Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Mar 1.
Published in final edited form as: Am J Geriatr Psychiatry. 2021 Jul 29;30(3):332–337. doi: 10.1016/j.jagp.2021.07.012

Increased levels of circulating cell-free mtDNA in the plasma of subjects with late-life depression and frailty: a preliminary study

Emi Ampo 1, Ana Paula Medes-Silva 2, Vanessa Goncalves 2, Jenna M Bartley 3, George A Kuchel 3, Breno S Diniz 2,3,4
PMCID: PMC8799751  NIHMSID: NIHMS1728631  PMID: 34412934

Abstract

Objective:

To evaluate the circulating cell-free mitochondrial DNA (ccf-mtDNA) levels, a marker of cellular stress and damage, in older adults with late-life depression (LLD) and frailty. We hypothesize that individuals with both frailty and LLD will have higher ccf-mtDNA levels than individuals with either condition in isolation.

Methods:

Fifty-three older adults (Never Depressed+Robust (reference group, n=16), LLD+Robust (n=9), Never Depressed+Pre-frail/Frail (n=5), LLD+Pre-frail/Frail (n=23)) were included in the study. DNA was extracted from EDTA plasma samples, and ccf-mtDNA was quantified by RT-PCR.

Results:

We found a statistically significant difference in the levels of ccf-mtDNA across groups (F(3,49)=3.07, p=0.036), with individuals in the LLD+Pre-Frail/Frail group showing the highest levels of ccf-mtDNA.

Conclusion:

The co-existence of LLD and frailty is associated with increased markers of cellular damage and stress (i.e., ccf-mtDNA). Our results suggest that these conditions may share cellular stress and mitochondrial dysfunction phenomena as a common biological mechanism, offering potential future opportunities for geroscience-guided interventions for these conditions.

Keywords: late-life depression, frailty, circulating cell-free mitochondrial DNA, mitochondria dysfunction, cellular stress, aging

1. INTRODUCTION

Late-life depression (LLD) and frailty often co-exist in older adults and are associated with adverse health outcomes and comorbidity (1,2,3). Despite their clinical relevance and the fact that aging represents a major risk factor for both conditions, little is known about possible shared biological mechanisms. Both conditions have been associated with pro-inflammatory activation, oxidative stress, mitochondrial dysfunction, among others (2,4) which have all been described as biological hallmarks or pillars of aging (5).

Beyond their primary role in energy production, mitochondria also represent the main source of oxidative stress of by-products such as reactive oxygen species (ROS) (6,7). Increased exposure to ROS can lead to mitochondrial DNA (mtDNA) damage and fragmentation. Persistent, unchecked oxidative stress also leads to increased mitochondrial membrane permeability and the leakage of mtDNA into the cytosol and the extracellular space. The mtDNA can be identified in different biofluids, like plasma or serum, as circulating cell-free mtDNA (ccf-mtDNA). The ccf-mtDNA in plasma reflects the amount of mitochondrial genome released during cellular stress, where higher levels of ccf-mtDNA are an indicator of increased cell damage (8).

Despite the emergence of ccf-mtDNA as potential biomarkers of cellular damage, to date no study has evaluated interactions between LLD and frailty in ccf-mtDNA levels. Previous studies in young adults showed higher ccf-mtDNA levels during a major depressive episode (8), but no data has been reported for individuals with both frailty and LLD. Thus, in this exploratory analyses, we aimed to evaluate if MDD and frailty are associated with changes in ccf-mt-DNA levels and their potential synergistic effect on ccf-mtDNA in older adults. We hypothesize that individuals diagnosed with both frailty and LLD will have higher ccf-mtDNA levels than robust individuals with no history of major depression (comparison groups). Individuals with only LLD or frailty will have intermediate levels of ccf-mtDNA compared to LLD and frailty, and comparison groups.

2. Methods

2.1. Human subject recruitment

Fifty-three participants were recruited from January 2019 to December 2019 in the Centre for Addiction and Mental Health (CAMH), Toronto, Canada from an ongoing cohort that aims to evaluate the impact of major depressive disorder (MDD) on aging biology. Participants with MDD were diagnosed according to the Diagnostic and Statistical Manual of Mental Disorders, 5th edition (DSM-V) (n=32). Older adults without a history of major depressive episodes, other psychiatric disorders, or substance abuse were included as a comparison group (n=21). Participants with LLD were not under antidepressant treatment for at least three months before the research assessment and blood draw. Participants included in the LLD and those in the comparison groups were identified by advertisements in different media (LLD and comparison individuals) or referred by psychiatrists or family physicians (LLD individuals).

Frailty was evaluated by the FRAIL questionnaire, which screens for 5 components related to frailty: fatigue, resistance, ambulation, medical comorbidity, and weight loss (9, 10). The FRAIL questionnaire was previously validated as a screening measure for frailty and showed a significant correlation with IADL difficulties, reduced grip strength and balance, and lower physical capacity. Each item is scored as 0 (absent) or 1 (present) and based on the total score (maximum of 5), it classifies individuals into 3 groups (Robust, score = 0; Pre-Frail, score=1 or 2; and Frail, score ≥). Based on the FRAIL scale scores, this sample comprised of Robust (n=25), Pre-Frail (n=27), Frail (n=1). Since pre-frailty is a high-risk condition for future development of frailty and carries similar risk factors and long-term negative outcomes as frailty, the Pre-Frail and Frail participants were classified into the same group (Pre-Frail/Frail) (11,12) The final group classification were: Never Depressed+Robust (reference group, n=16), LLD+Robust (n=9), Never Depressed+Pre-frail/Frail (n=5), LLD+Pre-frail/Frail (n=23).

The severity of depressive symptoms was evaluated using the Montgomery-Asberg Depression Rating Scale (MADRS) (13). Cognitive performance was evaluated by the Montreal Cognitive Assessment (MOCA) test (14) and the Repeatable Battery for Assessment of Neuropsychological Status (RBANS) (15). The local ethics board approved this study. All participants provided written informed consent for participation in this study.

2.2. Plasma sample collection.

Peripheral blood was collected by venipuncture in EDTA tubes and processed within 3 hours of collection. Plasma was obtained from the blood by centrifugation at 3000g for 10 min at 4°C. Plasma was separated, aliquoted, and stored at −80°C until laboratory analysis.

2.3. DNA extraction and ccf-mtDNA quantification in plasma

We centrifuged thawed plasma at 10000g for 10 min to remove cells and cellular debris. The QIAmp 96 DNA Blood kit (Qiagen, Valence, USA) was used to extract DNA from 200μL of the plasma, according to manufacturer protocol for blood and body fluids. Total DNA was then eluted in 50μL of elution buffer and quantified using spectrophotometric analysis at 260/280 nm in NanoPhotometer ® P-Class (Implen, Westlake Village, CA, US).

Quantitative analysis of ccf-mtDNA was performed using a real-time polymerase chain reaction (rtPCR) as previously described (9,16). We performed serial dilution of the purified PCR product from a control individual to create standard curves in triplicate. We added the plasma DNA sample used to create the standard curve for all of the rtPCR plates to evaluate the coefficient of variance between plates. The crossing-point values from the testing samples were compared with the standard curve to reveal the DNA concentration. The number of mtDNA units per sample was calculated using the formula: amount of DNA (g μl−1) divided with the size of the PCR-fragment (161 bp) and the molar mass per base pair (g mol−1). The product was multiplied with Avogadro’s constant. The ccf-mtDNA was measured as units per microliter (units/μL).

We amplified the MT-ND2 (mitochondrial encoded NADH: Ubiquinone Oxidoreductase Core Subunit 2) gene using the following primers: forward (CACACTCATCACAGCGCTAA), and reverse (GGATTATGGATGCGGTTGCT) (Life Technology, Paisley, UK).

The PCR reaction was performed using SYBR Green Technology (Thermo Fisher Scientific, Waltham, MA, USA). Each 20μL reaction contained 5μL of template, 1μL of each primer (10μM), 10μL SYBR MIX (2x Sensifast, Bioline, London, UK), and 3μL of nuclease-free water. Each reaction was run in triplicate on CFX96 Touch Real-Time PCR Detection System (Bio-rad, Hercules, California, USA). PCR program: initial denaturation at 95°C for 10 min, followed by 45 cycles consisting of 95°C in 10 sec (melting), 65°C for 10 sec (annealing), and 72°C for 10sec (extension). The program ended with a melting curve analysis measuring fluorescence continuously from 60 to 97°C.

2.4. Statistical analysis

Before statistical analysis, we evaluated the pattern of data distribution and log-transformed all data that followed a non-normal distribution. We performed a chi-square analysis to evaluate for differences in the distribution of dichotomous variables between diagnostic groups. We carried out t-test or analysis of variance (ANOVA) to evaluate statistically significant differences between diagnostic groups, and their interaction, on ccf-mtDNA concentration, demographic, and clinical variables. Pairwise contrast analyses with Dunnett’s test were done to compare the ccf-mtDNA among groups. We also examined Pearson correlations to evaluate the association between ccf-mtDNA, demographic and clinical variables. The statistical analyses were done with the STATA software v16 (College Station, TX).

3. Results

The groups were comparable in most demographic and clinical variables, but the subjects in the LLD+Pre-Frail/Frail group had the highest scores on the MADRS and FRAIL scale, as expected (table 1). Correlation analysis showed a significant correlation between ccf-mtDNA with MADRS scores (r=0.42, p=0.002, n=53) and FRAIL scale scores (r=0.31, p=0.02, n=53). There were no statistically significant correlations between ccf-mtDNA and age (r=−0.02, , n=53), BMI (r=0.01, n=53), years of education (r=0.09, n=53), MOCA (r=−0.11, n=53), RBANS scores (r=−0.05, n=53), or the number of medical comorbidities (r=0.20, n=53) (p-value > 0.1 for all analyses).

Table 1 –

Demographic, clinical and ccf-mtDNA levels according to the study participants’ groups.

Never-Depressed+Robust LLD+Robust Never-Depressed+Pre-frail/Frail LLD+Pre-Frail/Frail Statistics p-value
Age (mean±sd) 69.9 ± 7.6 67.7 ± 6.5 70.6 ± 10.3 68.2 ± 6.9 F(3,49)= 0.34 0.79
Sex Male (N) 8 2 2 7 X2 (3)=2.45 0.51*
Female (N) 8 7 3 16
Years of Education (mean±sd) 15.6 ± 1.3 15.1 ± 2.0 14.6 ± 3.0 14.0 ± 2.6 F(3,49)=1.88 0.14
MADRS (mean±sd) 1.0 ± 1.5 16.1 ± 8.0 1.4 ± 2.2 19.7 ± 6.1 F(3,49)= 47.2 <0.001
MOCA (mean±sd) 26.2 ± 1.9 26.2 ± 2.2 26.6 ± 2.1 25.2 ± 3.4 F(3,49)= 0.74 0.53
RBANS (mean±sd) 101.6 ± 14.8 95.7 ± 8.2 99.6 ± 15.4 97.4 ± 14.3 F(3,49)= 0.45 0.71
Number of medical comorbidities (mean±sd) 0.8 ± 1.2 1.1 ± 1.4 0.4 ± 0.5 1.3 ± 1.1 F(3,49)= 1.1 0.34
ccf-mtDNA (log-scale, (mean±sd))** 8.55 ± 0.14 8.65 ± 0.09 8.64 ± 0.10 8.67 ± 0.11 F(3,49)= 3.1 0.036
Open in a new tab
*

Fisher’s exact test.

**

Contrast analysis (Dunnett’s test): Never-depressed+Robust vs LLD+Pre-Frail/Frail: p= 0.014, Dunnett’s corrected t-test = 2.94, d.f. = 38; Never-depressed+Robust vs. Never-Depressed+Pre-Frail/Frail: p= 0.38, Dunnett’s corrected t-test = 1.38, d.f. = 24 Never-depressed+Robust vs. LLD+Robust: p=0.13, Dunnett’s corrected t-test=1.99, d.f.=20.

MADRS: Montgomery-Asberg Depression Rating Scale. MOCA: Montreal Cognitive Assessment; RBANS: Repeatable Battery for the Assessment of Neuropsychological Status; ccf-mtDNA: circulating cell-free mitochondrial DNA.

We found an independent association of LLD diagnosis (t51=2.68, p=0.009, Cohen d= 0.81 [0.23 – 1.34]) with Pre-Frail/Frail status (t51=2.18, p=0.033, Cohen d= 0.55 [0.01 – 1.10]). We also observed a significant LLD-by-Pre-Frailty/Frailty diagnosis interaction in the ccf-mtDNA levels (F(3,49)=3.07, p=0.036), with individuals in the LLD+Pre-Frail/Frail group having the highest levels of ccf-mtDNA (table 1). The effect size was moderate to large (η2=0.30). Pairwise contrast analysis (Dunnett’s test) showed that the groups LLD+Pre-Frail/Frail had significantly higher ccf-mtDNA levels than Never-depressed+Robust. There were no statistically significant differences between Never-depressed+Robust vs. Never-Depressed+Pre-Frail/Frail and the Never-depressed+Robust vs. LLD+Robust.

Sensitivity analysis by excluding the one participant with Frailty (FRAIL score of 3) did not change the results (F(3,48)=3.04, p=0.037). Finally, given the small sample size, especially in the groups LLD+Robust and Never-Depressed+Pre-frail/Frail, we carried out a Kruskal-Wallis equality-of-population rank test. The ccf-mtDNA levels were also significantly differences among groups (χ23=8.7, p=0.033).

4. Discussion

In this study, we aimed to evaluate the impact of LLD and frailty status on ccf-mtDNA, a marker of cellular damage and stress. We observed that individuals with both LLD and evidence of being pre-frail or frail had the highest ccf-mtDNA levels and that this parameter was significantly associated with the severity of depressive symptoms and frailty scores. To the best of our knowledge, this is the first study to evaluate the levels of ccf-mtDNA in LLD and frailty and to demonstrate the comorbidity between LLD and pre-frail/frail status has the most significant impact on ccf-mtDNA in this population.

Despite the growing evidence of LLD and frailty’s association, few studies have addressed the possible underlying biological mechanisms. Arts et al. (18) showed no differences in leukocyte telomere length according to frailty status among individuals with LLD. More recently, Brown and colleagues (19) also did not find a significant association between cerebrovascular burden and frailty measures in LLD. In another study using data from the NESDO cohort, Arts et al. (20) did not find a significant effect of frailty and depression on inflammatory markers (i.e., CRP, IL-6, and NGAL). However, after decomposing the physical frailty index in 2 dimensions, based on principal component analysis, they found a significant association between performance-based physical frailty (encompassing gait speed, handgrip strength, and low physical activity), LLD, and elevated CRP levels. Our study, thus, is the first to report that the co-existence of pre-frailty/frailty and LLD is associated with worse biological parameters.

The current results should be viewed in light of the study limitation. First, we included a small sample size, with most individuals in the pre-frail/frail group identified as pre-frail status. The identification of pre-frail and frailty status was based on a self-report screening scale, and there was no direct assessment of the frailty parameters in this sample. These limitations can impact the generalizability of the results. Therefore, our results need to be replicated in larger samples, preferentially with longitudinal design to assess the trajectory of ccf-mtDNA in this population. Nevertheless, if replicated, these findings would indicate the existence of several shared biological underpinnings pertaining to aging for both conditions which could justify and help guide the development of future geroscience-guided clinical trials targeting individuals with this type of comorbidity.

In conclusion, our study provides preliminary evidence that the co-existence of LLD and frailty is associated with a evidence of increased biological markers related to cell stress and damage (i.e., ccf-mtDNA). If confirmed in future studies, the evaluation of ccf-mtDNA can be as a biomarker (21) for interventions designed to mitigate cellular stress and that could be helpful in improving both mood and frailty-related outcomes in vulnerable older adults.

Highlights.

1) What is the primary question addressed by this study? We evaluated the synergistic effect of late-life depression and frailty on circulating cell-free mitochondrial DNA (ccf-mtDNA), a marker of cellular stress and damage.

2) What is the main finding of this study? We found that the ccf-mtDNA was significantly elevated in individuals identified as LLD and pre-frail/frail compared to never-depressed, robust individuals.

3) What is the meaning of the finding? Our findings indicate the existence of shared biological abnormalities pertaining to aging, between LLD and frailty, which could justify and help guide the development of future geroscience-guided clinical trials targeting individuals with this comorbidity.

Acknowledgments:

This work was supported by grants from the National Institute of Mental Health (R01MH115953) and intramural grant support from the CAMH, Toronto, ON, Canada. GAK is supported by the Travelers Chair in Geriatrics and Gerontology. All authors do not report any conflict of interest related to this manuscript. The sources of support did not have any role in the study design, analysis, draft of the manuscript, or the decision to submit for publication.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Statement of conflict of interest

All authors do not report any conflict of interest related to this manuscript.

Presentation:

The results presented in this manuscript were presented, in part, during the Annual Meeting of the American Association for Geriatric Psychiatry, 2021.

REFERENCES

  • 1.Brown PJ, Roose SP, O’Boyle KR, et al. : Frailty and Its Correlates in Adults With Late Life Depression. Am J Geriatr Psychiatry 2019; 14:145–154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Brown PJ, Rutherford BR, Yaffe K, et al. : The Depressed Frail Phenotype: The Clinical Manifestation of Increased Biological Aging. Am J Geriatr Psychiatry 2016; 24:1084–1094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Arts MHL, van den Berg KS, Marijnissen RM, et al. : Frailty as a Predictor of Mortality in Late-Life Depression: A Prospective Clinical Cohort Study. J Clin Psychiatry 2021; 82:20m13277. [DOI] [PubMed] [Google Scholar]
  • 4.Diniz BS, Lin C, Sibille E, et al. : Circulating biosignatures of late-life depression (LLD): Towards a comprehensive, data-driven approach to understanding LLD pathophysiology. J Psychiatr Res 2016; 82:1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.López-Otín C, Blasco MA, Partridge L, et al. : The hallmarks of aging. Cell 2013; 153:1194–217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Pizzino G, Irrera N, Cucinotta M, et al. : Oxidative Stress: Harms and Benefits for Human Health. Oxid Med Cell Longev. 2017; 2017:8416763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Nilsson MI, Tarnopolsky MA. Mitochondria and aging—the role of exercise as a countermeasure. Biology (Basel). 2019;8(2):40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gambardella S, Limanaqi F, Ferese R, et al. : CCF-mtDNA as a potential link between the brain and immune system in neuroimmunological disorders. Front Immunol. 2019; 10:1064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Lindqvist D, Wolkowitz OM, Picard M, et al. : Circulating cell-free mitochondrial DNA, but not leukocyte mitochondrial DNA copy number, is elevated in major depressive disorder. Neuropsychopharmacology. 2018;43:1557–1564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Abellan van Kan G, Rolland YM, Morley JE, et al. : Frailty: Toward a Clinical Definition. J Am Med Dir Assoc. 2008; 9:71–72. [DOI] [PubMed] [Google Scholar]
  • 11.Xue QL. The frailty syndrome: definition and natural history. Clin Geriatr Med. 2011; 27(1):1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hanlon P, Nicholl BI, Jani BD, Lee D, McQueenie R, Mair FS. Frailty and pre-frailty in middle-aged and older adults and its association with multimorbidity and mortality: a prospective analysis of 493 737 UK Biobank participants. Lancet Public Health. 2018; 3(7):e323–e332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Montgomery SA, Asberg M. A new depression scale designed to be sensitive to change. Br J Psychiatry. 1979. Apr;134:382–9. [DOI] [PubMed] [Google Scholar]
  • 14.Nasreddine ZS, Phillips NA, Bédirian V, Charbonneau S, Whitehead V, Collin I, Cummings JL, Chertkow H. The Montreal Cognitive Assessment, MoCA: a brief screening tool for mild cognitive impairment. J Am Geriatr Soc. 2005;53(4):695–9. [DOI] [PubMed] [Google Scholar]
  • 15.Randolph C, Tierney MC, Mohr E, Chase TN. The Repeatable Battery for the Assessment of Neuropsychological Status (RBANS): preliminary clinical validity. J Clin Exp Neuropsychol. 1998;20(3):310–9. [DOI] [PubMed] [Google Scholar]
  • 16.Gonçalves VF, Mendes-Silva AP, Koyama E, Vieira E, Kennedy JL, Diniz B. Increased levels of circulating cell-free mtDNA in plasma of late life depression subjects. J Psychiatr Res. 2021; 139:25–29 [DOI] [PubMed] [Google Scholar]
  • 17.Morley JE, Malmstrom TK, Miller DK. A simple frailty questionnaire (FRAIL) predicts outcomes in middle aged African Americans. J Nutr Health Aging. 2012; 16:601–608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Arts MHL, Collard RM, Comijs HC, de Jonge L, Penninx BWJH, Naarding P, Kok RM, Oude Voshaar RC. Leucocyte telomere length is no molecular marker of physical frailty in late-life depression. Exp Gerontol. 2018; 111:229–234. [DOI] [PubMed] [Google Scholar]
  • 19.Brown PJ, Brennan N, Ciarleglio A, Chen C, Garcia CM, Gomez S, Roose SP, Rutherford BR, Simonsick EM, Spencer RG, Ferrucci L. Declining Skeletal Muscle Mitochondrial Function Associated With Increased Risk of Depression in Later Life. Am J Geriatr Psychiatry. 2019. Sep;27(9):963–971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Arts MH, Collard RM, Comijs HC, Naudé PJ, Risselada R, Naarding P, Oude Voshaar RC. Relationship Between Physical Frailty and Low-Grade Inflammation in Late-Life Depression. J Am Geriatr Soc. 2015; 63:1652–1657. [DOI] [PubMed] [Google Scholar]
  • 21.Pene F, Courtine E, Cariou A, Mira JP. Toward theragnostics. Crit Care Med. 2009; 37(1 Suppl):S50–8. [DOI] [PubMed] [Google Scholar]

RESOURCES