asperellum is a biocontrol fungus that suppresses the wheat pathogen Fusarium oxysporum. Paraburkholderia terrae associates with the mycelium of T. asperellum and can be induced to migrate in the direction of mycellial growth, as well as promote fungal growth in the presence of crude supernatant derived from antagonistic bacteria21. However, this family of bacteria can also empower pathogenic fungi. Rhizopus microsporus is a necrotic plant pathogen of rice. The primary toxin it secretes that is required for infection is actually produced by the intracellular bacterium Mycetohabitans rhizoxinica, another Burkholderiaceae member, that resides inside the fungal cells22. Other Paraburkholderia with less clear roles associate extracellularly with fungal pathogens, such as Paraburkholderia fungorum, found isolated with the white-rot fungus Phanerochaete chrysosporium23. While the roles each of these bacteria play for their host fungus may differ, fungal association with bacteria of this family is well established.

In addition to these isolated examples, data from a recent metagenomic survey of soil microbes across many climate conditions support the notion that cooperation with bacteria might underpin fungal ecological success24. Specifically, this study found that the presence of bacterially-derived genes regulating antibiotic tolerance were correlated with fungal biomass in the community. Although this co-occurrence was suggested to indicate inter-domain antagonism, where bacterial groups use these genes to defend themselves against fungally-produced antibiotics, an alternative and non-mutually exclusive explanation may be that these bacterial stress response genes help fungi navigate an otherwise inhospitable environment. Given that fungi can be excluded from microbial communities by phenazine-producing bacteria, it stands to reason other phenazine resistant bacteria in the community that associate with fungi may have the power to affirm their presence. Because the number of environments where susceptible fungi are found living in proximity to phenazine producers is likely to be high, we reasoned that finding an example of such a hypothetical protective association could be of great value in understanding the recruitment versus repression of fungi in microbial communities containing phenazine producers.

Accordingly, we set out to identify a model bacterial/fungal partnership in the presence of phenazines. Using an accessible soil on the Caltech campus from which we had previously isolated phenazine degrading bacteria19, we designed a procedure to select for such partnerships. Here, we report the isolation and initial mechanistic characterization of a genetically tractable fungal-bacterial system where the bacterial partner protects the fungus from PCA assault. The ease with which we were able to experimentally validate the existence of a hypothetical bacterial/fungal association suggests that this type of partnership may be widespread in nature.

Results

Isolation of protective bacterial partner and physically associated fungus.

To identify fungi that rely on protective bacteria to resist phenazine assault, we sampled topsoil from the base of a blood orange citrus tree outside of the Beckman Institute on the Caltech campus. We chose this site because soil represents an easily accessible and broad niche containing many microbial species and because we had isolated a strain of Mycobacterium from this same plot that can degrade phenazines, suggesting the presence of bacteria capable of producing and interacting with these molecules19.

We collected the top three centimeters of soil from this site, and developed a protocol to find strong bacterial-fungal pairs. We washed and sonicated 100 mg to separate microbes that were not strongly associated with one another, thereby enriching for strongly adherent partners (Figure 1A). To select a first fungal culture, the washed samples were diluted to extinction and plated on potato dextrose agar. Fungal colonies that grew after approximately three days were screened for the presence of bacteria via PCR amplification of the 16S rDNA region. Fungal/bacterial pairings were then challenged with 300 μM phenazine-1-carboxylic acid (PCA). We used PCA because it is the biosynthetic starting product for modification into more specialized phenazine types and is known to play important roles in excluding fungal pathogens from wheat rhizosphere communities5. Co-colonies that were able to grow when challenged with PCA were repeatedly sub-cultured to isolate the partner bacterium, while the fungus was re-plated in the absence of PCA with bacteriocidal antibiotics to cure it of the bacterium. Isolated fungi and bacteria were retreated with PCA to check phenazine-sensitivity and tolerance, respectively, and susceptible fungi were then supplemented with their co-isolated bacterium in the presence of PCA to confirm that the partner bacterium conferred phenazine tolerance.

Figure 1. Co-isolation of a fungus and protective bacterial partner.

Figure 1.

A) 100 mg of top soil samples were washed in PBS with 0.01% Tween 20, sonicated to break apart soil and loosely associated microbes, and plated on PDA. Colonies were screened for bacterial partners by 16S amplification, and pairings were subsequently cured of their partners and tested by PCA challenge. B) An Aspergillus isolate from the soil growing on PDA (top). The same isolate fails to grow in the presence of 300 μM PCA after 48 hours (bottom, left), but is capable of withstanding phenazine assault when grown with its co-isolated partner, P. edwinii (bottom, right). Red arrows indicate bacterial aggregates that form in the co-colony only in the presence of PCA. C) When P. edwinii is grown alone next to P. fluorescens, it can be engulfed by the phenazine-producing strain (left) but not the phenazine mutant strain, ::phzD (right). D) The isolated Aspergillus species is inhibited by a wide array of phenazine producing organisms (left column), The bacterial competitors and primary phenazines they produce, top to bottom, are Pseudomonas chlororaphis (phenazine-1-carboxamide), Pseudomonas aureofaciens (2-hydroxyphenazine), Pseudomonas fluorescens (PCA), and Paraburkholderia phenazinium (iodinin). Fungal growth is enhanced in the same conditions by the presence of P. edwinii (right column). Also note P. fluorescens is incapable of engulfing the co-colony as it did to P. edwinii alone in panel C. Blue arrows indicate columns of phenazine-producing bacteria, white indicates the Aspergillus isolate alone, and orange indicates the Aspergillus isolate paired with P. edwinii. Bacterial aggregates are visible in several images. All colonies were grown on PDA for 48 hrs at 30 °C. See Figure S1 for further examples of proactive partnerships isolated from the soil and demonstration that phenazine activity is responsible for fungal inhibition.

Using this process we uncovered three fungal-bacterial partnerships. Genus-level identification was performed with ITS and 16S rDNA sequencing, respectively. Two Paraburkholderia isolates were found protecting an Aspergillus and a Coniochaeta isolate. A Luteibacter species also provided protection to a second Aspergillus isolate (Figure S1A). In each case, the fungal growth was negatively impacted when challenged with PCA alone, but was restored to varying degrees when supplemented with its natively co-isolated bacterial partner. Of these three co-isolates, we selected the Paraburkholderia-Aspergillus pairing for further analysis due to the dramatic level of protection the bacterium provided the fungus, as well as the radical morphological change the bacterium underwent as it formed spherical aggregates within the fungal colony when the two were challenged with PCA (Figure 1B). Moreover, while the Aspergillus species is sensitive to PCA and the Paraburkholderia species resists its toxic effects, this Paraburkholderia isolate is still vulnerable to engulfment by the PCA producer P. fluorescens, but not to a strain that cannot make PCA, suggesting a mutual benefit (Figure 1C). Finally, this pairing was attractive because previous reports of Burkholderiaceae family members being isolated with fungi21,25 suggested that such associations may be common in the soil.

To determine the phylogenetic placement of these two organisms and open the possibility of making them genetically tractable, we sequenced both genomes using Illumina and PACBio technologies (see STAR Methods for details of assembly). Two closed chromosomes resulted upon assembly of the Paraburkholderia genome (GenBank accession CP080095CP080096, sample Paraburkholderia edwinii Pe01). Because most members of the Burkholderiaceae family contain an additional third genetic element that can range in size from one or more plasmids to a small third chromosome, we attempted to also isolate smaller genetic components. However, unlike many closely related species of Paraburkholderia, no plasmid was recovered. P. edwinii appeared to be a novel species, with its closest relative being Paraburkholderia SOS3 based upon a 98.89% 16S identity and 88% average nucleotide identity (ANI) shared between the two, well beyond the 95–96% cutoff for a new species26. A tetranucleotide usage analysis yielded a correlation of 0.990, again suggesting a new species. Due to this bacterium’s apparent novelty as a species, and due to its ability to help its fungal partner prosper despite the presence of a toxin, we named it Paraburkholderia edwinii, derived from the Old English “Edwin”, meaning prosperous friend.

The Aspergillus species produced an assembly of 52 contigs greater than 0.2 MB accounting for ~35 MB (GenBank accession JAHXQV000000000, sample Aspergillus sp. ADI1). Although there are not well established cut-offs for novel fungal species using traditional analysis methods meant for bacteria, we applied similar methods as for P. edwinii for comparison to determine what species this fungus might belong to. The ITS sequence of the fungus was a 100% match for A. calidoustus, but was similarly matched to A. ustus, A pseudodeflectus, and A. fuscicans. Of these organisms with complete genomes available, A. calidoustus generated an ANI score with the isolate of 96.44%, and is thus within the 95–96% identity used for species differentiation. However, only 87.74% and 90.93% of the isolate and A. calidoustus genomes, respectively, were represented in the other. Further, a tetranucleotide usage analysis showed a 0.997 correlation between the two organisms, near the cutoff for what would routinely be considered the same species. Finally, we note that our Aspergillus isolate is capable of growing at 37 degrees C, a key trait of A. calidoustus. While our Aspergillus isolate may be a strain of A. calidoustus, further detailed analysis is necessary to determine if this isolate has crossed the threshold to be considered a new species or may belong to a previously described species with an unpublished genome.

P. edwinii protects its fungal partner from phenazine assault

We next sought to characterize the range of the bacterium’s ability to protect its partner fungus from phenazines. The minimal inhibitory concentration of PCA toward fungal targets has been reported to be in the 1–50 μM range27. The 300 μM PCA used for our isolation assay therefore represents a strong phenazine challenge intended to identify bacterial partners with a robust protection phenotype. The advantage of using a high concentration of PCA in our laboratory experiments is that it may better mimic local gradients of PCA that exist within rhizosphere microbial communities that likely exceed bulk measurements.

To determine whether P. edwinii can protect Aspergillus against actual phenazine-producers in addition to purified PCA, we tested the response in the presence of different phenazine-producing pseudomonads. Aspergillus was plated adjacent to Pseudomonas fluorescens, Pseudomonas chlororaphis, Pseudomonas chlororaphis sub-species aureofaciens28, and Paraburkholderia phenazinium. The primary phenazine product made by these species under are growth conditions is PCA, phenazine-1-carboxamide (PCN), 2-hydroxy-phenazine, and iodinin, respectively. When grown close to one another, each phenazine producing bacterium impeded Aspergillus growth (Figure 1D). However, when the fungus was supplemented with P. edwinii, growth was partially restored. Intriguingly, bacterial aggregates again formed within the co-colonies proximal to phenazine producers, suggesting this morphological phenotype reflected a general protective response (Figure 1D). Finally, to verify that these responses were specifically due to phenazine assault, mutants of Pseudomonas fluorescens and Pseudomonas chlororaphis were obtained that could not make phenazines29. While the WT strains were capable of suppressing fungal growth, the fungus grew unimpeded in proximity of the non-phenazine producing mutants (Figure S1B), confirming that the protection provided by P. edwinii is specific to phenazine assault and can occur in a mixed microbial system.

P. edwinii undergoes a morphological shift in response to phenazine-induced fungal stress.

To understand how P. edwinii responds to its partner fungus during phenazine assault, we imaged the bacterium inside the co-colony. While a ring of what appeared to be one or two dozen bacterial aggregates formed on the co-colony surface, it remained possible these were fungal structures. To distinguish between these possibilities, we adapted a tissue clearing technique developed in our lab termed Microbial identification after PASSIVE Clarity Technique (MiPACT) to render the fungal tissue transparent (see STAR Methods). This allowed us to visualize bacteria within the fungal structure using in situ fluorescence detection of 16S rRNA with the hybridization chain reaction (HCR)30. Because the exterior of the colonies showed putative bacterial aggregates within the center, we hypothesized that may be where the bacteria were concentrated. We first imaged the outer 2/3 of the colonies. In the control, whole-colony samples untreated with PCA, P. edwinii was found concentrating near the tips of the outwardly-growing mycelium, with relatively low amounts of bacteria found further inward among older mycelial growth. The propensity of P. edwinii to track with the mycelial edge in the untreated samples is in agreement with reports suggesting other Paraburkholderia are capable of identifying the growing edge of expanding fungi21. Conversely, in the PCA treated sample, this population of bacteria was largely absent (Figure 2).

Figure 2. P. edwinii forms aggregates in center of fungal colony in response to PCA challenge.

Figure 2.

Panels A-D show the fluorescent signal of the eubacterial probes identifying P. edwinii within the fungal colony, E-H are DAPI stained showing the structure of the co-colony, and I-L are the merged images. In the absence of PCA, P. edwinii gathers along the edge of the mycelia (panels A, E, I) and mixes throughout the interior of the fungal colony (panels C, G, K). When challenged with PCA, P. edwinii does not congregate at the leading edge of the mycelium (panels B, F, J) and aggregates within the colony center (panels D, H, L). Whole colonies were grown on PDA for 48 hours at 30 °C, processed using the MiPACT technique to render fungal tissue transparent, and visualized using HCR eubacterial probes and DAPI (see STAR Methods). Eubacterial probes were labeled with a with an Alexa 647 fluorophore. Images are representative of three independently grown co-colonies for each condition, and were captured on an inverted confocal Leica model TCS SPE confocal microscope with a 10x objective. Images of the HCR signal were normalized in contrast to the brightest image in like samples (i.e. edge vs edge, or center vs center), while images of the DAPI signal were independently adjusted to best outline fungal morphology in the vicinity of the bacteria. See Figure S2 for imaging of the bacterial ridge that forms between the inner and outer regions of the co-colony.

To gage whether a lack of bacteria among the outer mycelium in the PCA treated samples was due to bacterial aggregation, we imaged the center of each co-colony. In untreated samples, bacteria were mixed homogenously throughout the fungal mass without identifiable structure or patterning (Figure 2). One exception to this observation was an apparent transition zone between the bacterially rich inner co-colony and more sparely populated outer co-colony. This transition zone, or ring, comprised more densely packed bacteria, but the region lacked further organization (Figure S2). In the PCA treated sample, the center of the co-colony contained clear spherical structures that lit up with the eubacterial HCR probes (Figure 2). These P. edwinii aggregates ranged from 50 to 100 μm in diameter and were ubiquitous throughout the colony center, indicating that the visible bacterial aggregates on the surface of the co-colony were only a fraction of those being formed. The PCA treated co-colony also had a transition ring structure between the bacterially populated center and unpopulated outer colony. In this case, however, the ring contained more clearly defined aggregates of bacteria, corresponding to the region that produced aggregates visible to the naked eye (Figure S2). These results reveal that P. edwinii forms bacterial aggregates inside and in the center of the fungal colony when challenged with PCA.

P. edwinii acts as a toxin sponge

How does P. edwinii impart phenazine resistance to its partner fungus? Possible mechanisms included phenazine degradation, sequestration, and/or detoxification. We first tested degradation. To accurately measure the PCA concentration over time, we grew P. edwinii in shaking liquid cultures spiked with 300 μM PCA either alone or in the presence of the Aspergillus species, in case a fungal signal was necessary to trigger degradation of PCA. In no condition was PCA degraded (Figure S3). The lack of degradation suggested that bacterial aggregate formation might instead reflect a PCA sequestration and detoxification response, which we proceeded to test.

Because the bacterial aggregates are too small to probe or manipulate individually, we modified our experimental set up to grow P. edwinii directly next to its Aspergillus partner in the presence of PCA to generate bacterial auto-aggregation in the form of a colony. To verify the protection phenotype is still responsive in this assay, we grew the two organisms next to each other in the presence and absence of PCA. Growing P. edwinii and the Aspergillus species at a distance in the presence of PCA resulted in severely stunted fungal growth, however the fungus was able to grow toward P. edwinii when plated adjacently (Figure 3A). Intriguingly, the bacterial colony developed a deep yellow hue in the PCA treated condition, but only did so in the presence of the fungus. PCA is a largely colorless molecule when exposed to oxygen, but in the reduced state turns yellow. We used LC-MS to determine whether this yellow pigment was PCA and its presence was confirmed in the bacterial sample grown next to the fungus (Figure 3B). We detected a smaller amount of PCA in the colonies of P. edwinii grown alone in the presence of PCA than in the presence of PCA and the fungus, suggesting that while PCA sequestration may be an intrinsic trait of the bacterium, sequestration is stimulated by the fungal partner (Figure 3C).

Figure 3. P. edwinii acts as a toxin sponge.

Figure 3.

A) The Aspergillus species and P. edwinii growing on PDA supplemented with 300 μM PCA growing at a distance (top) and 5 mm apart (bottom). Note the Aspergillus growth toward the bacterium and deepening yellow color of P. edwinii when the two organisms are grown in proximity of one another. Images are representative of 5 sets of colonies. B) HPLC chromatogram with the peak representing PCA derived from scraped up P. edwinii colonies grown with or without its fungal partner, and in the presence or absence of PCA challenge. C) nmoles PCA sequestered by P. edwinii in the absence and presence of its partner fungus, normalized by bacterial dry mass. P. edwinii does not readily degrade PCA as seen in Figure S3. Quantification was performed by measuring absorbance at 365 nm. Error bars represent standard deviation of four biological replicates. *** p < 0.001. D) Fraction of reduced PCA present (left) in a P. edwinii or Pseudomonas fluorescens colony when grown as a three-member system with the isolated Aspergillus species (right). Reduced PCA was quantified by fluorescence spectroscopy using an excitation wavelength of 365 nm and reading emission at 520 nm. Error bars represent standard deviation of 3 biological replicates. p = 0.096 using Welch corrected t-test.

Having confirmed the sequestration of PCA within the bacterial colonies, we next wanted to assess possible detoxification of PCA by measuring its redox state. Oxygen availability permits phenazine oxidation, leading to the generation of reactive oxygen species and/or chemical interference with components of the electron transport chain. Being sequestered in a reducing environment, however, may alleviate PCA toxicity by preventing these reactions. Previously, we had been measuring PCA sequestered from an agar plate where most of the molecule would be expected to be oxidized due to atmospheric oxygen. A better comparator for the fraction of reduced PCA found within a P. edwinii colony would therefore be another bacterial colony containing PCA, but one that was not employing a protection response involving PCA detoxification. To this end, we grew P. edwinii and the Aspergillus species adjacent to the phenazine producer P. fluorescens. PCA is the sole phenazine produced by P. fluorescens. Before the bacterial colonies were harvested, the plates were transferred to an anaerobic chamber to minimize the atmospheric oxidation of any reduced PCA. Reduced, but not oxidized, PCA has a peak excitation of 364 nm and emission of 520 nm, which allowed us to determine the fraction of the PCA in the reduced state. Fluorescent emission spectra were collected in the anaerobic chamber, which revealed a trend indicating the phenazine-producing P. fluorescens colony biofilm holds a smaller fraction of its PCA in the reduced state compared to P. edwinii colonies that maintain approximately a third of the PCA it sequestered in the reduced state (p = 0.096 using a Welch corrected t-test to account for assumed unequal variance between an organism which produces phenazines and one which stores them). This result demonstrated that P. edwinii colony aggregates reduce PCA (Figure 3D), providing evidence of PCA detoxification and implicating the P. edwinii aggregates as maintaining a reducing environment, an idea which is probed in subsequent sections.

HrcA is a regulator of the protection response in P. edwinii

Given that PCA sequestration in P. edwinii is stimulated by its partner fungus, we aimed to discover how P. edwinii sensed and responded to its partner. We developed genetic tools to manipulate P. edwinii to screen for mutants altered in their ability to protect the fungus from PCA. We therefore created a mating protocol to introduce a mini-mariner transposon31 into the genome of P. edwinii. Mutants were screened with the Aspergillus species on PCA, and mutants that produced an atypical morphology had their transposons mapped to the inserted gene (Table S1). P. edwinii mutants were identified that were either less or more protective of the partner fungus. Generally, more bacterial aggregation was associated with more fungal protection and vice versa (Figure 4A). We focused on a mutant with a transposon insertion in the stress inducible transcriptional repressor hrcA, due to its strong protection phenotype and relative ease of growth. To ensure its phenotype was due to the disruption of this gene and was not caused by polar effects or secondary mutations elsewhere in the genome, we made an in-frame deletion of hrcA. The deletion mutant phenocopied the transposon mutant, showing enhanced bacterial aggregation and fungal growth when challenged with PCA (Figures 4B, C). Constitutively expressing hrcA from a pBBR1 vector restored the WT phenotype (Figure 4B). Not only did the ΔhrcA mutant promote fungal growth beyond the wild type strain during PCA challenge, but the extra-large bacterial aggregates characterizing this mutant appeared to form even in the absence of PCA, suggesting this mutant constitutively turned on the protection program (Figure S4A).

Figure 4. hrcA regulates the protection response of P. edwinii.

Figure 4.

A) Select transposon mutants of P. edwinii discovered by screening the ability of bacterium to protect partner fungus in the presence of 300 μM of PCA after 48 hours of growth on potato dextrose plates. Mutants were generated using a mini-mariner transposon with a kanamycin marker. Single, mutant P. ediwnii colonies were subsequently grown in liquid PDB in a 96 well plate before being mixed with spores of the Aspergillus isolate and plated to the PCA challenge condition. Images are organized from bacterial mutants producing less aggregation/protection to most. All genes listed refer to the disrupted locus in the bacterium. B) An in-frame deletion of the hrcA gene in the bacterium was constructed to verify the transposon phenotype, and was complemented using the pBBR1 expression vector in the presence of PCA. Red arrows indicate examples of larger bacterial aggregation present in ΔhrcA strain. Strain labels refer to the bacterium, and all images show the resultant co-colonies with the WT Aspergillus sp. Figures S4A and B demonstrate aggregates forming even in the absence of PCA in the co-colony, and the general morphology of ΔhrcA grown tends toward a larger colony structure with enhanced response to its fungal partner. C) ΔhrcA shows a greater degree of fungal protection as measured by growth area compared to the WT bacterial strain. The Aspergillus species alone shows minimal growth. Error bars represent standard deviation of four biological replicates. ***p < 0.001. D) Comparison of bacterial WT and ΔhrcA CFUs derived from co-colonies. Whole co-colonies exposed or not exposed to PCA challenge were excised from PDA plates, homogenized, and plated on PDA supplemented with nystatin to prevent fungal growth. Reported is the total number of CFUs per co-colony. Error bars represent standard deviation of four biological replicates. *p < 0.05, **p < 0.01. E) Comparison of the ability of WT and ΔhrcA bacterial strains to sequester PCA with and without partner fungus. Error bars represent standard deviation of four biological replicates. *p < 0.05. F) Biofilm (left) and motility (right) assays of WT and ΔhrcA. The ability of P. edwinii to form static biofilms using a 96-well microtire dish was assessed by inoculating normalized overnight culture into 1/5 V8 medium and was grown for 24 hours at 30 °C before staining with 0.1% crystal violet, producing a purple ring (left). Motility was assessed by plunging a pipette tip with overnight culture into 0.3% low sodium M9 agar resulting in white rings of swimming bacteria after 72 hours at 30 °C (right). The WT strain shows increased biofilm formation and motility (top images) compared to ΔhrcA (bottom images). Error bars represent standard deviation of four biological replicates. ***p < 0.001. WT refers to bacterial strain throughout.

Intriguingly, the hrcA gene product in Bacillus subtilis represses expression of genes involved in the stress response to heat shock, and deletion of hrcA in B. subtilis results in cells that can adapt and grow more rapidly under conditions of heat stress32. By analogy, we wondered whether the removal of hrcA in P. edwinii might permit larger aggregate formation due to a similar growth advantage in the presence of PCA. To test this, we grew WT and ΔhrcA strains as co-colonies with the Aspergillus species in the presence or absence of PCA. Co-colonies were homogenized after 48 hours and bacterial CFUs were plated on potato dextrose agar containing nystatin to suppress fungal growth. The ΔhrcA strain showed an approximately 2-fold increase in CFUs compared to the WT per co-colony in both the PCA treated and untreated conditions (Figure 4D). Not only did the ΔhrcA mutant grow better than the WT in the presence of PCA, it was better at sequestering PCA; as before, its ability to sequester PCA was stimulated in the presence of the fungus (Figure 4E). Because the amount of PCA sequestered is normalized by the dry weight of the collected biomass, a growth advantage alone is not sufficient to explain these results. Though bacterial aggregation in the ΔhrcA mutant was enhanced relative to the WT, it failed to form a biofilm using the crystal violet assay33—possibly linked to a swimming motility defect we uncovered using a swim assay (Figure 4F). These results suggest that the protection/aggregation phenotype relies on a different developmental program from that involved in classical biofilm development.

P. edwinii holds sequestered PCA in a reduced, anoxic environment

Phenazines exert toxic effects on diverse cell types through a variety of mechanisms including generating reactive oxygen species and destabilizing the electron transport chain of the target cell dependent upon the ability of the phenazine to cycle its redox state in the presence of oxygen13,3439. It may therefore seem paradoxical that the Aspergillus species achieves protection against PCA by promoting concentration of PCA within its co-culture. Given that P. edwinii colonies show a trend toward reduced PCA enrichment relative to the phenazine producer, P. fluorescens (Figure 3D), we hypothesized that a solution to this paradox might come from limiting oxygen by maintaining a reducing environment within the bacterial aggregates. We used oxygen and redox microelectrodes to test this hypothesis.

Because the co-colony bacterial aggregates are of a similar size as the width of our microelectrode tips (25 – 100 μm), puncture when probed, and are invisible from the outside of the co-colony, we instead grew P. edwinii next to the Aspergillus species with or without PCA to induce the sequestration phenotype and probed the interior of the bacterial colony (setup as in Figure 4A). We measured the oxygen concentration and redox potential of the bacterial colony microenvironment after 48 hours (Figure 5). In the absence of PCA, P. edwinii grew as shallow, flat colonies with a narrow anoxic zone (Figure S4B). These colonies were anoxic at 50 μm of depth before increasing in oxygen concentration at approximately 175 μm depth (Figure 5A). When grown without the fungal partner in the presence of PCA, the bacterial colony became taller and encased in an apparent layer of polysaccharide (Figure S4B). Oxygen levels in this thicker colony dropped slowly through the outer layer, disappearing at approximately 180 μm. Oxygen was again detected at 380 μm, indicating a larger anoxic volume within the colony compared to the untreated colony. When grown next to its partner fungus in the presence of PCA, these trends continued with the colony again becoming taller and more dome shaped (Figure S4B), becoming anoxic at 280 μm beneath its thicker layer of matrix. At no depth probed was oxygen again detected.

Figure 5. P. edwinii and Aspergillus species respond to PCA challenge by modifying oxygen availability, reduction potential, and pH.

Figure 5.

A) Oxygen profile of P. edwinii colonies. The WT colony grows as a flat disc in the absence of PCA, but becomes rounded with an apparent outer polysaccharide layer when stressed with PCA, and the increase in colony volume creates a larger anoxic zone beneath this layer than exists in the non-stress condition (left). ΔhrcA shows a similar trend but more closely resembles the WT PCA (+) condition even when not challenged (right). B) When challenged with PCA, WT and ΔhrcA P. edwinii colonies generate more reducing conditions. The larger zone of lower reducing potential in the ΔhrcA mutant compared to WT when exposed to PCA is reflective of the larger internal volume this mutant creates. The addition of the Aspergillus isolate causes a further decrease in reduction potential that is sustained to greater depths (left right), where the fungus may be contributing to lowering the reduction potential (see Figure S4C). C) The WT and ΔhrcA P. edwinii colonies generate near-neutral pH conditions that show a trend of decreasing when exposed to PCA, and growing the fungus adjacent to P. edwinii colonies causes the internal environment to be more acidic (Left, Center). The Aspergillus isolate generates alkaline conditions when grown without PCA challenge, but generates a much more acidic environment when PCA is present (right). Error bars for all microelectrode experiments represent standard deviation of three measurements at each depth. D) Addition of 5 mM HCl or citric acid causes an increase in PCA sequestration in P. edwinii colonies. Colonies were grown for 48 hrs at 30 °C. All adjacent colonies were grown 5 mm apart. Error bars represent standard deviation of four biological replicates. Significance for the citric acid was calculated using a Welch corrected t test to account for the greater variability produced by adding a metabolizable organic acid (p = 0.081). **p < 0.01.

Given the additional protection from PCA the ΔhrcA mutant provides, we speculated that it might contain a larger anoxic core even in the absence of PCA challenge/its fungal partner. When grown alone in the absence of PCA, ΔhrcA grew tall, rounded colonies (Figure S4B) and reached anoxia 150 μm from the surface and continued to a depth of 590 μm (Figure 5A). In the presence of PCA, anoxia was reached at a depth of 250 μm and continued to 660 μm, which resulted in similarly large anoxic interiors even as PCA caused an increase in matrix material at the surface of the colony (Figure S4B). Intriguingly, the presence of the fungus and treatment with PCA resulted in the ΔhrcA mutant reaching anoxia at a similar depth as the PCA treatment alone at 230 μm, but the oxygen concentration declined more sharply. Oxygen again could not be detected at any depth when the fungus was present (Figure 5A).

Profiles using a redox probe revealed that, in the absence of PCA, neither WT nor ΔhrcA significantly lowered the redox potential through their depth, maintaining a potential of greater than 280 mV in both cases, indicating an oxidizing environment. (Figure 5B). This is not surprising because the absence of oxygen is necessary but not sufficient to create a reducing environment. When supplemented with PCA (the effective redox buffer), however, both strains showed a marked drop in redox potential to a low of approximately −30 mV, although the ΔhrcA mutant maintained low redox potential over a greater depth and thus represents a larger volume of a reducing environment. When challenged with PCA in the presence of the fungus, both strains showed similar low redox potentials in their cores as when challenged with PCA alone, and the environment continued to be reducing at all tested depths for both strains. To determine if the Aspergillus species contributes to this reducing environment, the redox potential of fungal colonies was measured with and without PCA challenge. The fungus showed a sharp drop in redox potential when challenged with PCA (Figure S4C). Although the drop was somewhat less than that produced by the bacterium, it is possible that the fungus helps maintain a reducing environment in partnership with P. edwinii.

Fungal-induced pH shift corresponds with protection response

While the Aspergillus species stimulated P. edwinii to generate anoxic and reducing interiors in the presence of PCA, the fungus was not required to trigger these bacterial responses. However, the Aspergillus species promoted an increase in PCA sequestration in both WT P. edwinii and even more so in the ΔhrcA strain (Figure 4E), suggesting the fungus may provide a stress-related trigger to the bacterium. Many species of fungi will acidify their environment when stressed in an attempt to outcompete other microbes40. Accordingly, we hypothesized that our Aspergillus species might acidify the medium in response to PCA. In addition to the acid stress to which this would expose the bacterium, a lower pH results in a higher fraction of the PCA becoming protonated, and thus neutrally charged and more cell permeable, potentially forcing a response from P. edwinii. To test this hypothesis, we used a pH microelectrode to probe the pH of P. edwinii and Aspergillus colonies

Both the WT and the ΔhrcA strain exhibited a colony pH profile above 7.0 when grown alone without PCA, with a slightly more acidic pH profile in the presence of PCA and an even more acidic profile in the presence of PCA + the fungus (Figure 5C). Measurement of pH in fungal colonies alone showed that PCA exposure prompts the fungus to dramatically acidify its environment by 2–3 log units (Figure 5C). Could acidification be a trigger for the protective response of P. edwinii? Given the dual stress induced by acidification in the presence of PCA and the involvement of a stress regulator in the activation of the protective PCA sequestration and reduction phenotype, we hypothesized that acidifying the medium could cause P. edwinii to behave as though its partner fungus is present even when absent. Indeed, HCl-acidified medium caused P. edwinii alone to sequester nearly four-fold more PCA, an action that previously required the fungal partner (Figure 5D). We obtained similar results with citric acid, an organic acid made by some Aspergillus species and also commonly excreted from roots in the rhizosphere.

Bacterial Protection of Fungi is not Specific to a Single Species Pairing

To determine if mechanisms underpinning the protective partnership are general enough to allow other Paraburkholderia species to protect the Aspergillus isolate, we assayed the protective phenotype of three other Paraburkholderia species: P. SOS3, P. unamae, and P. phenazinium. P. SOS3 was isolated in Australia and is genetically similar to P. edwinii; P. unamae was isolated from the corn roots in Mexico, making it a bonafide member of a food crop rhizosphere41; and P. phenazinium, though inhibitory to our fungal isolate when grown in tandem, is another known rhizosphere member and has the ability to form nitrogen fixing nodules42,43. When challenged with 300 μM PCA, both P. SOS3 and P. unamae protected the Aspergillus isolate similar to P. edwinii, whereas P. phenazinium did not (Figure 6A). If a pH shift helps prime the protective response, we similarly wondered whether P. edwinii may also protect other fungi, given that acidification is a general trait of filamentous fungi44,45. Accordingly, we selected two model fungi, Aspergillus nidulans FGSC4 and Aspergillus terreus MF4845, to test the general ability of P. edwinii to protect soil fungi (Figures 6B, C). We further tested the ability of P. edwinii to protect fungi from different niches by including a species of Fusarium isolated from infected corn seedling as well as clinical samples of the human opportunistic pathogens Aspergillus fumigatus, Penicillium glabrum, and Penicillium echinulatum isolated from the lungs of cystic fibrosis patients. While A. fumigatus is primarily thought of as a pathogen, many Penicillium species are thought to enhance plant growth while also being opportunistic human pathogens. The identity of all clinical isolates was determined by sequencing the ITS region of the fungi. P. edwinii protected all of the aforementioned fungi except for Penicillium echinulatum from PCA assault (Figures 6DG).

Figure 6. The protection response is conserved in other Paraburkholderia species and shows partial specificity.

Figure 6.

A) The ability to protect the Aspergillus isolate was tested among several species of Paraburkholderia. Left to right: No bacterium added, P. unamae, P. SOS3, and P. phenazinium. The protection response was present in P. unamae and P. SOS3, isolated from the roots of corn in Mexico and from topsoil in Australia, respectively. P. phenazinium, itself a producer of the phenazine iodinin, appeared to support no fungal growth. B) P. edwinii tested for gross ability to protect model fungi Aspergillus nidulans FGSC4 and C) Aspergillus terreus MF4845 from PCA, as well as D) a phytopathogenic Fusarium species isolated in our lab, and three opportunistic human pathogenic fungi isolated from the lungs of CF patients including E) Aspergillus fumigatus, F) Penicillium glabrum, and G) Penicillium echinulatum. Panels arranged in pairs with the top panel showing fungal growth alone in PCA, and the bottom panel showing each fungus in the same condition as a co-colony with P. edwinii. Of the tested fungi, Penicillium echinulatum showed an inability to be protected by P. edwinii. White dashed lines represent the diameter of the fungus growing alone in the presence of PCA from the top panel superimposed upon the image of the co-colony to help visualize the increase in fungal growth resulting from P. edwinii protection. All samples were grown for 48 hrs at 30 °C.

Together, these results suggest that the ability of bacteria to protect fungi from phenazine assault is not unique to P. edwinii. Moreover, the factors involved in activating the protection program are general enough to enable a diverse array of members of this genus to protect a fungus they may not necessarily be paired with in nature, at least under laboratory conditions. The apparent inclusivity of P. edwinii between more distantly related fungi but selectivity between members of the same genus (e.g. Penicillium) suggests that while the mechanism of protection may be general, there are more factors involved that may help determine the success of such pairings in nature.

Discussion

This study was motivated by an ecological paradox: how do vulnerable fungi withstand the toxicity of a widespread class of antibiotics (phenazines) produced by co-occurring bacteria in the soil? Given that soil microbial communities are diverse, we hypothesized that other bacteria in these niches would confer protection through inter-domain partnerships. Our discovery of P. edwinii—the “prosperous friend” that helps its fungal partner withstand PCA challenge—establishes that such beneficial partnerships exist in nature and are likely common, a finding of basic interest that may also have important practical implications.

While much remains to be learned about the mechanisms underpinning the P. edwinii-Aspergillus partnership, our results underscore the importance of the biologically-controlled microenvironment and the biochemical conversation that generates it. P. edwinii effectively serves as a “toxin sponge”, sequestering PCA in a reducing environment in response to acidification driven by an Aspergillus species. The P. edwinii transcriptional repressor HrcA responds to the fungus, triggering the aggregation and PCA sequestration pathways. Yet we do not know how PCA is sequestered by P. edwinii—whether it is primarily stored extracellularly in the core of aggregates, or whether some fraction is held intracellularly. Similarly, whether specific enzymes are required to generate and maintain the reducing environment is unclear. A hint at an answer may be found in our mutagenic screen (Table S1): a transposon knockout of the E1 subunit of the pyruvate dehydrogenase gene generated a mutant that actively harms the fungus in a PCA dependent manner, with PCA crystals accumulating in the co-colony (Figure 4A). Intriguingly, pyruvate dehydrogenase has previously been implicated in PCA reduction in Pseudomonas aeruginosa46. Future experiments will reveal how the absence of this enzyme promotes PCA toxicity, and whether WT P. edwinii can protect Aspergillus against redox-active small molecules other than PCA. That P. edwinii is genetically tractable and Aspergillus has the potential to be, makes this a good model system to explore these and other mechanistic questions.

Our focus in this study on the ΔhrcA mutant derives from the fact that HrcA homologues are stress-inducible transcriptional repressors. For example, heat appears to inactivate HrcA in B. subtilis, releasing transcriptional repression of genes responsible for stress-tolerance32. An interesting possibility is that HrcA in P. edwinii regulates some of the genes involved in reducing and sequestering PCA in response to its fungal partner. If so, we speculate that HrcA degradation/deactivation is not due to heat per se, but to redox stress from PCA as well as acid or other stress produced by the fungus, where the latter stress could increase the former. We also note that the ΔhrcA mutant appears to have its protection program partially “activated” in the absence of these stressors, as the mutant will produce bacterial aggregates within the fungus even without PCA present and will sequester more PCA than WT despite being apart from its fungal partner. That the ΔhrcA mutant can sequester still more PCA with the fungus present suggests further regulators or triggers of the protection response await discovery.

An important question raised by our study is whether the phenomenon we have uncovered is environmentally relevant? We believe the answer is yes for several reasons. First, phenazine producers are widespread in nature6 and thus odds are high that fungi will encounter them. Second, we were able to readily isolate a variety of such partnerships. Third, P. edwinii showed reasonable promiscuity in its ability to protect other soil fungi including well-studied environmental species such as A. nidulans and A. terreus; we also found that several other Paraburkholderia species isolated from disparate locations manifested the phenotype of fungal protection. Fourth, PCA challenge leads to fungal acidification. pH is well known to play a critical role in determining phenazine toxicity as PCA becomes neutrally charged when protonated (pKa = 4.24), leading it to more readily pass through cell membranes38,47. One study investigating the toxicity of PCA found that at a pH of 6.0, PCA showed virtually no toxicity to C. elegans, while at pH 5.0 toxicity was very high38. Therefore, while fungal acidification can kill competing microbes, it can also render natural antibiotics made by certain bacteria more toxic. We thus predict that a fungus cooperating with an acid-tolerant beneficial bacterial partner would have a fitness advantage in phenazine-replete microbial communities. Fifth and finally, members of the Burkholderiaceae family are known to be particularly acid tolerant, which underlies their ability to associate with fungi48. This, along with phenazine resistance among several individual species, make these bacteria ideal partners to provide protection from phenazine assault to organisms which produce acid in response to stress. Intriguingly, many plant roots also produce organic acid exudates that may reinforce such partnerships. Identifying which organic acids along with other stress signals protective bacteria sense and respond to will be necessary for better understanding and predicting the environmental relevance of these type of bacterial-fungal partnerships. We also note that because resisting redox stressors such as phenazines is not uncommon in bacteria, and many fungi acidify their environments on their own accord, it is possible that relationships like this one are an example of ecological fitting, whereby novel associations can be formed between organisms under environmental pressures that make those interactions advantageous49,50. While the association between fungi and soil-dwelling Burkholderiaceae family members is old, there are many other phenazine-replete environments where these bacteria and fungi may meet as discussed below.

Given that PCA toxicity and production is predicted to increase in acidic soils that are vulnerable to climate-induced drought due to enhanced oxygen penetration8,51, finding biological agents that can protect fungi from phenazine toxicity may be relevant to agriculture. Many phenazine-sensitive filamentous fungi in the rhizosphere play important roles in water and nutrient acquisition for their host plants and can help them withstand environmental stresses. Many Paraburkholderia species also have been implicated in plant health, and the P. unamae isolate which we found to confer resistance to phenazines in this study was originally isolated from the roots of corn41. Understanding how often protective bacterial-fungal interactions occur in the rhizosphere may aid efforts to predict which microbial community compositions impact crop yield, differential stress tolerance of crops, and susceptibility to invasive pathogens. Additionally, though relatively little is known about phenazine interaction with the more deeply penetrating arbuscular mycorrhizal fungi that can help support vegetation and some food crop survival, a recent study suggests that phenazines could become toxic to this group of fungi if phenazine assault co-occurs with other environmental stresses52. Because fungi-associated vegetation play an outsized role in carbon sequestration among terrestrial plants, understanding how fungi can be included into phenazine replete environments such as plant rhizospheres matters not just for plant growth on a warmer Earth, but also for maximizing our natural reservoirs of sequestered carbon3,53.

Importantly, it is also possible that fungal-bacterial partnerships are exploited by fungal pathogens as well, as demonstrated by P. edwinii being capable of protecting a pathogenic Fusarium isolate in this study. One study showed that when Paraburkholderia glathei was paired with the fungal plant pathogens Alternaria alternata and Fusarium solani, P. glathei upregulated protein expression associated with antibiotic tolerance and oxidative stress response, while P. glathei simultaneously downregulated its starvation response54. These results raise the tantalizing possibility that this may be another example of a mutually beneficial interspecies interaction competent to resist phenazine assault, where the bacterial stress responses may serve to protect its partner fungus from other bacteria rather than defending itself from its fungal host. Whether similar dynamics can play out in the context of the human host is also worth exploring, given that pathogenic fungi such as Aspergillus fumigatus and Candida albicans can be co-isolated from the lungs of cystic fibrosis patients with Pseudomonas aeruginosa55,56. Lung function is negatively correlated with such coinfections, yet these fungi are largely inhibited by the phenazines produced by P. aeruginosa34,57. Whether protective bacterial partners might help resolve this paradox remains to be seen.

Given the ease with which we isolated our model P. edwinii-Aspergillus pairing and the relative promiscuity of the protective bacterial partner and/or fungus being protected, we posit that interspecies cooperation may be an important method by which fungal membership in microbial communities is determined. This insight has important implications for diverse problems concerning environmental and human health. We hope that the model system established in this study will enable basic biological insights to be gained that will facilitate such partnerships to be exploited for human benefit in the future.

STAR Methods

Resource Availability

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Dianne Newman (dkn@caltech.edu).

Materials Availability

Bacterial and fungal strains that were isolated in this study, and those that were generated in this study (i.e. genetically modified variants), are available upon request.

Data Availability

Genomic data generated in this study to characterize the co-isolated Aspergillus species and P. edwinii, and used to generate in-frame deletions for P. edwinii, have been deposited with GenBank under accession numbers JAHXQV000000000 (Aspergillus whole genome shotgun sequence) and CP080095CP080096 (full chromosomes for P. edwinii) and are available as of the date of publication. This study does not report any original code. Microscopy data reported in this paper will be shared by the lead contact upon request, and any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Experimental Model and Subject Details

Strains used in this study are listed in Table S2. E coli S1758 was used for cloning and conjugation of the pMQ30 suicide vector during construction of deletion mutants. E. coli strain B215559 was used for mating of the mini-mariner containing pSC189. All E. coli were grown overnight in 5 mL lysogeny broth (LB), supplemented with 300 μM diaminopimelic acid (DAP) for B2155. Strains were grown shaking at 250 RPM at 37 °C for cloning constructs and 30 °C when used for conjugations. Pseudomonas fluorescens 2–79, Pseudomonas chlororaphis, Pseudomonas chlororaphis subsp. aureofaciens were grown overnight in 5 ml LB at 30 °C shaking at 250 rpm. Paraburkholderia phenazinium, Paraburkholderia unamae, Paraburkholderia SOS3, and Paraburkholderia edwinii were grown 24 hours under the same conditions in 5 mL potato dextrose broth (PDB) unless otherwise indicated. Primers used in this study can be found in Table S3.

The environmental Aspergillus isolate was grown on potato dextrose agar (PDA) at 30 °C, and all experiments which paired P. edwinii and the Aspergillus isolate were grown for 48 hours unless otherwise indicated. Clinical Aspergillus fumigatus as well as Penicillium species isolates were obtained from Children’s’ Hospital Los Angeles, and were grown under the same conditions. Growth on PDA for 1 week at 30 °C to allow conidiation was performed on all fungi to collect spores for storage and experimentation. Fungal conidiospores were collected by scraping mature colonies with a pipette tip, filtering the spores through cheesecloth, and freezing in 15% glycerol. All PDA plates contained 1.75% agar, while all other plates contained 1.5% agar.

Method Details

Co-isolation of phenazine tolerant fungal-bacterial pairings.

100 mg of material was collected within the top 3 centimeters of top soil from outside of the Beckman Institute on the campus of the California Institute of Technology (34°8’21.15”N 118°7’36.05”W). The collected soil was washed in 0.1% TWEEN® 20 and pulsed in a sonicator bath for one minute to break up larger soil components. A serial dilution of the suspension was plated to extinction on potato dextrose medium. Fungal colonies were screened for adherent bacterial associates via amplification of the 16S rRNA encoding region of the bacterial genomes, and discovered pairings were subjected to challenge on potato dextrose agar supplemented with 300 μM phenazine-1-carboxylic acid (see Figures 1A and S1A). Surviving co-colonies were serially passaged in yeast-peptone (YP) medium to isolate the bacterium. The fungal partners were cured by growth on YP medium supplemented with 50 μg ml−1 gentamicin, repatched onto PDA and grown for one week at 30 °C until conidiation. Spores were collected and frozen in 12.5% glycerol.

Phenazine Protection Assay

P. edwinii was grown shaking overnight in potato dextrose broth at 30 °C. Cultures were normalized to OD600 of 2.5, diluted 1:5, and mixed 1:1 with a suspension of ~ 4 × 107 spores collected from the Aspergillus species. 6 ul of this mixture was spotted onto potato dextrose plates supplemented with 300 μM PCA and allowed to grow for 48 hours before measuring the co-colony diameter with the aid of Keyence digital microscope (VHX-600).

Mutant transposon screen of P. edwinii.

Transposon mutagenesis of P. edwinii was achieved using a mini-mariner transposon housed in the pSC189 vector and mutants were generated as follows. P. edwinii was grown overnight in potato dextrose broth, and the pSC189 vector-containing B2155 strain of E. coli was grown in LB with 50 μg ml−1 kanamycin and supplemented with 300 μM diaminopimelic acid (DAP). The E. coli was sub-cultured for 3–4 hours until early log phase was achieved. 1 mL of each culture was pelleted and washed in their respective media before being resuspended in 100 μl of YP. The strains were mixed together and several 5 μl replicates were plated on YP plates overnight. Colonies were then scraped up and grown on YP plates lacking DAP and containing 30 μg ml−1 kanamycin to select for transposon insertions. Colonies were picked after two days and grown overnight in a 96 well plate in YP containing 60 μg ml−1 kanamycin. Mutants were mixed with spores of the Aspergillus species and grown on potato dextrose supplemented with PCA as above to screen for a dysregulated protection response. Mutants of interest had their transposition insertion mapped using arbitrary PCR.

Construction of in-frame deletion and complementation strains in P. edwinii.

In-frame deletions were constructed in P. edwinii using homologous recombination as previously described in Pseudomonas species with modification60. ~1 KB regions upstream and downstream of the genomic region to be deleted were cloned into the pMQ30 suicide vector at the SmaI site, and the resulting constructs were electroporated into the S17 E. coli strain. Matings were conducted as described above, and the resulting mated colonies were scraped up and plated on potato dextrose containing 50 μg ml−1 gentamycin and 15 μg ml−1 chloramphenicol. Colonies were restreaked on selective plates, and finally patched onto YP plates amended with 7.5% (w/v) sucrose. Candidate colonies grown after 48 hours were screened by polymerase chain reaction to identify those containing the desired in-frame deletions.

The pBBR1MCS-2 expression plasmid was used for complementation experiments61. The gene of interest plus a 24 bp region upstream of the start codon were cloned into the plasmid and electroporated into P. edwinii using the following protocol. P. edwinii was grown overnight in potato dextrose broth. 4–5 mL of the culture was spun down and washed twice with 20% (w/v) sucrose at room temperature, before resuspending it in 100 μl of 20% (w/v) sucrose. 100 ng of the plasmid was added to 50 μL of the resuspended culture and electroporated using standard E. coli settings. Cells were allowed to recover for 2 hours in YP at 30 °C before plating to YP plates containing 30 μg ml−1 kanamycin. Colonies were grown shaking overnight in potato dextrose broth with 60 μg ml−1 kanamycin before being used in growth assays without antibiotic selection as described above.

Biofilm assay

V8 medium was produced by diluting V8 tomato juice 1:5 with ddH2O the same day of the experiment. Overnight P. edwinii cultures grown in potato dextrose broth were normalized to an OD600 of 2.5 and diluted 1:67 in the V8 medium and vortexed. 100 μL was pipetted per well into 96 well microtiter dishes as described for other systems33. Biofilms were stored in a humidified microchamber and allowed to grow for 24 hours at 30 °C before being stained with 0.1% crystal violet for 20 minutes, and rinsed twice with ddH20.

Motility assay

P. edwinii strains were tested for motility using a swim assay. A modified M9 medium lacking added NaCl was made using 0.35% agar. Strains of P. edwinii were normalized to an OD600 of 2.5 and 100 μL was pipetted into a 96 well microtiter dish. A p10 pipette tip was dipped into one of these wells and subsequently plunged into the swim agar. Plates were incubated at 30 °C for 72 h.

Phenazine sequestration assay

5 μl each of a spore suspension from the Aspergillus species and an overnight culture of P. edwinii normalized to OD600 2.5 were spotted 5 ul apart from each other on potato dextrose agar supplemented with 300 uM PCA and grown until the P. edwinii colonies developed a distinct yellow hue, approximately 48 h. Material from the P. edwinii colonies was then collected and resuspended in 250 uL Phosphate buffer saline solution (PBS). The samples were centrifuged, and the supernatant was read for absorbance at 365 nm in a spectrophotometer and compared to a standard curve to derive PCA concentration. The pelleted fraction of the sample was dried and weighed to normalize sequestered PCA to bacterial dry weight mass.

This procedure was repeated to determine the fraction of reduced PCA present, but samples were collected and analyzed in an anerobic chamber, and the reduced PCA was identified using an excitation of 365 nm and read at an emission of 528 nm on a BioTek plate reader. Concentration was calculated using a standard curve of reduced PCA and compared to the total PCA concentration to determine the reduced fraction.

PCA Degradation Assay

P. edwinii was added to 5 ml of PDB that was spiked with 300 μM PCA. For combined bacterial-fungal samples, the Aspergillus isolate was pre-grown in the medium for 3 days to allow an appreciable amount of slower growing fungal biomass to coexist with the subsequently added P. edwinii and PCA. 250 μl was sampled every 24 hours for 3 days, and all cultures had reached stationary phase by the first sampling. Cells were pelleted, and the supernatant was used to quantify PCA by absorbance at 365 nm compared to a standard curve and PCA negative control.

Microelectrode Profiling

Aspergillus and P. edwinii colonies were grown side by side or alone on PDA as above for 48 hours at 30 °C. Unisense pH and redox 25 μm tip microelectrodes were paired with a steel reference probe (Unisense) in accordance with the manufacturer’s instructions for use and calibration, and were readthrough a high-impedance millivoltmeter-equipped multimeter, while a 10 μm tip O2 probe was read through the multimeter’s picoampere amplifier. Oxygen concentration was read at 10 μm interval depths within the colonies, while pH and redox values were read at 25 μm intervals through the colonies. Redox values are given relative to a standard hydrogen electrode. Initial calibration and recording of data were performed using the Unisense SensorTrace Suite software. All calibrations and measurements were conducted at 23 °C.

MiPACT clearing and HCR

Fungal tissue was cleared using the MiPACT procedure as described previously with minor modification30. Briefly, samples were grown for 48 h, and whole co-colonies cut from their growth medium, removing as much agar as possible. Samples were incubated at 4 °C overnight in 3% (v/v) paraformaldehyde. Samples were cleared for 2 weeks in a spinning 8% (w/v) SDS solution at 37 °C. Samples were washed in PBS, treated with 1 mg ml−1 lysozyme for 30 minutes at 30 °C before being hybridized with HCR 2.0 eubacterial probes and incubated overnight at 46 °C while gently shaking. Samples were washed and the amplification step was performed using hairpins tagged with an AlexaFluor 647 fluorophore for visualization62. Samples were stained with 1 μg ml−1 DAPI, and microscopy was performed on an inverted confocal Leica model TCS SPE confocal microscope with a 10x objective for the colony center and edge, and a Nikon Ti2 Eclipse widefield microscope with a 4x objective for images of the colony ridge. Contrast of the HCR generated images were normalized to the brightest signal in like samples (i.e. colony edge vs edge, center vs center). Contrast was adjusted independently for each DAPI stained images for clarity of fungal morphology present near the bacteria. Images were analyzed in using Fiji63.

CFU Quantification

Fungal-bacterial co-colonies were grown as above, and the colonies were homogenized using a tissue homogenizer (Bio-Gen Pro200) at 60% power for one minute. The resulting slurry was serially diluted and plated to YP medium supplemented with 50 μg ml−1 nystatin to prevent fungal growth. Bacterial colonies were grown for 48 hours and counted.

HPLC-MS

P. edwinii colonies were scraped from their growth plates and resuspended in phosphate buffer saline before being pelleted. Supernatants were frozen and thawed to encourage precipitation of large particulate condiments, and centrifuged using a cellulose acetate Spin-X column (VWR). 20 ul of the supernatant was injected onto a Waters e2695 Separations Module equipped with a 2998 PDA Detector and run through a C18 column (XBridge, 3.5 um, 2.1 × 50 mm) housed at 40 °C at a flow rate of 0.5 ml min−1 for 20 mins. The mobile phase consisted of ddH20 + 0.04% (v/v) NH4OH with a gradient to 70% (v/v) acetonitrile + 0.04% (v/v) NH4OH with a constant background of 2% (v/v) methanol and compared against a prepared standard. The identify of PCA was confirmed using a quadrupole Time of Flight MS (Q-TOF, Xevo G2-XS, Waters) targeting a mass of 225.1 m/z.

Genomic Sequencing and Annotation

P. edwinii genomic DNA was recovered using the Qiagen plant and tissue kit on 1 mL of culture grown overnight in PDB. Genomic DNA from the Aspergillus species was recovered by growing it for 72 hours in PDB until large fungal aggregates had formed. These aggregates were frozen in liquid nitrogen, and crushed with a mortar and pestle followed by a chloroform extraction.

Illumina sequencing of both genomes was conducted at the Caltech genomic core facility, and subsequent PACBio sequencing was carried out at the UC Irvine Genomics High Throughput Facility. Genome assembly was performed using SPAdes version 3.12.064, and BASys was used for genome annotation of P. edwinii as provided by the Health Sciences Library System at the University of Pittsburg65. Genomic comparisons were performed using JSpeciesWS66. The P. edwinii whole genome has been deposited with GenBank (accession CP080095CP080096). The Aspergillus species whole genome shotgun project has been deposited at DDBJ/ENA/GenBank under the accession JAHXQV000000000. The version described in this paper is version JAHXQV010000000.

Quantification and Statistical Analysis

All statistics were calculated using GraphPad Prism 8.4.3. Comparisons of CFUs, fungal growth area, bacterial swim area, and PCA sequestration were conducted using an unpaired t test. A Welch’s correction was further applied as part of the experimental design in the case of Figure 3D and 5D to account for assumed unequal variances produced between two different species differentially handling PCA and adding a known metabolizable organic acid, respectively.

Supplementary Material

Supplemental Material

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
N/A
Bacterial and virus strains
Pseudomonas fluorescens 2–79 5 N/A
Pseudomonas. fluorescens phz(−) 29 N/A
Pseudomonas chlororaphis PCL 1391 4 N/A
Pseudomonas chlororaphis phz(−) 4 N/A
Pseudomonas aureofaciens 30–84 28 N/A
E. coli S17 λ(pir)
thi pro hsdR-hsdM+ “recA RP4–2::TcMu-Km::Tn7
58 N/A
E. coli β2155
thrB1004 pro thi strA hsdsS lacZD M15 (F`lacZD M15 lacIq traD36 proA+ proB+) D dapA::erm (Ermr) pir::RP4 [::kan (Kmr)]
59 N/A
Paraburkholderia SOS3 Provided by Sustainable Organic Solutions Pty. Ltd. Building 1015, Gate 4, 80–120 Meiers Road, Indooroopilly, 4068 QLD, Australia N/A
Paraburkholderia unamae 40 N/A
Paraburkholderia phenazinium 42 N/A
Biological samples
N/A
Chemicals, peptides, and recombinant proteins
N/A
Critical commercial assays
N/A
Deposited data
Paraburkholderia edwinii complete genome NCBI - CP080095CP080096 Pe01
Aspergillus isolate genome assembly NCBI - JAHXQV000000000 ADI1
Experimental models: Cell lines
N/A
Experimental models: Organisms/strains
Paraburkholderia edwinii – WT This Study DKN_2541
Paraburkholderia edwinii ΔhrcA This Study DKN_2542
Paraburkholderia edwinii ::pdhA This Study DKN_2543
Paraburkholderia edwinii ::hrcA This Study DKN_2544
Paraburkholderia edwinii ::flgE This Study DKN_2545
Paraburkholderia edwinii
Transposon insertion into putative potassium transporter
This Study DKN_2546
Paraburkholderia edwinii
Transposon insertion into putative LysR transcriptional regulator
This Study DKN_2547
Paraburkholderia edwinii
Transposon insertion into gene of unknown function
This Study DKN_2548
Lutibacter isolate KMD_2017 This Study DKN_2549
Aspergillus isolate ADI1 This Study DKN_2550
Aspergillus isoalte_02 KMD_2017 This Study DKN_2551
Lecythophora isolate KMD_2017 This Study DKN_2552
Fusarium isolate KMD_2018 This Study DKN_2553
Aspergillus fumigatus isolate KMD_2018 This Study DKN_2554
Penicillium isolate_01 KMD_2018 This Study DKN_2555
Penicillium isolate_02 KMD_2018 This Study DKN_2556
Paraburkholderia isolate KMD_2017 – WT This Study DKN_2557
Oligonucleotides
Hybridization Chain Reaction eubacterial probe 2.0
GCTGCCTCCCGTAGGAGTTATAGCATTCTTTCTTGAGGAGGGCAGCAAACGGGAAGAG
30 N/A
B1 hairpin probes – AlexaFluor 647
CGTAAAGGAAGACTCTTCCCGTTTGCTGCCCTCCTCGCATTCTTTCTTGAGGAGGGCAGCAAACGGGAAGAG
GAGGAGGGCAGCAAACGGGAAGAGTCTTCCTTTACGCTCTTCCCGTTTGCTGCCCTCCTCAAGAAAGAATGC
62 N/A
Primers for strain construction: See Table S3.
Recombinant DNA
pMQ30 60 N/A
pMQ30 ΔhrcA This Study N/A
pBBR1 MSC-2 61 N/A
pBBR1 MSC-2 hrcA This Study N/A
mini-mariner plasmid 31 N/A
Software and algorithms
FIJI https://imagej.net/software/fiji/ N/A
SPAdes version 3.12.0 https://cab.spbu.ru/software/spades/ N/A
JSpeciesWS http://jspecies.ribohost.com/jspeciesws/ N/A
Keyence VHX-600 measurement software N/A N/A
Other
N/A

Highlights:

Co-isolation of phenazine tolerant fungal–bacterial pairings

The fungal partners are phenazine sensitive in the absence of the bacterial partner

The bacterium, P. edwinii, acts as a toxin sponge by sequestering this antibiotic

P. edwinii’s protection response is partially triggered by a fungus-induced pH shift

Acknowledgements

We thank members of the Newman lab for constructive feedback on the project and the manuscript, and The Millard and Muriel Jacobs Genetics and Genomics Laboratory at Caltech and Igor Antoshechkin for support during library preparation and sequencing. We thank Marko Kojic for help screening transposon mutants, as well as Robert Cramer, Deborah Hogan, and Jeff Holloman for sharing their expertise in mycology. We thank Susan Duffy for skillful instruction in biology and the belief that substantial goals are achievable when we work together. This work was supported by the Life Sciences Research Foundation (postdoctoral fellowship to K.M.D.), the Resnick Sustainability Institute (K.M.D. and D.K.N.) and the NIH (1R01AI127850- 01A1 to D.K.N.).

Footnotes

Declaration of Interests

The authors have filed a provisional patent (CIT-8617-P) “Biocontrol strain to protect fungi from phenazine antibiotics” based on this work.

References

  • 1.Delfino E, Del Puente F, Briano F, Sepulcri C, and Giacobbe DR (2019). Respiratory Fungal Diseases in Adult Patients with Cystic Fibrosis. Clin Med Insights Circ Respir Pulm Med 13:1179548419849939. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Jahagirdar S, Kambrekar DN, Navi SS, and Kunta M (2019). Plant Growth-Promoting Fungi: Diversity and Classification. In Bioactive Molecules in Plant Defense: Signaling in Growth and Stress, Jogaiah S and Abdelrahman M, eds. (Springer International Publishing; ), pp. 25–34. [Google Scholar]
  • 3.Soudzilovskaia NA, van Bodegom PM, Terrer C, van’t Zelfde M, McCallum I, Luke McCormack M, Fisher JB, Brundrett MC, de Sá NC, and Tedersoo L (2019). Global Mycorrhizal Plant Distribution Linked to Terrestrial Carbon Stocks. Nature Communications 10, 5077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Chin T, Bloemberg G, Bij A, Drift K, Schripsema J, Kroon B, Scheffer R, Keel C, Bakker P, Tichy H-V, et al. (1998). Biocontrol by Phenazine-1-Carboxamide-Producing Pseudomonas chlororaphis PCL1391 of Tomato Root Rot Caused by Fusarium oxysporum f. sp. radicis-lycopersici. Mol Plant Microbe Interact 11(11), 1069–1077. [Google Scholar]
  • 5.Thomashow LS, and Weller DM (1988). Role of a phenazine antibiotic from Pseudomonas fluorescens in biological control of Gaeumannomyces graminis var. tritici. J Bacteriol 170(8), 3499–3508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Dar D, Thomashow LS, Weller DM, and Newman DK (2020). Global Landscape of Phenazine Biosynthesis and Biodegradation Reveals Species-Specific Colonization Patterns in Agricultural Soils and Crop Microbiomes. eLife 9, e59726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Mavrodi OV, Mavrodi DV, Parejko JA, Thomashow LS, and Weller DM (2012). Irrigation Differentially Impacts Populations of Indigenous Antibiotic-Producing Pseudomonas spp. in the Rhizosphere of Wheat. Appl. Environ. Microbiol 78(9), 3214–3220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Mavrodi DV, Mavrodi OV, Elbourne LDH, Tetu S, Bonsall RF, Parejko J, Yang M, Paulsen IT, Weller DM, and Thomashow LS (2018). Long-Term Irrigation Affects the Dynamics and Activity of the Wheat Rhizosphere Microbiome. Front Plant Sci 9, 345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Trejo-Hernández A, Andrade-Domínguez A, Hernández M, and Encarnación S (2014). Interspecies Competition Triggers Virulence and Mutability in Candida albicansPseudomonas aeruginosa Mixed Biofilms. The ISME Journal 8(10), 1974–1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sass G, Ansari SR, Dietl A-M, Déziel E, Haas H, and Stevens DA (2019). Intermicrobial Interaction: Aspergillus fumigatus Siderophores Protect Against Competition by Pseudomonas aeruginosa. PLOS ONE 14(5), e0216085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Pan SK, and Das A (2010). In Vivo Interaction in Antagonistic Potential of Trichoderma spp. and Pseudomonas fluorescens. Journal of Biological Control 24(3), 263–267. [Google Scholar]
  • 12.Patel NP, Raju M, Haldar S, and Chatterjee PB (2020). Characterization of Phenazine-1-Carboxylic Acid by Klebsiella sp. NP-C49 from the Coral Environment in Gulf of Kutch, India. Arch Microbiol 202(2), 351–359. [DOI] [PubMed] [Google Scholar]
  • 13.Amin R, Dupuis A, Aaron SD, and Ratjen F (2010). The Effect of Chronic Infection with Aspergillus fumigatus on Lung Function and Hospitalization in Patients with Cystic Fibrosis. Chest 137(1), 171–176. [DOI] [PubMed] [Google Scholar]
  • 14.Bonfante P, and Genre A (2010). Mechanisms Underlying Beneficial Plant–Fungus Interactions in Mycorrhizal Symbiosis. Nature Communications 1, 48. [DOI] [PubMed] [Google Scholar]
  • 15.Marjanović Ž, and Nehls U (2008). Ectomycorrhiza and Water Transport. In Mycorrhiza: State of the Art, Genetics and Molecular Biology, Eco-Function, Biotechnology, Eco-Physiology, Structure and Systematics, Varma A, ed. (Springer; ), pp. 149–159. [Google Scholar]
  • 16.Varsha KK, Nishant G, Sneha SM, Shilpa G, Devendra L, Priya S, and Nampoothiri KM (2016). Antifungal, Anticancer and Aminopeptidase Inhibitory Potential of a Phenazine Compound Produced by Lactococcus BSN307. Indian J Microbiol 56(4), 411–416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Fisher MC, Henk DA, Briggs CJ, Brownstein JS, Madoff LC, McCraw SL, and Gurr SJ (2012). Emerging Fungal Threats to Animal, Plant and Ecosystem Health. Nature 484(7393), 186–194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Perry EK, and Newman DK (2019). The Transcription Factors ActR and SoxR Differentially Affect the Phenazine Tolerance of Agrobacterium tumefaciens. Molecular Microbiology 112(1), 199–218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Costa KC, Bergkessel M, Saunders S, Korlach J, and Newman DK (2015). Enzymatic Degradation of Phenazines Can Generate Energy and Protect Sensitive Organisms from Toxicity. mBio 6(6), e01520–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Yang Z-J, Wang W, Jin Y, Hu H-B, Zhang X-H, and Xu Y-Q (2007). Isolation, Identification, and Degradation Characteristics of Phenazine-1-Carboxylic Acid–Degrading Strain Sphingomonas sp. DP58. Curr Microbiol 55(4), 284–287. [DOI] [PubMed] [Google Scholar]
  • 21.Nazir R, Tazetdinova DI, and van Elsas JD (2014). Burkholderia terrae BS001 Migrates Proficiently with Diverse Fungal Hosts through Soil and Provides Protection from Antifungal Agents. Frontiers in Microbiology 11(5), 598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Partida-Martinez LP, and Hertweck C (2005). Pathogenic Fungus Harbours Endosymbiotic Bacteria for Toxin Production. Nature 437(7060), 884–888. [DOI] [PubMed] [Google Scholar]
  • 23.Seigle-Murandi F, Guiraud P, Croize J, Falsen E, and Eriksson KL (1996). Bacteria Are Omnipresent on Phanerochaete chrysosporium Burdsall. Applied and environmental microbiology 62(7), 2477–2481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bahram M, Hildebrand F, Forslund SK, Anderson JL, Soudzilovskaia NA, Bodegom PM, Bengtsson-Palme J, Anslan S, Coelho LP, Harend H, et al. (2018). Structure and Function of the Global Topsoil Microbiome. Nature 560(7717), 233–237. [DOI] [PubMed] [Google Scholar]
  • 25.Levy A, Merritt AJ, Mayo MJ, Chang BJ, Abbott LK, and Inglis TJJ (2009). Association Between Burkholderia Species and Arbuscular Mycorrhizal Fungus Spores in Soil. Soil Biology and Biochemistry 41(8), 1757–1759. [Google Scholar]
  • 26.Richter M, and Rosselló-Móra R (2009). Shifting the Genomic Gold Standard for the Prokaryotic Species Definition. PNAS 106(45), 19126–19131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Simionato AS, Navarro MOP, de Jesus MLA, Barazetti AR, da Silva CS, Simões GC, Balbi-Peña MI, de Mello JCP, Panagio LA, de Almeida RSC, et al. (2017). The Effect of Phenazine-1-Carboxylic Acid on Mycelial Growth of Botrytis cinerea Produced by Pseudomonas aeruginosa LV Strain. Front Microbiol 8, 1102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Pierson LS, and Thomashow LS (1992). Cloning and Heterologous Expression of the Phenazine Biosynthetic Locus from Pseudomonas aureofaciens 30–84. Mol Plant Microbe Interact 5(4), 330–339. [DOI] [PubMed] [Google Scholar]
  • 29.Mavrodi DV, Ksenzenko VN, Bonsall RF, Cook RJ, Boronin AM, and Thomashow LS (1998). A Seven-Gene Locus for Synthesis of Phenazine-1-Carboxylic Acid by Pseudomonas fluorescens 2–79. J Bacteriol 180(9), 2541–2548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.DePas WH, Starwalt-Lee R, Sambeek LV, Kumar SR, Gradinaru V, and Newman DK (2016). Exposing the Three-Dimensional Biogeography and Metabolic States of Pathogens in Cystic Fibrosis Sputum via Hydrogel Embedding, Clearing, and rRNA Labeling. mBio 7(5), e00796–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Chiang SL, and Rubin EJ (2002). Construction of a Mariner-Based Transposon for Epitope-Tagging and Genomic Targeting. Gene 296(1–2), 179–185. [DOI] [PubMed] [Google Scholar]
  • 32.Schulz A, and Schumann W (1996). hrcA, the First Gene of the Bacillus subtilis dnaK operon Encodes a Negative Regulator of Class I Heat Shock Genes. J Bacteriol 178(4), 1088–1093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.O’Toole GA, and Kolter R (1998). Initiation of Biofilm Formation in Pseudomonas fluorescens WCS365 Proceeds via Multiple, Convergent Signalling Pathways: a Genetic Analysis. Molecular Microbiology 28(3), 449–461. [DOI] [PubMed] [Google Scholar]
  • 34.Morales DK, Grahl N, Okegbe C, Dietrich LEP, Jacobs NJ, and Hogan DA (2013). Control of Candida albicans Metabolism and Biofilm Formation by Pseudomonas aeruginosa Phenazines. mBio 4(1), e00526–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Rada B, and Leto TL (2013). Pyocyanin effects on respiratory epithelium: relevance in Pseudomonas aeruginosa airway infections. Trends Microbiol 21(2), 73–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Allen L, Dockrell DH, Pattery T, Lee DG, Cornelis P, Hellewell PG, and Whyte MKB (2005). Pyocyanin Production by Pseudomonas aeruginosa Induces Neutrophil Apoptosis and Impairs Neutrophil-Mediated Host Defenses In vivo. J Immunol 174(6), 3643–3649. [DOI] [PubMed] [Google Scholar]
  • 37.Zhu X, Zeng Y, Zhao X, Zou S, He Y-W, and Liang Y (2017). A Genetic Screen in Combination with Biochemical Analysis in Saccharomyces cerevisiae Indicates that Phenazine-1-Carboxylic Acid is Harmful to Vesicular Trafficking and Autophagy. Scientific Reports 7(1), 1967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Cezairliyan B, Vinayavekhin N, Grenfell-Lee D, Yuen G, Saghatelian A, and Ausubel F (2013). Identification of Pseudomonas aeruginosa Phenazines that Kill Caenorhabditis elegans. PLoS pathogens 9(1), e1003101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Zhang L, Tian X, Kuang S, Liu G, Zhang C, and Sun C (2017). Antagonistic Activity and Mode of Action of Phenazine-1-Carboxylic Acid, Produced by Marine Bacterium Pseudomonas aeruginosa PA31x, Against Vibrio anguillarum In vitro and in a Zebrafish In vivo Model. Front Microbiol 8, 289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Liaud N, Giniés C, Navarro D, Fabre N, Crapart S, Gimbert I-H, Levasseur A, Raouche S, and Sigoillot J-C (2014). Exploring Fungal Biodiversity: Organic Acid Production by 66 Strains of Filamentous Fungi. Fungal Biology and Biotechnology 1(1), 1.26457194 [Google Scholar]
  • 41.Caballero-Mellado J, Martínez-Aguilar L, Paredes-Valdez G, and Estrada-de los Santos P (2004). Burkholderia unamae sp. nov., an N2-Fixing Rhizospheric and Endophytic Species. International journal of systematic and evolutionary microbiology 54(4), 1165–72. [DOI] [PubMed] [Google Scholar]
  • 42.Dias GM, Pires A. de S., Grilo VS, Castro MR, Vilela L. de F., and Neves BC (2019). Comparative Genomics of Paraburkholderia kururiensis and its Potential in Bioremediation, Biofertilization, and Biocontrol of Plant Pathogens. MicrobiologyOpen 8(8), e00801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Viallard V, Poirier I, Cournoyer B, Haurat J, Wiebkin S, Ophel-Keller K, and Balandreau J (1998). Burkholderia graminis sp. nov., a Rhizospheric Burkholderia Species, and Reassessment of [Pseudomonas] phenazinium, [Pseudomonas] pyrrocinia and [Pseudomonas] glathei as Burkholderia. International Journal of Systematic and Evolutionary Microbiology, 48(2), 549–563. [DOI] [PubMed] [Google Scholar]
  • 44.Tkacz JS, and Lange L eds. (2004). Advances in Fungal Biotechnology for Industry, Agriculture, and Medicine. (Springer US; ), pp 307–340. [Google Scholar]
  • 45.Andersen MR, Lehmann L, and Nielsen J (2009). Systemic Analysis of the Response of Aspergillus niger to Ambient pH. Genome Biol 10(5), R47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Glasser NR, Wang BX, Hoy JA, and Newman DK (2017). The Pyruvate and α-Ketoglutarate Dehydrogenase Complexes of Pseudomonas aeruginosa Catalyze Pyocyanin and Phenazine-1-Carboxylic Acid Reduction via the Subunit Dihydrolipoamide Dehydrogenase *. Journal of Biological Chemistry 292(13), 5593–5607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Brisbane PG, Janik LJ, Tate ME, and Warren RF (1987). Revised Structure for the Phenazine Antibiotic from Pseudomonas fluorescens 2–79 (NRRL B-15132). Antimicrob Agents Chemother 31(12), 1967–1971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Stopnisek N, Bodenhausen N, Frey B, Fierer N, Eberl L, and Weisskopf L (2014). Genus-Wide Acid Tolerance Accounts for the Biogeographical Distribution of Soil Burkholderia Populations. Environ Microbiol 16(6), 1503–1512. [DOI] [PubMed] [Google Scholar]
  • 49.Aanen DK, and Bisseling T (2014). The Birth of Cooperation. Science 345(6192), 29–30. [DOI] [PubMed] [Google Scholar]
  • 50.Hom EFY, and Murray AW (2014). Niche Engineering Demonstrates a Latent Capacity for Fungal-Algal Mutualism. Science 345(6192), 94–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Mavrodi DV, Mavrodi OV, Parejko JA, Bonsall RF, Kwak Y-S, Paulitz TC, Thomashow LS, and Weller DM (2012). Accumulation of the Antibiotic Phenazine-1-Carboxylic Acid in the Rhizosphere of Dryland Cereals. Appl. Environ. Microbiol 78(3), 804–812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Dwivedi D, Johri BN, Ineichen K, Wray V, and Wiemken A (2009). Impact of Antifungals Producing Rhizobacteria on the Performance of Vigna radiata in the Presence of Arbuscular Mycorrhizal Fungi. Mycorrhiza 19(9), 559–570. [DOI] [PubMed] [Google Scholar]
  • 53.Varney RM, Chadburn SE, Friedlingstein P, Burke EJ, Koven CD, Hugelius G, and Cox PM (2020). A Spatial Emergent Constraint on the Sensitivity of Soil Carbon Turnover to Global Warming. Nature Communications 11, 5544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Stopnisek N, Zühlke D, Carlier A, Barberán A, Fierer N, Becher D, Riedel K, Eberl L, and Weisskopf L (2016). Molecular Mechanisms Underlying the Close Association Between Soil Burkholderia and Fungi. ISME J 10(1), 253–264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Al-momani H, Perry A, Stewart CJ, Jones R, Krishnan A, Robertson AG, Bourke S, Doe S, Cummings SP, Anderson A, et al. (2016). Microbiological Profiles of Sputum and Gastric Juice Aspirates in Cystic Fibrosis Patients. Scientific Reports 6(1), 26985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Peleg A, Hogan D, and Mylonakis E (2010). Medically Important Bacterial-Fungal Interactions. Nature Reviews Microbiology 8, 340–9. [DOI] [PubMed] [Google Scholar]
  • 57.Briard B, Bomme P, Lechner BE, Mislin GLA, Lair V, Prévost M-C, Latgé J-P, Haas H, and Beauvais A (2015). Pseudomonas aeruginosa Manipulates Redox and Iron Homeostasis of its Microbiota Partner Aspergillus fumigatus via Phenazines. Sci Rep 5(2), 8220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Simon R, Priefer U, and Pühler A (1983). A Broad Host Range Mobilization System for In vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Nat Biotechnol 1, 784–791. [Google Scholar]
  • 59.Dehio C, and Meyer M (1997). Maintenance of Broad-Host-Range Incompatibility Group P and Group Q Plasmids and Transposition of Tn5 in Bartonella henselae Following Conjugal Plasmid Transfer from Escherichia coli. J Bacteriol 179(2), 538–540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Shanks RMQ, Caiazza NC, Hinsa SM, Toutain CM, and O’Toole GA (2006). Saccharomyces cerevisiae-Based Molecular Tool Kit for Manipulation of Genes from Gram-Negative Bacteria. Appl Environ Microbiol 72(7), 5027–5036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM, and Peterson KM (1995). Four New Derivatives of the Broad-Host-Range Cloning Vector pBBR1MCS, Carrying Different Antibiotic-Resistance Cassettes. Gene 166(1), 175–176. [DOI] [PubMed] [Google Scholar]
  • 62.Choi HMT, Beck VA, and Pierce NA (2014). Next-Generation In situ Hybridization Chain Reaction: Higher Gain, Lower Cost, Greater Durability. ACS Nano 8(5), 4284–4294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, et al. (2012). Fiji: an Open-Source Platform for Biological-Image Analysis. Nat Methods 9, 676–682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, et al. (2012). SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing. J Comput Biol 19(5), 455–477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Van Domselaar GH, Stothard P, Shrivastava S, Cruz JA, Guo A, Dong X, Lu P, Szafron D, Greiner R, and Wishart DS (2005). BASys: a Web Server for Automated Bacterial Genome Annotation. Nucleic Acids Res 33, W455–W459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Richter M, Rosselló-Móra R, Oliver Glöckner F, and Peplies J (2016). JSpeciesWS: a Web Server for Prokaryotic Species Circumscription Based on Pairwise Genome Comparison. Bioinformatics 32(6), 929–931. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Material

Data Availability Statement

Genomic data generated in this study to characterize the co-isolated Aspergillus species and P. edwinii, and used to generate in-frame deletions for P. edwinii, have been deposited with GenBank under accession numbers JAHXQV000000000 (Aspergillus whole genome shotgun sequence) and CP080095CP080096 (full chromosomes for P. edwinii) and are available as of the date of publication. This study does not report any original code. Microscopy data reported in this paper will be shared by the lead contact upon request, and any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

RESOURCES