Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2001 May;39(5):1738–1745. doi: 10.1128/JCM.39.5.1738-1745.2001

Characterization of AfaE Adhesins Produced by Extraintestinal and Intestinal Human Escherichia coli Isolates: PCR Assays for Detection of Afa Adhesins That Do or Do Not Recognize Dr Blood Group Antigens

Chantal Le Bouguénec 1,*, Lila Lalioui 1, Laurence du Merle 1, Mabel Jouve 1,2, Pascale Courcoux 1, Saeid Bouzari 1,†, Rangaraj Selvarangan 3, Bogdan J Nowicki 3, Yves Germani 4, Antoine Andremont 5, Pierre Gounon 2, Marie-Isabelle Garcia 1,‡
PMCID: PMC88018  PMID: 11325983

Abstract

Operons of the afa family are expressed by pathogenic Escherichia coli strains associated with intestinal and extraintestinal infections in humans and animals. The recently demonstrated heterogeneity of these operons (L. Lalioui, M. Jouve, P. Gounon, and C. Le Bouguénec, Infect. Immun. 67:5048–5059, 1999) was used to develop a new PCR assay for detecting all the operons of the afa family with a single genetic tool. This PCR approach was validated by investigating three collections of human E. coli isolates originating from the stools of infants with diarrhea (88 strains), the urine of patients with pyelonephritis (97 strains), and the blood of cancer patients (115 strains). The results obtained with this single test and those previously obtained with several PCR assays were closely correlated. The AfaE adhesins encoded by the afa operons are variable, particularly with respect to the primary sequence encoded by the afaE gene. The receptor binding specificities have not been determined for all of these adhesins; some recognize the Dr blood group antigen (Afa/Dr+ adhesins) on the human decay-accelerating factor (DAF) as a receptor, and others (Afa/Dr− adhesins) do not. Thus, the afa operons detected in this study were characterized by subtyping the afaE gene using specific PCRs. In addition, the DAF-binding capacities of as-yet-uncharacterized AfaE adhesins were tested by various cellular approaches. The afaE8 subtype (Afa/Dr− adhesin) was found to predominate in afa-positive isolates from sepsis patients (75%); it was frequent in afa-positive pyelonephritis E. coli (55.5%) and absent from diarrhea-associated strains. In contrast, Afa/Dr+ strains (regardless of the afaE subtype) were associated with both diarrhea (100%) and extraintestinal infections (44 and 25% in afa-positive pyelonephritis and sepsis strains, respectively). These data suggest that there is an association between the subtype of AfaE adhesin and the physiological site of the infection caused by afa-positive strains.


Pathogenic Escherichia coli cells, which cause intestinal and extraintestinal infections in humans, generally adhere to mucosal epithelia early in the colonization of host tissues (14). These bacteria produce a wide variety of adhesive proteins and organelles. Adhesins are often assembled into hairlike fibers called fimbriae (or pili) and are classified based on their adhesive properties. Type 1 adhesins that bind to mannose-containing host cell receptors (adhesins mediating mannose-sensitive hemagglutination [MSHA]) are produced by a wide variety of pathogenic and nonpathogenic E. coli strains yet have been implicated only in the pathogenicity of uropathogenic E. coli (41). There are many adhesins that mediate mannose-resistant hemagglutination (MRHA). They are produced by a large number of pathogenic E. coli isolates associated with different intestinal and extraintestinal infections. Some MRHA adhesins do not form fimbriae: among these are the AFA afimbrial adhesive sheaths (AFAs) that are encoded by the afa gene clusters. Several studies have strongly suggested that afa-positive strains play an important role in urinary tract infection (UTI) pathogenesis (1, 2, 6, 9, 32). Such strains are especially common in pregnant woman (44), children (2), and patients with recurring UTIs (10). Furthermore, using an experimental model of mouse chronic pyelonephritis, Goluszko et al. (20) demonstrated that an isogenic mutant that did not produce the Dr adhesin (encoded by the afa-related dra operon) was less virulent in terms of causing persistent UTI than the parental wild-type strain (20). An unusual feature of the afa-positive strains is their additional association with intestinal infections in children (17, 19, 37, 38). These diarrhea-associated isolates are E. coli organisms of the diffusely adherent pathotype (DAEC) (26, 35).

The first set of afa gene clusters to be described originated from human uropathogenic and diarrhea-associated strains. It contained very similar operons that could be detected by a PCR assay based on the sequence of the afaB and afaC genes from the afa-3 operon (36). This assay also detected the dra (45) and daa (5) operons from the same family of gene clusters. Unlike the other afa genes, afaE, the structural-adhesin-encoding gene, was found to be highly heterogeneous, producing antigenically different adhesins (30). Of the various AfaE subtypes, the AfaE-I, AfaE-III, Dr, and F1845 adhesins, encoded by the afa-1, afa-3, dra, and daa operons, respectively, have been extensively studied (3, 4, 8, 12, 13, 21, 22, 28, 31, 32, 37, 39). They mediate MRHA of human erythrocytes expressing the Dr blood group antigen on the decay-accelerating factor (DAF, or CD55) (43). These so-called Afa/Dr+ adhesins also mediate diffuse adhesion of the bacteria to human epithelial cells by recognizing the short consensus repeat-3 (SCR-3) domain of the DAF molecule as a receptor (42). The relative distribution of each of these Afa/Dr+ adhesin subtypes in a large collection of strains from patients with UTI showed that afaE3 and afaE1 are frequently expressed (47). Their distribution among afa-positive diarrheagenic strains is unknown. Interestingly, the same afaE1-positive strain has been implicated as the causative agent of consecutive diarrhea and cystitis in an individual child (16).

We recently reported the cloning and characterization of the afa-7 and afa-8 gene clusters from bovine isolates (33). Although these two operons have a genetic organization very similar to that of the afa gene clusters from human isolates, strains carrying them test negative for afa sequences by PCR. The AfaE-VII and AfaE-VIII adhesins do not bind to human DAF (Afa/Dr− adhesins) (33). Preliminary epidemiological results showed a high prevalence of afa-8 genes in E. coli isolates from animals with extraintestinal infections and indicated that afa-8 sequences were present in human extraintestinal clinical isolates (15, 33). From these data, it appears that the afa operons are widely distributed among pathogenic E. coli. However, they encode a large variety of AfaE adhesins, the distributions and the receptors of which have not always been identified.

This study has been initiated to increase our knowledge of the various AfaE adhesins and to better understand their role in the pathogenicity of extraintestinal and intestinal E. coli isolates. The first goal was to develop a new PCR assay (using the afa-f and afa-r primers) for the detection of all the members of the afa family of gene clusters, including the afa-7 and afa-8 operons. We then used this assay to collect a large number of afa-positive strains associated with different pathologies. The main objective was to compare the adhesins produced by intestinal and extraintestinal isolates. We identified the subtypes of the AfaE adhesins by PCR and showed that afaE8 is the most prevalent adhesin subtype in human pyelonephritis and blood isolates. We then studied the receptor specificities of some as-yet-uncharacterized AfaE adhesins. These studies confirmed that Afa/Dr+ adhesins are produced by both extraintestinal and intestinal pathogenic human isolates, whereas Afa/Dr− adhesins are produced only by extraintestinal pathogenic strains. Based on our results, we have a PCR assay for the detection of both Afa/Dr+ and Afa/Dr− adhesins and a PCR assay for the detection of Afa/Dr+ adhesins only.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions.

Three collections of human pathogenic E. coli, previously partially characterized, were used in this study. Ninety-seven E. coli strains were isolated from urine specimens from patients (children and adults) clinically diagnosed with pyelonephritis (1). Eighty-eight E. coli strains were isolated from stool specimens from children with diarrhea (18). These strains did not produce heat-stable or heat-labile enterotoxins or Shiga-like toxins and were noninvasive. All adhered to HEp-2 and HeLa cell monolayers. One hundred fifteen strains of E. coli were isolated from blood cultures from cancer patients (25). Additional afa-positive strains were also used: seven human E. coli isolates, including strains KS52 and A30, from which the afa-1 and afa-3 operons have been cloned, respectively (30, 37), and the diarrhea-associated isolate C1845 (5), kindly provided by S. Moseley (University of Washington, Seattle). Twenty-two isolates from calves (19 strains) and piglets (3 strains) with intestinal and extraintestinal disorders were also studied. These isolates were previously reported to carry either the afa-7 (bovine strain 262 KH 89) or the afa-8 (21 strains, including the bovine strain 239 KH 89) gene clusters (33).

E. coli K-12 strain HB101 (7) was used as a negative control in PCR studies and as a host for genetic experiments. pILL570 (29) was used for cloning experiments. pILL1101 and pILL1191 are recombinant plasmids carrying the afa-3 gene cluster from strain A30 and the afa-7 operon from strain 262 KH 89, respectively (13, 33). Culture conditions were as previously described (37).

Molecular biology techniques.

Restriction endonuclease digestion and other common DNA manipulations were performed according to standard procedures (40). PCR assays were performed as previously described (36) using the sets of primers listed in Table 1. Amplification was carried out over 25 cycles of 94°C for 1 min, 65°C for 1 min, and 72°C for 2 min in a thermal cycler (Perkin-Elmer Cetus).

TABLE 1.

Primers used for PCR assays

Region specific for Primer name Sequence (5′-3′) Sequence deduced from (GenBank accession no. or reference): Size of product (bp)
afaBC afa1 GCTGGGCAGCAAACTGATAACTCTC afa-1 operon (36) 750
afa2 CATCAAGCTGTTTGTTCGTCCGCCG
afaC afa-f CGGCTTTTCTGCTGAACTGGCAGGC afa-3, afa-7, afa-8 operons  (X76688, AF72901, AF72900) 672
afa-r CCGTCAGCCCCCACGGCAGACC
afaE1 afaE-fa TTAGACCGTACTGTTGTGTTACCCCC afaE1 gene (X69197) 394
afaE1-r CATCGCCCGTCGCAGAGCCCAT
afaE2 afaE-fa TTAGACCGTACTGTTGTGTTACCCCC afaE2 gene (X85782) 375
afaE2-r GTTTCCCAGTAGACTGGAATGAAGC
afaE3b afaE-fa TTAGACCGTACTGTTGTGTTACCCCC afaE3 gene (X69102) 349
afaE3-r CCCTATTGTTGTCGCTGATCAGGAAG
afaE5 afaE5-f TCAACTCACCCAGTAGCCCCAG afaE5 gene (X91748) 405
afaE5-r AGGAAGTGGTAGCACCGGTACG
afaE7 afaE7-f GCTAAATCAACTGTTGATGTT afaE7 gene (AF72901) 618
afaE7-r GGACAATCCAAATGGCGAATTA
afaE8 afaE8-f CTAACTTGCCATGCTGTGACAGTA afaE8 gene (AF72900) 302
afaE8-r TTATCCCCTGCGTAGTTGTGAATC
daaE afaE-fa TTAGACCGTACTGTTGTGTTACCCCC daaE gene (5) 338
daaE-r CGGCTAGTCATATATAGATTTGTCGC
a

The afaE-f primer was based on a region upstream from the afaE gene (37) that is conserved in several afa gene clusters. 

b

afaE3 PCR also detects the Dr adhesin-encoding gene (draA, recently renamed draE [8]), which is 99.4% identical to afaE3 (37). 

The afa-5 gene cluster was isolated from E. coli AL851, one of the clinical strains associated with diarrhea previously reported to carry an afa gene cluster (37). Fragments (6 to 13 kb in size) of plasmid DNA partially digested with Sau3A were ligated to pILL570 linearized with BamHI. Two clones hybridizing with the afa1-afa2 amplification product were selected; one carried the recombinant plasmid pILL1147, which confers HeLa cell adhesion activity, and the other carried pILL1114, which does not confer adhesion (absence of the afaE gene). In electron microscopy of negatively stained preparations of the wild-type (AL851) and recombinant [HB101(pILL1147)] strains, we observed no fimbrial structures on the bacterial surface, suggesting that the AfaE-V adhesin is afimbrial. The afa-2 gene cluster from E. coli A22 was cloned by inserting a 11.2-kb Sau3A fragment from the recombinant cosmid pILL73 (30) into pILL570. The resulting recombinant plasmid was called pILL1019. The nucleotide sequence accession numbers for afaE2 and afaE5 are X85782 and X91748, respectively.

Hemagglutination and adhesion assays.

Adhesion to HeLa cells and the hemagglutination of washed human erythrocytes in the presence of 2% (wt/vol) α-methyl mannoside were assessed as described elsewhere (1, 28). CHO cell-binding assays were performed as previously described (42). For hemagglutination and adhesion assays, human erythrocytes and CHO cells were preincubated with monoclonal antibodies (MAbs) directed against various domains of the human DAF.

Antibodies.

The DAF-specific MAbs 1H4 and 8D11 (directed against the SCR-3 and SCR-4 domains, respectively), were kindly provided by D. M. Lublin (Washington University, St. Louis, Mo.), and BRIC110 (directed against SCR-2) and BRIC230 (directed against SCR-1) were purchased from the International Blood Group Reference Laboratory (Bristol, United Kingdom).

Immunofluorescence.

HeLa cells on glass coverslips were infected by incubation with afa-expressing strains for 3 h. Briefly, the cells were fixed in 4% (wt/vol) paraformaldehyde (Merck, Darmstadt, Germany) in 0.1 M phosphate buffer (pH 7.4) for 15 min, incubated in 50 mM NH4Cl in phosphate-buffered saline (PBS) for 30 min, and then permeabilized by adding 0.1% saponin (Sigma-Aldrich Chimie, St. Quentin-Fallavier, France) in PBS containing 0.2% bovine serum albumin (BSA; Sigma-Aldrich Chimie) and incubating them for 15 min. DAF molecules were detected by incubating the cells for 30 min at room temperature with BRIC230 and then with a fluorescein-conjugated secondary antibody. Coverslips were mounted in mowiol and examined under an Olympus microscope (model BH-2).

Microscopy.

Interacting bacteria and erythrocytes were fixed by incubation in 1.6% buffered (0.1 M phosphate buffer, pH 7.4) glutaraldehyde for 1 h, postfixed for 2 h with 2% buffered osmium tetroxide, and embedded in 4% agarose type VII at 37°C. The agar was solidified on ice, and the embedded specimens were cut into 1-mm3 blocks, which were dehydrated in a graded series of ethanol solutions, treated with epoxy-1,2-propane, and then embedded in epoxy resin. Semithin sections (0.5 mm thick) were cut with a diamond knife, placed on glass slides, and examined in phase contrast with a Leica microscope. Bacterial suspensions were examined by electron microscopy for fimbrialike structures as previously described (37). For immunocytochemistry, the infected monolayers were treated as previously described (23). Briefly, cells were fixed in situ with 4% formaldehyde (freshly made from paraformaldehyde) and 0.2% glutaraldehyde in 0.1 M phosphate buffer (pH 7.4), scraped off the slides with a rubber policeman, and embedded in 10% gelatin. Small blocks were infused with 1.7 M sucrose–15% (wt/vol) polyvinylpyrrolidone (average molecular weight, 10,000) for at least 2 h, frozen in liquid nitrogen, and cut at −120°C with a cryostat; the sections were transferred to Formvar-coated nickel grids. The grids were floated on droplets of the following solutions in succession: 50 mM NH4Cl in PBS; 1% BSA–1% normal goat serum in PBS; anti-DAF antibodies (IA10) in 1% BSA–1% normal goat serum in PBS; three times on 0.1% BSA in PBS; IgG (H+L) anti-mouse immunoglobulin–gold conjugate; and 0.01% gelatin in PBS. The grids were washed with PBS, fixed with 1% glutaraldehyde in PBS, washed again with water, and then incubated with 1% methyl cellulose–0.3% uranyl acetate, air dried, and examined with a Jeol 1010 electron microscope at 80 kV.

RESULTS

Selection of oligonucleotides for the detection of afa-related sequences in pathogenic E. coli.

The first set of primers, afa1 and afa2, used to detect afa sequences was based on the partial sequence of the afa-1 gene cluster (36). These oligonucleotides flanked a 750-bp DNA segment overlapping the afaB and afaC genes (Table 1). Comparison of the nucleotide sequences of the afa-3, afa-7, and afa-8 operons showed that these primers did not detect all the afa-related gene clusters. Thus, based on the alignment of the sequences of the afaC3, afaC7, and afaC8 genes, we selected a new set of primers (afa-f and afa-r) specific for the afa family. These primers flanked a 672-bp DNA segment internal to the afaC genes (Table 1). The specificity of the new afa oligonucleotide pair for afa gene clusters was evaluated by testing representative strains. Strains KS52, A22, A30, AL851, 262 KH 89, and 239 KH 89, from which the afa-1, afa-2, afa-3, afa-5, afa-7, and afa-8 operons, respectively, have been cloned, showed positive amplification (Table 2). An amplification product was also obtained from the diarrhea-associated C1845 strain, which carried the daa operon (Table 2). No amplification product was obtained for the E. coli K-12 strain, HB101, used as a negative control. As for the afa1-afa2 set of primers, the afa-f and afa-r oligonucleotides could be used in the multiplex PCR assay developed to detect in a single step the three common adhesin-encoding operons (pap, sfa, and afa) in uropathogenic E. coli (36). The distribution and sizes of the amplification products were as predicted (data not shown).

TABLE 2.

Distribution of afa operons among representative E. coli strains

Isolate (reference) Cloned operon Origina afa PCR resultb
afaE PCR subtypeb
afa1-afa2 afa-f–afa-r afaE1 afaE2 afaE3 afaE5 daaE afaE7 afaE8
Human
 KS52 (32) afa-1 Pye + + + − − − − − −
 A22c (30) afa-2 Cys + + − + + − − − −
 A30 (30) afa-3 Cys + + − − + − − − −
 AL851 (30) afa-5 D + + − − − + − − −
 C1845 (5) daa D + + − − − − + − −
 A2c (30) Cys + + − + + − − − −
 4006d (30) Cys + + + − − − − − −
 6584d (30) Cys + + + − − − − − −
Animal (34)
 262 KH 89 afa-7 BEI − + − − − − − + −
 239 KH 89 afa-8 BEI − + − − − − − − +
 17 Isolates BEI − + − − − − − − +
 3 Isolates PEI − + − − − − − − +
a

Pye, pyelonephritis; Cys, cystitis; D, diarrhea; BEI, bovine extraintestinal infection; PEI, porcine extraintestinal infection. 

b

+, positive; −, negative. 

c

Strain known to carry two afa gene clusters (30). This strain was identified as producing an adhesin designated AFA-II based on biochemical and antigenic properties (30). 

d

Strain initially identified as producing an adhesin designated AFA-I (30). 

Detection of afa operons in clinical isolates.

Operons of the afa family have been detected in E. coli isolates associated with human extraintestinal and intestinal infections. To validate the new PCR approach for detecting afa-related sequences in clinical isolates, we investigated three collections of E. coli isolates (Table 3). This PCR assay was demonstrated to be sensitive because all the strains that previously gave positive results with the afa1-afa2 pair and all but one of the afa-8-carrying strains tested gave positive results with this test. PCR investigation with the afa-f–afa-r set identified a total of 27 positive pyelonephritis-associated E. coli strains. Only 12 of these strains were positive with the afa1-afa2 pair of primers. Eleven of 115 blood isolates were positive with the afa-f–afa-r set, even though for 8 of these isolates no amplification product was obtained with the afa1-afa2 pair. Twenty-eight of the 88 diarrheal isolates, positive with afa1-afa2 primers, tested positive with the afa-f–afa-r pair. These results confirmed that afa operons are present in E. coli strains associated with various diseases and indicated that the new PCR assay is more sensitive than the original assay for the detection of afa-expressing strains. This assay shows that the frequency of afa-positive strains among pyelonephritis and blood isolates is much higher than predicted with the afa1-afa2 set: 28 instead of 12.4 and 9.6 instead of 2.6%, respectively. The frequencies of afa-positive strains among diarrheal strains are similar (32%) whatever the set of primers.

TABLE 3.

Distribution of afa operons among human clinical isolates

PCR assay No. of positive isolates (total no. of isolates)
Pyelonephritis (97) Sepsis (115) Diarrhea (88)
afa
 afa1-afa2 12a 3a 28a
 afa-f–afa-r 27b 11b 28
afaE subtype
 afaE1 2 3 5
 afaE2 0 0 2
 afaE3 0 0 6
 afaE5 0 0 5
 daaE 1 0 1
 afaE7 0 0 0
 afaE8 15 9c 0
 afaE1 + afaE5 1 0 1
 afaEX 8 0 8
a

All strains were positive in the afa-f–afa-r PCR. 

b

Strains negative in the afa1-afa2 PCR were all positive for afaE8. 

c

One strain was negative in afa-f–afa-r PCR. 

Distribution of afaE subtypes in pathogenic E. coli isolates.

The various afa operons carried by human and animal pathogenic E. coli were characterized by subtyping the afaE gene, using a PCR approach, as previously reported (47). Seven pairs of primers, each specific for an afaE subtype, were defined (Table 1). The specificity of each set of primers was evaluated by testing representative strains (Table 2): (i) the strains from which the afa-1, afa-2, afa-3, afa-5, afa-7, afa-8, and daa operons were cloned and (ii) strains reported to produce adhesins previously designated AFA-I and AFA-II on the basis of their biochemical and antigenic properties (30).

The screening of human and animal isolates for the afaE subtype indicated that the frequencies of the various afaE subtypes differed depending on the pathotype of the isolate (Tables 2 and 3). The afaE7 gene was extremely rare; the only afaE-7-positive strain was that from which the afa-7 gene cluster was cloned. The afaE8 subtype predominated in both animal (95.4%) and human (75% in blood isolates and 55.6% in pyelonephritis strains) extraintestinal isolates. The afaE8 subtype was not detected in any human diarrheal isolate. None of the animal and human afa-8-positive isolates tested positive with the afa1-afa2 set or with any of the other afaE subtype sets. We identified afaE1-, afaE2-, afaE3-, afaE5-, and daaE-carrying strains only among human extraintestinal and intestinal isolates that tested positive in the afa1-afa2 PCR assay. The afaE1 subtype was frequent, especially in extraintestinal strains (25%). In human diarrheal isolates, the afaE1, afaE3, and afaE5 subtypes were similarly represented (21.4%). Despite positive detection with both the afa-f–afa-r and afa1-afa2 sets, about 29% of human pyelonephritis (8 of 27) and diarrheal (8 of 28) isolates were not typable using the various afaE subtype PCR assays. The afaE subtype of these strains was designated afaEX.

Receptor specificities of AfaE adhesins.

Four afaE subtypes (afaE1, afaE3, draE, and daaE) expressed by strains positive in afa1-afa2 PCR encoded adhesins binding the SCR-3 domain of human DAF (42). In contrast, adhesins produced by afa1-afa2 PCR-negative strains, such as AfaE-VII and AfaE-VIII, did not recognize human DAF molecules as receptors (33). We investigated whether other AfaE subtypes (AfaE-II, AfaE-V, and AfaE-X) produced by strains positive in the afa1-afa2 PCR recognized DAF as a receptor.

(i) Binding specificity of AfaE-V.

Strains producing AfaE-V have an MRHA-negative phenotype. As an initial approach for evaluating the receptor specificity of AfaE-V, we compared the interactions with human erythrocytes of MRHA-positive strains producing AfaE-I and AfaE-III and that of an MRHA-negative AfaE-V-producing strain by light microscopy (Fig. 1). AfaE-I- and AfaE-III-producing strains adhered to erythrocytes, causing extensive agglutination (Fig. 1A and B). The AfaE-V-producing strain also bound to erythrocytes, suggesting that the cell receptor for the AfaE-V adhesin was present on erythrocyte membranes (Fig. 1C). However, this strain caused a lower level of erythrocyte aggregation.

FIG. 1.

FIG. 1

Light micrographs of semithin sections of human erythrocytes interacting with strains KS52 (A), A30 (B), and AL851 (C). Note that the aggregates resulting from the cross-linking of erythrocytes (arrowheads) with bacteria (arrows) producing AfaE-I (A) and AfaE-III (B) are larger than those with AfaE-V-producing bacteria (C).

We determined the receptor specificity of the AfaE-V adhesin by using CHO cells transfected with the cDNA for human DAF (Table 4). No binding of AfaE-V-producing HB101(pILL1147) to untransfected CHO cells was observed. Moreover, HB101(pILL1147) adhered significantly more strongly to transfected CHO cells than did HB101(pILL1114), which did not produce AfaE-V. The specific inhibition of this binding by SCR-3 MAb clearly indicated that AfaE-V recognized the SCR-3 domain of DAF as a receptor.

TABLE 4.

Binding properties of AfaE-V adhesin

Strain Presence of the afaE5 genea Binding to CHO cellsb
Untransfected DAF cDNA transfected Pretreated with anti-SCR-3 MAb Pretreated with anti-SCR-2 MAb
HB101(pILL1147) + 1.02 ± 0.2 14.3 ± 0.8 1.82 ± 0.17 14.2 ± 1.09
HB101(pILL1114) − 1.52 ± 0.48 1.47 ± 0.12 NTc NT
a

+, present; −, absent. 

b

Each experiment was performed three times, and the binding values are expressed as the mean number of bacteria per CHO cell ± standard deviation. 

c

NT, not tested. 

(ii) Binding specificity of AfaE-II and AfaE-X adhesins.

Inhibition of hemagglutination was used to test the specificity of the receptor for the AfaE-II and AfaE-X adhesins produced by HB101(pILL1019), three afaE2-expressing isolates, and five isolates carrying an afaEX gene. In all cases, MRHA was affected by the prior treatment of erythrocytes with SCR-3 MAb (Fig. 2). The other afaEX-expressing strains could not be tested due to the lack of MRHA phenotype or P adhesin production. Thus, the SCR-3 domain appears to be essential for AfaE-II and some AfaE-X attachment.

FIG. 2.

FIG. 2

Hemagglutination of erythrocytes by the AL657 strain producing an AfaE-X adhesin without (A) and with (B) prior treatment of erythrocytes with SCR-3 MAb. Bar, 0.5 μm.

Ultrastructural analyses by transmission electron microscopy of HeLa cells infected with AfaE-III- and AfaE-V-producing HB101 strains showed a dense accumulation of DAF molecules beneath adherent bacteria and in the microvillar extensions surrounding the bacteria (Fig. 3). Immunofluorescence studies showed that DAF also aggregated on HeLa cells infected with HB101 strains expressing the afa-1, afa-2, and daa operons or the 16 human isolates producing uncharacterized AfaE-X adhesins (Fig. 4). No such aggregation was observed on HeLa cells infected with HB101(pILL1191), which produces the AfaE-VII adhesin that does not recognize human DAF as a receptor (data not shown).

FIG. 3.

FIG. 3

Electron micrographs of immunogold staining of uninfected HeLa cells (A) and HeLa cells incubated with HB101(pILL1147) bacteria producing AfaE-V (B). DAF molecules were detected by incubation with anti-DAF antibodies followed by anti-mouse immunoglobulin G antibodies conjugated to 10-nm-diameter gold particles. Bar, 0.5 μm.

FIG. 4.

FIG. 4

Immunofluorescence micrographs of uninfected HeLa cells (A) and HeLa cells incubated with HB101(pILL1101) (B), HB101(pILL1019) (C), or the clinical isolate 1548 (D) producing the AfaE-III, AfaE-II, and AfaEX adhesins, respectively. DAF molecules were detected by incubation with anti-DAF antibodies followed by fluorescein-conjugated secondary antibodies. Bar, 1 μm.

DISCUSSION

The AFA adhesive sheath, encoded by the afa operons, is reported to be a virulence factor in E. coli strains that cause intestinal infections and UTIs in humans. Our recent description of new members of the afa family of gene clusters, afa-7 and afa-8, two operons from E. coli strains pathogenic in calves (33), strongly suggested that the prevalence and significance of these virulence factors has been underestimated. In this study, we developed a PCR approach, using a single set of primers designed such that the sequence of each of the members of the afa family of operons would be amplified, and validated it by testing clinical isolates from patients with various diseases (intestinal and extraintestinal infections). This new PCR assay appears to detect all afa-related sequences in human and animal strains. We observed that the frequencies of afa-positive strains in pyelonephritis isolates and in blood isolates were higher (twice and three times, respectively) than those obtained with the previously described PCR. Characterization of the AfaE adhesin subtype by specific PCR assay made it possible to determine in both cases the increase in detection of the afa-8 operon.

Investigation of the AfaE subtypes showed that afaE1, afaE2, afaE3 (and draE, which is 99.4% identical to afaE3), afaE5, and daaE were found in both diarrhea and uropathogenic human isolates, suggesting that, regardless of the afaE subtype, strains expressing these operons may cause both intestinal infections and UTIs. An AfaE-I-producing clone lacking other virulence factors has been reported to be the causative agent of both diarrhea and cystitis (16). We found that the afaE1 subtype was one of the most frequent in isolates from patients with pyelonephritis, sepsis, and diarrhea. In addition, afaE3 and afaE5, two subtypes that have been reported to predominate in cystitis isolates (47), together with afaE1, were also observed in this study to predominate in strains associated with diarrhea. In contrast, we did not detect the afaE7 subtype in human pathogenic strains. These data are consistent with the lack of significance of this subtype suggested by studies with animal pathogenic strains (15, 33).

Previous studies have detected the afa-8 operon in E. coli strains causing neonatal septicemia and diarrhea in farm animals, especially calves (15, 33), and have reported the presence of afa-8-positive strains in human E. coli isolates, especially in human extraintestinal isolates producing cytotoxic necrotizing factor 1 (CNF1) (15). Our results confirm the association of afa-8 with human extraintestinal isolates. Our approach, using two different PCR assays to detect the conserved AFA biogenesis region and the adhesin-encoding gene, generated results suggesting that the entire afa-8 operon is present in all of the positive strains. We demonstrated the presence of the afa-8 operon in blood isolates from cancer patients with various underlying diseases and immune statuses and with and without a possible urinary source for bacteremia. We found that afa-8 was carried by 75% of the afa-positive bacteremia isolates. In addition, we report for the first time that afa-8 is also the most prevalent afa operon in a well-documented collection of pyelonephritis isolates. All these data strongly suggested that afa-8-positive bacteria are associated with severe human extraintestinal infections. afa-positive strains are also associated with infections of the lower urinary tract (10). The possible presence of afa-8 in cystitis isolates should be evaluated.

Several virulence factors associated with extraintestinal isolates of E. coli were detected with similar frequencies in afa-8-positive strains isolated from patients with sepsis and pyelonephritis. We found that iutC (aerobactin)- and papC (P fimbria)-positive strains occurred at high frequencies (70.8 and 58%, respectively) (data not shown). Some afa-8-positive strains were also found to carry sfa or foc (S and FIC fimbriae), hlyA (hemolysin), and cnf1 (CNF1 toxin) sequences. Moreover, 54% of the afa-8-positive strains carried two to five of these virulence factors (data not shown), indicating that these strains are true extraintestinal pathogens. However, three pyelonephritis isolates (12.5%) were positive for only afa-8. In two of these strains, afa-8 was reported to be carried by a genetic element similar to PAI IAL862, the afa-8-carrying pathogenicity island of the human blood isolate AL862 (34). These data strongly suggested that these two strains are pathogenic and that afa-8 itself may be a key factor in pathogenesis. This idea is supported by a recent study that reported the presence of bmaE (encoding an M agglutinin very similar to AfaE-VIII [33, 46]) in urosepsis isolates of E. coli lacking other extraintestinal virulence factors (27). E. coli isolated from the feces of healthy volunteers is rarely positive for the presence of afa-8 sequences (data not shown). The normal niche for the extraintestinal pathogenic E. coli is the colonic microflora, from which it may spread and cause UTI or septicemia. We detected four afa-8-positive strains among 46 isolates from healthy people (data not shown). At least three of these strains could be considered extraintestinal pathogenic E. coli. They carried a genetic element similar to PAI IAL862 and were positive for the presence of sequences encoding virulence factors (aerobactin and P fimbriae) associated with uropathogenic strains (data not shown). Interestingly, afa-8 was not detected in human isolates associated with diarrhea, consistent with the previously reported properties of AfaE-VIII, which binds to urothelial cell lines but does not bind to intestinal cell lines (33). It seems likely that afa-8 is involved exclusively in the development of extraintestinal infections in humans and animals. The afa-8 operon encodes AfaE-VIII adhesin and AfaD-VIII protein, which belongs to the AfaD family of invasins (11, 33). The characterization of adhesin and invasin receptors should provide important information about the role of this virulence factor in the pathogenic processes involved in the development of such infections.

Afa/Dr+ adhesins, encoded by the afaE1, afaE3, draE, and daaE genes, and Afa/Dr− adhesins, encoded by the afaE7 and afaE8 genes, have been described (33, 43). The Afa/Dr+ adhesins bind to human DAF, and this attachment results in a dense local accumulation of DAF molecules readily detectable on HeLa and Caco-2 cells by immunofluorescence (22, 24; M. Jouve, M.-I. Garcia, P. Courcoux, S. Bouzari, A. Labigne, P. Gounon, and C. Le Bouguénec, Abstr. 98th Gen. Meet. Ave. Soc. Microbiol., abstr. B-304, 1998). Here, we demonstrate that the afaE2, afaE5, and afaEX subtypes encode adhesins that also recognize DAF, suggesting that all these adhesins, which do or do not mediate MRHA, belong to the Afa/Dr+ family. We screened all the afa-positive clones with the fluorescent DAF staining test and showed a correlation between the accumulation of DAF at the bacterium-HeLa cell interaction site and positive results in the PCR assay based on the afa1 and afa2 primers. Thus, the two afa PCR assays described here could be used for different purposes. The afa-f–afa-r primers detect all afa strains, irrespective of the afaE subtype and the binding properties of the adhesins (Afa/Dr+ and Afa/Dr−). In contrast, the afa1-afa2 assay detects only strains encoding Afa/Dr+ adhesins.

The production of several AfaE adhesins by a single strain has been reported (30). Our results suggest that the various AfaE adhesins produced by a single strain have similar binding properties: we found strains that produced two different Afa/Dr+ adhesins among diarrhea and intestinal isolates, whereas no single strain simultaneously produced Afa/Dr+ and Afa/Dr− adhesins. Similar mutual exclusion was observed between sfa or foc operons and afa operons encoding Afa/Dr+ adhesins. We have no explanation for this yet. Further investigation of these points might increase our understanding of how and why the genome of E. coli evolves to create new pathotypes and the limits of the evolutionary process.

ACKNOWLEDGMENTS

We thank A. Labigne, in whose unit this work was carried out, for her continuing interest and helpful discussions. We also thank S. Moseley for the C1845 isolate and D. M. Lublin for the IH4 and 8D11 MAbs against human DAF.

C. Le Bouguénec was supported by grant 1335 from the European Community program FAIR and a grant from the Programme de Recherche Fondamentale en Microbiologie et Maladies Infectieuses et Parasitaires (PRFMMIP-MENRT). L. Lalioui received fellowships from the Marcel Mérieux Fondation and the Fondation pour la Recherche Médicale. M. Jouve was a fellow of the Association Pour les Journées de Biologie Clinique Institut Pasteur-CHU Necker Enfants Malades.

REFERENCES

  • 1.Archambaud M, Courcoux P, Labigne-Roussel A. Detection by molecular hybridization of PAP, AFA, and SFA adherence systems in Escherichia coli strains associated with urinary and enteral infections. Ann. Inst. Pasteur/Microbiol. 1988;139:575–588. doi: 10.1016/0769-2609(88)90156-1. [DOI] [PubMed] [Google Scholar]
  • 2.Arthur M, Johnson C E, Rubin R H, Arbeit R D, Campanelli C, Kim C, Steinbach S, Agarwal M, Wilkinson R, Goldstein R. Molecular epidemiology of adhesin and hemolysin virulence factors among uropathogenic Escherichia coli. Infect Immun. 1989;57:303–313. doi: 10.1128/iai.57.2.303-313.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bilge S S, Apostol J M, Aldape M A, Moseley S L. mRNA processing independent of RNase III and RNase E in the expression of the F1845 fimbrial adhesin of Escherichia coli. Proc Natl Acad Sci USA. 1993;90:1455–1459. doi: 10.1073/pnas.90.4.1455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bilge S S, Apostol J M J, Fullner K J, Moseley S L. Transcriptional organization of the F1845 fimbrial adhesin determinant of Escherichia coli. Mol Microbiol. 1993;7:993–1006. doi: 10.1111/j.1365-2958.1993.tb01191.x. [DOI] [PubMed] [Google Scholar]
  • 5.Bilge S S, Clausen C R, Lau W, Moseley S L. Molecular characterization of a fimbrial adhesin, F1845, mediating diffuse adherence of diarrhea-associated Escherichia coli to HEp-2 cells. J Bacteriol. 1989;171:4281–4289. doi: 10.1128/jb.171.8.4281-4289.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Blanco M, Blanco J E, Alonso M P, Mora A, Balsalobre C, Munoa F, Juarez A, Blanco J. Detection of pap, sfa, and afa adhesin-encoding operons in uropathogenic Escherichia coli strains: relationship with expression of adhesins and production of toxins. Res Microbiol. 1997;148:745–755. doi: 10.1016/s0923-2508(97)82450-3. [DOI] [PubMed] [Google Scholar]
  • 7.Boyer H W, Roulland-Dussoix D. A complementation analysis of the restriction and modification of DNA in Escherichia coli. J Mol Biol. 1969;41:459–472. doi: 10.1016/0022-2836(69)90288-5. [DOI] [PubMed] [Google Scholar]
  • 8.Carnoy C, Moseley S L. Mutational analysis of receptor binding mediated by the Dr family of Escherichia coli adhesins. Mol Microbiol. 1997;23:365–379. doi: 10.1046/j.1365-2958.1997.2231590.x. [DOI] [PubMed] [Google Scholar]
  • 9.Daigle F, Harel J, Fairbrother J M. Expression and detection of pap-, sfa-, and afa-encoded fimbrial adhesin systems among uropathogenic Escherichia coli. Can J Microbiol. 1994;40:286–291. doi: 10.1139/m94-046. [DOI] [PubMed] [Google Scholar]
  • 10.Foxman B, Zhang L, Tallman P, Palin K, Rode C, Bloch C, Gillespie B, Marrs C. Virulence characteristics of Escherichia coli causing first urinary tract infection predict risk of second infection. J Infect Dis. 1995;172:1536–1541. doi: 10.1093/infdis/172.6.1536. [DOI] [PubMed] [Google Scholar]
  • 11.Garcia M-I, Jouve M, Nataro J P, Gounon P, Le Bouguénec C. Characterization of the AfaD-like family of invasins encoded by pathogenic Escherichia coli associated with intestinal and extra-intestinal infections. FEBS Lett. 2000;479:111–117. doi: 10.1016/s0014-5793(00)01898-6. [DOI] [PubMed] [Google Scholar]
  • 12.Garcia M I, Gounon P, Courcoux P, Labigne A, Le Bouguénec C. The afimbrial adhesive sheath encoded by the afa-3 gene cluster of pathogenic Escherichia coli is composed of two adhesins. Mol Microbiol. 1996;19:683–693. doi: 10.1046/j.1365-2958.1996.394935.x. [DOI] [PubMed] [Google Scholar]
  • 13.Garcia M I, Labigne A, Le Bouguénec C. Nucleotide sequence of the afimbrial-adhesin-encoding afa-3 gene cluster and its translocation via flanking IS1 insertion sequences. J Bacteriol. 1994;176:7601–7613. doi: 10.1128/jb.176.24.7601-7613.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Garcia M I, Le Bouguénec C. Role of adhesion in pathogenicity of human uropathogenic and diarrhoeogenic Escherichia coli. Bull Inst Pasteur. 1996;94:201–236. [Google Scholar]
  • 15.Gérardin J, Lalioui L, Jacquemin E, Le Bouguénec C, Mainil J G. The afa-related gene cluster in necrotoxigenic and other Escherichia coli from animals belongs to the afa-8 variant. Vet Microbiol. 2000;76:175–184. doi: 10.1016/s0378-1135(00)00234-0. [DOI] [PubMed] [Google Scholar]
  • 16.Germani Y, Bégaud E, Duval P, Le Bouguénec C. An Escherichia coli clone carrying the adhesin-encoding afa operon is involved in both diarrhoea and cystitis in twins. Trans R Soc Trop Med Hyg. 1997;91:573. doi: 10.1016/s0035-9203(97)90031-6. [DOI] [PubMed] [Google Scholar]
  • 17.Germani Y, Bégaud E, Duval P, Le Bouguénec C. Prevalence of enteropathogenic, enteroaggregative, and diffusely adherent Escherichia coli among isolates from children with diarrhea in New Caledonia. J Infect Dis. 1996;174:1124–1126. doi: 10.1093/infdis/174.5.1124. [DOI] [PubMed] [Google Scholar]
  • 18.Germani Y, Morillon M, Begaud E, Dubourdieu H, Costa R, Thevenon J. Two-year study of endemic enteric pathogens associated with acute diarrhea in New Caledonia. J Clin Microbiol. 1994;32:1532–1536. doi: 10.1128/jcm.32.6.1532-1536.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Giron J A, Jones T, Millan-Velasco F, Castro-Munoz E, Zarate L, Fry J, Frankel G, Moseley S L, Baudry B, Kaper J B, Schoolnik G K, Riley L W. Diffuse-adhering Escherichia coli (DAEC) as a putative cause of diarrhea in Mayan children in Mexico. J Infect Dis. 1991;163:507–513. doi: 10.1093/infdis/163.3.507. [DOI] [PubMed] [Google Scholar]
  • 20.Goluszko P, Moseley S L, Truong L D, Kaul A, Williford J R, Selvarangan R, Nowicki S, Nowicki B. Development of experimental model of chronic pyelonephritis with Escherichia coli O75:K5:H bearing Dr fimbriae. J Clin Investig. 1997;99:1662–1672. doi: 10.1172/JCI119329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Goluszko P, Popov V, Selvarangan R, Nowicki S, Pham T, Nowicki B J. Dr fimbriae operon of uropathogenic Escherichia coli mediate microtubule-dependent invasion to the HeLa epithelial cell line. J Infect Dis. 1997;176:158–167. doi: 10.1086/514018. [DOI] [PubMed] [Google Scholar]
  • 22.Goluszko P, Selvarangan R, Popov V, Pham T, Wen J W, Singhal J. Decay-accelerating factor and cytoskeleton redistribution pattern in HeLa cells infected with recombinant Escherichia coli strains expressing Dr family of adhesins. Infect Immun. 1999;67:3989–3997. doi: 10.1128/iai.67.8.3989-3997.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Gounon P, Jouve M, Le Bouguénec C. Immunocytochemistry of the AfaE adhesin and AfaD invasin produced by pathogenic Escherichia coli strains during interaction of the bacteria with HeLa cells by high-resolution scanning electron microscopy. Microbes Infect. 2000;2:359–365. doi: 10.1016/s1286-4579(00)00331-2. [DOI] [PubMed] [Google Scholar]
  • 24.Guignot J, Peiffer I, Bernet-Camard M-F, Lublin D M, Carnoy C, Moseley S L, Servin A L. Recruitment of CD55 and CD66e brush border-associated glycosylphosphatidylinositol-anchored proteins by members of the Afa/Dr diffusely adhering family of Escherichia coli that infect the human polarized intestinal Caco-2/TC7 cells. Infect Immun. 2000;68:3554–3563. doi: 10.1128/iai.68.6.3554-3563.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hilali F, Ruimy R, Saulnier P, Barnabé C, Le Bouguénec C, Tibayrenc M, Andremont A. Prevalence of virulence genes and clonality in Escherichia coli strains that cause bacteremia in cancer patients. Infect Immun. 2000;68:3983–3989. doi: 10.1128/iai.68.7.3983-3989.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Humbert J, Jouve M, Le Bouguénec C, Gounon P. Electron microscopic improvement in the study of diarrheagenic Escherichia coli. Microsc Res Tech. 2000;49:383–393. doi: 10.1002/(SICI)1097-0029(20000515)49:4<383::AID-JEMT7>3.0.CO;2-R. [DOI] [PubMed] [Google Scholar]
  • 27.Johnson J R, Stell A L. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J Infect Dis. 2000;181:261–272. doi: 10.1086/315217. [DOI] [PubMed] [Google Scholar]
  • 28.Jouve M, Garcia M I, Courcoux P, Labigne A, Gounon P, Le Bouguénec C. Adhesion to and invasion of HeLa cells by pathogenic Escherichia coli carrying the afa-3 gene cluster are mediated by the AfaE and AfaD proteins, respectively. Infect Immun. 1997;65:4082–4089. doi: 10.1128/iai.65.10.4082-4089.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Labigne A, Cussac V, Courcoux P. Shuttle cloning and nucleotide sequences of Helicobacter pylori genes responsible for urease activity. J Bacteriol. 1991;173:1920–1931. doi: 10.1128/jb.173.6.1920-1931.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Labigne-Roussel A, Falkow S. Distribution and degree of heterogeneity of the afimbrial-adhesin-encoding operon (afa) among uropathogenic Escherichia coli isolates. Infect Immun. 1988;56:640–648. doi: 10.1128/iai.56.3.640-648.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Labigne-Roussel A, Schmidt M A, Walz W, Falkow S. Genetic organization of the afimbrial adhesin operon and nucleotide sequence from a uropathogenic Escherichia coli gene encoding an afimbrial adhesin. J Bacteriol. 1985;162:1285–1292. doi: 10.1128/jb.162.3.1285-1292.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Labigne-Roussel A F, Lark D, Schoolnik G, Falkow S. Cloning and expression of an afimbrial adhesin (AFA-1) responsible for P blood group-independent, mannose-resistant hemagglutination from a pyelonephritic Escherichia coli strain. Infect Immun. 1984;46:251–259. doi: 10.1128/iai.46.1.251-259.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lalioui L, Jouve M, Gounon P, Le Bouguénec C. Molecular cloning and characterization of the afa-7 and afa-8 gene clusters encoding afimbrial adhesins in Escherichia coli strains associated with diarrhea or septicemia in calves. Infect Immun. 1999;67:5048–5059. doi: 10.1128/iai.67.10.5048-5059.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Lalioui L, Le Bouguénec C. afa-8 gene cluster is carried by a pathogenicity island inserted into the tRNAPhe of human and bovine pathogenic Escherichia coli isolates. Infect Immun. 2001;69:937–948. doi: 10.1128/IAI.69.2.937-948.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Le Bouguénec C. Diarrhea-associated diffusely adherent Escherichia coli. Clin Microbiol Rev. 1999;12:180–181. doi: 10.1128/cmr.12.1.180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Le Bouguénec C, Archambaud M, Labigne A. Rapid and specific detection of the pap, afa, and sfa adhesin-encoding operons in uropathogenic Escherichia coli strains by polymerase chain reaction. J Clin Microbiol. 1992;30:1189–1193. doi: 10.1128/jcm.30.5.1189-1193.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Le Bouguénec C, Garcia M I, Ouin V, Desperrier J M, Gounon P, Labigne A. Characterization of plasmid-borne afa-3 gene clusters encoding afimbrial adhesins expressed by Escherichia coli strains associated with intestinal or urinary tract infections. Infect Immun. 1993;61:5106–5114. doi: 10.1128/iai.61.12.5106-5114.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Levine M M, Ferreccio C, Prado V, Cayazzo M, Abrego P, Martinez J, Maggi L, Baldini M M, Martin W, Maneval D, Kay B, Guers L, Lior H, Wasserman S S, Nataro J P. Epidemiologic studies of Escherichia coli diarrheal infections in a low socioeconomic level peri-urban community in Santiago, Chile. Am J Epidemiol. 1993;138:849–869. doi: 10.1093/oxfordjournals.aje.a116788. [DOI] [PubMed] [Google Scholar]
  • 39.Loomis W P, Moseley S L. Translational control of mRNA processing in the F1845 fimbrial operon of Escherichia coli. Mol Microbiol. 1998;30:843–853. doi: 10.1046/j.1365-2958.1998.01117.x. [DOI] [PubMed] [Google Scholar]
  • 40.Maniatis T, Fritsch E F, Sambrook J. Molecular cloning: a laboratory manual. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory; 1982. [Google Scholar]
  • 41.Mulvey M A, Lopez-Boado Y S, Wilson C L, Roth R, Parks W C, Heuser J, Hultgren S J. Induction and evasion of host defenses by type 1-piliated uropathogenic Escherichia coli. Science. 1998;282:1494–1497. doi: 10.1126/science.282.5393.1494. [DOI] [PubMed] [Google Scholar]
  • 42.Nowicki B, Hart A, Coyne K E, Lublin D M, Nowicki S. Short consensus repeat-3 domain of recombinant decay-accelerating factor is recognized by Escherichia coli recombinant Dr adhesin in a model of a cell-cell interaction. J Exp Med. 1993;178:2115–2121. doi: 10.1084/jem.178.6.2115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Nowicki B, Labigne A, Moseley S, Hull R, Hull S, Moulds J. The Dr hemagglutinin, afimbrial adhesins AFA-I and AFA-III, and F1845 fimbriae of uropathogenic and diarrhea-associated Escherichia coli belong to a family of hemagglutinins with Dr receptor recognition. Infect Immun. 1990;58:279–281. doi: 10.1128/iai.58.1.279-281.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Nowicki B, Martens M, Hart A, Nowicki S. Gestational age-dependent distribution of Escherichia coli fimbriae in pregnant patients with pyelonephritis. Ann NY Acad Sci. 1994;730:290–291. doi: 10.1111/j.1749-6632.1994.tb44268.x. [DOI] [PubMed] [Google Scholar]
  • 45.Nowicki B, Svanborg-Eden C, Hull R, Hull S. Molecular analysis and epidemiology of the Dr hemagglutinin of uropathogenic Escherichia coli. Infect Immun. 1989;57:446–451. doi: 10.1128/iai.57.2.446-451.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Rhen M, Väisänen-Rhen V, Saraste M, Korhonen T K. Organization of genes expressing the blood-group-M-specific hemagglutinin of Escherichia coli: identification and nucleotide sequence of the M-agglutinin subunit gene. Gene. 1986;49:351–360. doi: 10.1016/0378-1119(86)90371-9. [DOI] [PubMed] [Google Scholar]
  • 47.Zhang L, Foxman B, Tallman P, Cladera E, Le Bouguénec C, Marrs C F. Distribution of drb genes coding for Dr binding adhesins among uropathogenic and fecal Escherichia coli isolates and identification of new subtypes. Infect Immun. 1997;65:2011–2018. doi: 10.1128/iai.65.6.2011-2018.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES