Skip to main content
FEBS Open Bio logoLink to FEBS Open Bio
. 2021 Dec 26;12(2):349–361. doi: 10.1002/2211-5463.13335

Chloroplast genomes of two Pueraria DC. species: sequencing, comparative analysis and molecular marker development

Jishuang Li 1, Meng Yang 1, Yanni Li 1, Mei Jiang 1, Chang Liu 1, Meijun He 2,, Bin Wu 1,
PMCID: PMC8804624  PMID: 34856076

Abstract

Puerariae lobatae radix (Ge‐Gen in Chinese) and Puerariae thomsonii radix (Fen‐Ge) are widely used as medicine and health products, particularly in Chinese medicine. Puerarin and daidzein are the primary bioactive compounds in Puerariae radix. These isoflavones have been used to treat cardiovascular and cerebrovascular diseases, hypertension, diabetes, and osteoporosis. The content of puerarin in Ge‐Gen is about six times higher than that in Fen‐Ge, so its use has a higher pharmacological effect. It is therefore of great importance to effectively distinguish between these two species. However, because their basal plants, P. lobata (Willd.) Ohwi and P. thomsonii Benth., possess an extremely similar appearance, and detecting the level of chemical constituents is just a rough distinction, it is necessary to develop more efficient identification approaches. Here the complete chloroplast genomes of P. lobata and P. thomsonii were deciphered, including sequencing, assembly, comparative analysis, and molecular marker development. The results showed that they are 153,393 and 153,442 bp in length, respectively; both contain 124 annotated genes, including eight encoding rRNA, 29 encoding tRNA, and 87 encoding proteins. Phylogenetic analysis showed that they form a clade, indicating that they originate from the same ancestor. After obtaining 10 intergenic/intronic regions with a genetic distance greater than 0.5 cm, primers were designed to amplify regions of high variability in P. lobata and P. thomsonii. Finally, a 60‐bp differential base fragment, located in the intron of rpl16, was developed as a molecular marker to efficiently distinguish between these two species.

Keywords: chloroplast genome, comparative analysis, molecular marker, Pueraria lobata (Willd.) Ohwi, Pueraria thomsonii Benth.


The content of the medicinal isoflavone puerarin in the root of Puerariae lobatae (Ge‐Gen) is about six times higher than that in Puerariae thomsonii (Fen‐Ge), but these two plants are visually indistinguishable. By deciphering the complete chloroplast genome of these two plants, the authors developed a molecular marker to efficiently distinguish between them.

graphic file with name FEB4-12-349-g006.jpg


Abbreviations

CP

chloroplast

IR

reverse complementary regions

LSC

long single copy region

P. lobata

Pueraria lobata (Willd.) Ohwi

P. thomsonii

Pueraria thomsonii Benth.

SSC

short single copy region

SSRs

simple sequence repeats

Puerariae lobatae radix, known as Ge‐Gen in Chinese, is a popular traditional Chinese herbal medicine that was first described in the Shennong Herbal Classic. The genus Pueraria DC. belongs to the Fabaceae family and comprises about 20 species worldwide. It is mainly distributed in East Asian countries, among which China is the distribution center, accounting for 11 species. The dried roots of Ge‐Gen have been widely used for the treatment of influenza, muscle stiffness, and other sicknesses [1]. Owing to a multi‐origin traditional Chinese medicine, there are two Pueraria species: Pueraria lobata (Willd.) Ohwi and Pueraria thomsonii Benth., whose roots were considered the main source of Ge‐Gen because of the wide distribution and its traditional Chinese herbal medicine value, as recorded in the Chinese Pharmacopoeia, 2000 edition [2]. Isoflavones, including puerarin and daidzein, are the primary bioactive compounds in Ge‐Gen. Modern pharmacological studies have proved that puerarin treats cardiovascular and cerebrovascular diseases, hypertension, diabetes, as well as osteoporosis [3], while daidzein can be used in the prevention of high blood alcohol level [4].

According to previous studies, the contents of isoflavones and polysaccharides in P. lobata are both higher than in P. thomsonii, especially the main bioactive compounds puerarin and daidzein [5, 6, 7]. This means that the pharmacological effect of P. lobata is much better than P. thomsonii. As a result, for accuracy of medication, since 2005 the roots of P. lobata and P. thomsonii have been separately used as Ge‐Gen and Fen‐Ge in the Chinese Pharmacopoeia; The Chinese Pharmacopoeia (2010 edition) specifies the lower limit of puerarin in P. thomsonii and P. lobata are 0.3% and 2.4%, respectively. However, the morphological characteristics of these two species are too similar to distinguish. They are both perennial woody lianas, up to 8 meters in length. They have thick and massive roots; woody stems at the base; pinnate compound leaves growing with three leaflets; ovate‐shaped accumbent stipules; campanulate calyx, covered with yellowish‐brown pubescent; purple corolla, obovate petals; flat pod, covered with brown bristles. The main difference between these two species is that the leaflets of P. thomsonii are rhomboid‐ovate or broadly ovate, the apexes are acute or apiculate, the bases are truncate, the lateral leaflets are slightly smaller and more oblique, and the petals are circular. While the shape of dried roots of the two plants is extremely similar, it is more difficult to identify the processed slices. Moreover, their morphological characteristics are susceptible to environmental conditions, which increases the difficulty for identification [8, 9]. Although some common species can be roughly distinguished by chemical composition content, it is not effective to screen P. lobata and P. thomsonii and their common counterfeits using minor differences. Universal molecular markers, such as internal transcribed spacer (ITS), rbcL and psbA, are widely used for identifying species easily and accurately [10, 11, 12], but wild relatives cannot be distinguished efficiently. Because of the lack of an effective approach for distinguishing these two species, they can easily be confused, which could potentially lead to poor therapeutic effects. As a consequence, it is urgent to develop novel molecular markers.

The chloroplast (CP) is an organelle of great importance in green plants, which plays a crucial role in photosynthesis, carbon fixation, translation, and biosynthesis [13]. According to former reports, the length of CP genomes in most angiosperms generally range from 115 to 165 kb; the structure of CP genomes in plants is highly conserved. CP has a circular genome, independent of the nuclear genome and is maternally inherited. The intraspecific sequences of CP genomes are relatively conserved, while some regions are highly variable, which can be utilized as markers for identification of different species [14]; the substitution rate of the CP genome is lower than the nuclear genome, while higher than the mitochondrial genome. As a result, CP genomes show the potential for the distinction among different species. With significant advances in next‐generation sequencing technologies and bioinformatics, CP genomes have been widely used for phylogenetic analysis and molecular marker development in our and other researchers' studies [15, 16, 17, 18]. However, the CP genomes of P. lobata and P. thomsonii have not been thoroughly studied. The complete CP genome of P. thomsonii has been reported [19], and we can use these data for subsequent experimental comparison and verification, and to conduct further analysis for the identification of the two species. Therefore, the comparative analysis and marker development of CP genome of Pueraria DC. represented by P. lobata and P. thomsonii will have great development prospects.

In our study, the genomes of P. thomsonii and P. lobata were sequenced, assembled, and annotated. Afterwards, a comparative genomic analysis between the two CP genomes was conducted with the aim of finding highly variable regions and establish the phylogenetic position of the Pueraria DC. in the Fabaceae family. Moreover, a specific molecular marker from the CP genomes of the two Pueraria species was developed and verified. In all, our study aimed to ensure safety in the use of medicinal plants, identify species, and conserve wild Pueraria species.

Materials and methods

Material preparation, DNA extraction, genome sequencing and assembly

Fresh leaf materials of P. lobata and P. thomsonii were collected from Sancha Town, Enshi City, Enshi Prefecture, Hubei Province (109.49°E, 30.30°N), China. Samples of P. lobata were collected from the Beijing Medicinal Plant Garden (116.28°E, 40.04°N) for reference. Leaves were stored at −80 °C after rinsing. Total DNA was extracted using a plant genomic DNA kit (Tiangen Biotech, Beijing, China). DNA quality was assessed using the Nanodrop spectrophotometer 2000 (ThermoFisher Scientific, Waltham, MA, USA), and the integrity was evaluated by 1.0% agarose gel electrophoresis. The sequencing libraries were prepared by using the TruSeq DNA Sample Prep Kit (Illumina, San Diego, CA, USA). DNA was fragmented into ~500 bp long fragments randomly for paired‐end library construction [20]. The library was sequenced on an Illumina HiSeq 3000 instrument. The raw reads obtained were filtered by trimmomatic (v. 0.32) [21]. spades (v. 3.10.1) [22], clc genomics workbench (v. 7), and novoplasty (v. 4.3) [23] were used for the CP genome assembly [24]. The contigs obtained were identified by Gepard [25]. All the identified contigs were assembled using the Seqman module of dnastar (v. 11.0) [26].

Annotation and comparative analysis

Dual Organellar GenoMe Annotator (DOGMA) [27], the CP Genome Annotation, Visualization, Analysis, and GenBank Submission (CPGAVAS2) [28] and GeSeq [29] were used to annotate the two genomes. Manual corrections on the positions of the start and stop codons and the intron/exon boundaries were performed based on the entries in the plastome database using the Apollo program [30]. The tRNA genes were identified with tRNAscan‐SE [31] and DOGMA. The circular plastome maps were drawn by ogdraw (v. 1.3.1) [32]. The percentage of GC content and the codon usage were analyzed using the programs Cusp and Compseq in emboss (v. 6.3.1) [33]. Comparative analysis of the CP genomes of P. thomsonii and P. lobata was performed using the mVISTA program [34] in Shuffle‐LAGAN mode with default parameters [35].

Long repeats and simple sequence repeats analyses

The size and location of long repeat sequences, including forward, palindromic, reverse, and complement repeats in the CP genomes of two species were identified by setting the parameter of the Hamming Distance to 3 (sequence identity ≥90%) and the Minimal Repeat Size to 30 through reputer [36]. Simple sequence repeats (SSRs) were detected using MISA software with the minimum repeat number set at 8, 4, 4, 3, 3, and 3 for mono‐, bi‐, tri‐, tetra‐, penta‐, and hexa‐nucleotides, respectively [37].

Phylogenetic analysis

In this study, the phylogenetic tree was conducted using the maximum likelihood (ML) method: a total of 46 CP genomes were used for the phylogenetic analysis, including P. lobata, P. thomsonii, and other 42 of Leguminosae, as well as two outgroup species, Nicotiana tabacum and Arabidopsis thaliana. The CP genome sequences were downloaded from the NCBI GenBank (https://www.ncbi.nlm.nih.gov/) (Table S1). After screening the protein‐coding genes in the CP genomes, 54 common protein‐coding genes (atpA, atpB, atpH, atpI, ccsA, cemA, clpP, matK, ndhC, ndhE, ndhF, ndhG, ndhH, ndhI, ndhJ, petA, petB, petD, petG, petL, psaA, psaB, psaC, psaJ, psbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ, psbK, psbM, rbcL, rpl14, rpl16, rpl2, rpl20, rpoA, rpoB, rpoC1, rpoC2, rps11, rps14, rps15, rps18, rps19, rps3, rps4, rps7, rps8, ycf3) were obtained and then globally matched using Alignment using the Fast Fourier Transform (MAFFT) program [38]. Next, using N. tabacum and A. thaliana as outgroup species, phylogenetic relationships were analyzed using the ML method and the Tamura‐Nei model in MEGA6 [39]. The BOOTSTRAP value, initially set to 1000 times, was used to evaluate nodal support of the phylogenetic tree.

Sequence divergence analysis and molecular marker development

In order to analyze sequence diversity and selective pressure, sequences of 124 annotated genes and 146 intergenic/intronic regions were extracted from the two CP genomes, and then aligned by the Clustalw2 (v. 2.0.12) program [40] with the options: “‐type=dna, ‐gapopen=10, ‐gapext=2”, pairwise distance were determined with the Distmat program that was implemented in EMBOSS [33] using the Kimura 2‐parameters (K2p) evolution model.

The molecular marker was selected based on the alignment and comparison of mVISTA similarities and divergence analysis results. To amplify these regions, primers were designed using Primer Premier 5 [41]. In order to further confirm whether the molecular marker developed in this study was reliable for the classification and identification of P. lobata and P. thomsonii, plant samples of P. lobata and P. thomsonii were collected from some other regions (Table S2). The procedure of DNA extraction was as described above. The developed molecular marker was used to amplify the total DNA of P. lobata and P. thomsonii from different regions. PCR was conducted with the following program: initial denaturation at 95 °C for 3 min; followed by 35 cycles of amplification at 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 1 min; and final extension at 72 °C for 5 min. Then the PCR products were separated with 1.0% (w/v) agarose gel for 20 min at 120 volts. Finally, the products were sent to the company for sequencing. The primers are listed in Table 2.

Table 2.

The specific molecular marker primer.

Primer name Primer sequence PCR products size (bp)
Puerarialobata Puerariae thomsonii
YF‐60 Forward: CTAGATAATCCGAAGCGATGC 338 398
Reverse: TCAGAGAAGGTAGGGTTCCTC

Results

General features of the CP genomes

After assembly and annotation, the CP genomes of P. lobata and P. thomsonii both display circular molecules with the typical quadripartite structure, including a long single copy region (LSC), a short single copy region (SSC), and a pair of reverse complementary regions (IRa and IRb). The CP genome of P. lobata from Hubei Province was 153,393 bp in length; while that of P. thomsonii was 153,442 bp; both of the total GC contents were 35.41% (Fig. 1, Table 1, and Fig. S1).

Fig. 1.

Fig. 1

Circular gene map of the complete CP genome of Puerarialobata. Genes drawn inside the circle are transcribed clockwise, and those on the outside are transcribed counterclockwise. The dark gray area in the inner circle corresponds to the GC content, whereas the light gray refers to AT content. LSC, large single copy region; SSC, small single copy region; IRa, IRb, copies of inverted repeat regions.

Table 1.

Base composition in the CP genomes of Puerarialobata and Puerariaethomsonii.

Chinese name Latin name Length (bp) GC content (%)
Total LSC SSC IR Total LSC SSC IR
Enye P. lobata 153,393 84,089 17,992 25,656 35.41% 32.86% 28.90% 41.87%
Guangfen P. thomsonii 153,442 84,163 17,998 25,640 35.41% 32.87% 28.90% 41.88%

Both P. lobata and P. thomsonii have 124 annotated genes: 87 protein‐coding genes, 29 tRNA genes, and eight rRNA genes. The 87 protein‐coding genes could be divided into three main types: the first one refers to a total of 29 self‐replicated genes; the second one refers to a total of 46 genes related to photosynthesis; the third one refers to a total of 12 other protein‐coding genes (Table S3).

There were 58 protein‐coding genes and 19 tRNA genes in the LSC region of P. lobata, accounting for 53.38% of the total length of LSC; there were five protein‐coding genes, four rRNA genes, and eight tRNA genes in each IR region, accounting for 67.80% of the total length of IR; and there were 12 protein‐coding genes and one tRNA gene in the SSC region, accounting for 50.48% of the total length of the SSC. The total gene sequence length of each region accounted for 58.57% of the CP genome length of P. lobata, as (Table S4). There were 61 protein‐coding genes and 21 RNA genes in the LSC region of P. thomsonii, accounting for 52.82% of the whole sequence of LSC; there were seven protein‐coding genes and 11 RNA genes in both IR regions, accounting for 65.68% of the total length of IR; and there were 13 protein‐coding genes and one tRNA in the SSC region, accounting for 50.46% of the total length of the SSC. The total encoding gene sequence accounted for 56.34% of the total length of the CP genome of P. thomsonii.

Additionally, the four CP boundaries (LSC‐IRA, IR‐SSC, SSC‐IRB, IRB‐LSC) and the adjacent genes of the CP genomes of P. lobata and P. thomsonii were compared in detail (Fig. 2). Genes of P. lobata and P. thomsonii were basically the same at the junction of each region, among which the rps19 gene stretched across LSC and IRa; ycf1 stretched across IRa and SSC; the distance between rps19, rpl2 and the boundary of P. lobata was two bp longer than that of P. thomsonii, respectively; trNH‐GUG was at the head of the LSC region and it is nine bp away from IRb in P. lobata, while it is 11 bp away from IRb in P. thomsonii.

Fig. 2.

Fig. 2

Comparison of boundary distance among adjacent genes and junctions of the LSC, SSC, and IRs regions between CP genomes of Puerarialobata and Puerariaethomsonii. The figure is not to scale with respect to sequence length.

There were 22 genes with introns in P. lobata, among which 20 genes had a single intron, two genes had two introns; while in P. thomsonii there were 22 genes with introns, among which 20 genes had one intron, and two genes had two introns (Tables S5 and S6).

Most discrepancies exist in intergenic/intronic regions

As shown in Fig. 3, although the CP genomes of the two species had the same overall structure and similar regions, there were some nucleotide polymorphisms, and these differences were mostly concentrated in intergenic/intronic regions. Additionally, fewer differences within protein‐coding regions could also be found.

Fig. 3.

Fig. 3

Structure comparison of the complete CP genomes of Puerarialobata and Puerariaethomsonii using the mVISTA program. Equal amounts of total DNA from three individuals of each specie were pooled and sequenced. The gray arrows and bold lines at the top of the global alignment represent gene orientation and IRs location, respectively. The y axis represents a 50–100% of identity.

Then, sequences of 124 annotated genes and 146 intergenic/intronic regions were extracted from the CP genomes of P. lobata and P. thomsonii for genetic distance analysis. The result showed that the degree of variation of the protein‐coding region was not considerable at all, and the genetic distance of the intergenic/intronic region was slightly larger than that of the protein‐coding region. The result was consistent with the result of the mVISTA global comparison and the result of comparative analysis among the CP genomes of other species that had been published [42]. The genetic distance of the protein‐coding region ranged from 0.00 to 0.25, while that of the intergenic/intronic region was from 0.00 to 0.97. After screening, we obtained 10 protein‐coding regions with genetic distance >0.1, and 10 intergenic/intronic regions with genetic distance >0.5 (Tables S7 and S8). The corresponding sequence information was extracted from the CP genome sequences of P. lobata and P. thomsonii. Furthermore, the molecular marker can be subsequently developed.

Pueraria lobata possesses more repeat sequences

Repeat units play important roles in genome evolution, and they are distributed quite frequently in CP genomes [43, 44, 45]. The repeat sequence statistics of P. lobata and P. thomsonii in this study are shown in Fig. 4. In the CP genome of P. lobata, a total of 46 repeat sequences with length of at least 30 bp and similarity of at least 90% were found. Among them, there were 23 palindromic repeat sequences, 11 forward repeats, seven reverse repeats, and five complementary repeats; in the CP genome of P. thomsonii, a total of 45 repeat sequences with length of at least 30 bp and similarity of at least 90% were found. Among them, there were 22 palindromic repeats, 15 forward repeats, six reverse repeats, and two complementary repeats. Generally speaking, the forward repeat sequences and the palindromic ones are the most abundant in both species. This result is consistent with the analyses of repeat sequences of other angiosperm CP genome sequences [46].

Fig. 4.

Fig. 4

Repeat sequence statistical analysis of the CP genomes of Puerarialobata and Puerariaethomsonii. Equal amounts of total DNA from three individuals of each specie were pooled and sequenced. “F” refers to forward repeat, “P” refers to palindromic repeat, “R” refers to reverse repeat, and “C” refers to complementary repeat.

The difference of the total number of repeats was not obvious, while the main difference of number was reflected in the forward repeat sequences and the complementary ones. The forward repeat sequences in the CP of P. lobata were four fewer than those in P. thomsonii, while the complementary ones in the CP of P. lobata were three more than those in P. thomsonii.

The SSRs analysis results are shown in Table S9. A total of 284 SSRs were detected in P. lobata, while 283 SSRs were detected in P. thomsonii. Apart from the one more dinucleotide repeat sequence AT/AT in P. lobata than in P. thomsonii, the number of other tandem repeats in both species was similar. Among the detected repeat sequences, there were 182 A/T single nucleotide repeat sequences, which were the most abundant, and accounted for 64.1% of the total number of repeat sequences; both had three G/C single nucleotide repeats. There were 62 and 63 AT/AT dinucleotide repeat sequences in total, respectively; both had 18 AG/CT dinucleotide repeats. Only one trinucleotide repeat sequence AAG/CTT was detected. The types of tetranucleotide repeat sequences included one AATC/ATTG repeat, two AATT/AATT repeats, three AAAT/ATTT repeats, and 12 AGAT/ATCT repeats (Tables S10 and S11).

The close phylogenetic relationship

The ML phylogenetic tree construction results are shown in Fig. 5. It shows that the phylogenetic positions of the two species are basically consistent with the known evolutionary relationship of species. In the whole phylogenetic tree, Ormosia is a single branch, while the other species are mainly divided into two branches. Arachis hypogaea, Maackiafloribunda, Sophora alopecuroides, Ammopiptanthus hainanensis, and Dalbergia hainanensis are closely related, so they were classified as one clade; most of the remaining species belong to the other main clade, including Glycyrrhiza glabra, Medicago falcata, Astragalus mongholicus, and Caragana. Puerarialobata, P. thomsonii, Glycine max, Vigna unguiculata, and Caragana were classified into another subordinate clade. Puerarialobata and P. thomsonii belong to the same small clade.

Fig. 5.

Fig. 5

Phylogenetic tree of Puerarialobata, Puerariaethomsonii, and the other 42 species of legumes based on the shared gene sequences among the CP genomes. The numbers on each branch represent bootstrap support.

Identification marker for distinguishing P. lobata from P. thomsonii

Through the comparative analysis of genomes and the genetic distance analysis results, the target sequences from the high variability regions were extracted for designing primers and screening out the resulting molecular markers. The P. lobata and P. thomsonii samples from Enshi, Hubei province, and the Beijing Medicinal Plant Garden were tested by PCR amplification, gel electrophoresis, and PCR product sequencing and verification. Aiming at the indels that existed among the amplified fragments of P. lobata and P. thomsonii, a pair of primer sequences named YF‐60 were tested, which means that the 60‐bp base difference could be used as the molecular marker to distinguish P. lobata from P. thomsonii (Table 2).

This pair of high‐resolution primers could clearly distinguish the P. lobata sample from the P. thomsonii sample with the highest degree of differentiation. Comparison of YF‐60 amplified sequences showed that there was a lack of a 60‐bp fragment in P. lobata compared with P. thomsonii. Sanger chromatograms are shown in Fig. 6. Gene rpl16 was chosen as the specific molecular marker region with high divergence, where the 60‐bp differential base fragment as well as YF‐60 F exists; while gene rps3 is the area where YF‐60 R locates. Specifically speaking, the 60‐bp differential base fragment locates in the intronic region (Fig. 7A).

Fig. 6.

Fig. 6

Primer YF‐60 amplification chromatogram. Equal amounts of total DNA from three individuals of each specie were pooled and sequenced. The blue and yellow background represent the common sequence of Puerarialobata and Puerariaethomsonii, while the green background represents the unique sequence of P. thomsonii.

Fig. 7.

Fig. 7

(A) The target DNA double‐strand fragment extracted from the highly variable region. YF‐60 represents primer; 60 bp represents the differential base fragment; rpl16 represents the gene where YF‐60 F and the 60‐bp differential base fragment are located; rps3 represents the gene where YF‐60 R is located. (B) PCR amplification of Puerarialobata and Puerariaethomsonii from different habitats using YF‐60 in 1% agar‐gel electrophoresis were 338 bp and 398 bp, respectively. “M” represents DL500 ladder; lanes 1–5 represent P. lobata from Hubei, Hubei, Beijing, Guizhou, and Liaoning, respectively; while lanes 6–8 represent P. thomsonii from Guangxi, Hunan, and Hubei, respectively.

After PCR amplification of DNA extracted from the P. lobata and P. thomsonii samples collected from the seven different regions using primer YF‐60, a 1% agarose gel electrophoresis was conducted for the amplified products (Fig. 7B). The result verified the effectiveness of our developed molecular marker: P. lobata could be clearly identified from P. thomsonii through it.

Discussion

The CP genomes of P. lobata and P. thomsonii were assembled and the general features of the two CP genomes were analyzed. The analyses helped us to find that the CP genomes of P. lobata and P. thomsonii both display single circular molecules with the typical quadripartite structure. The length, region composition, and GC content of different specimens of P. lobata from Hubei were essentially identical. There was almost no difference among different specimens of P. thomsonii from Hubei. However, there existed a few differences between P. lobata samples for reference collected from Beijing and those P. lobata control samples from Hubei, which may provide some references and basis for the identification of genuine medicinal materials in the future. According to the analyses of the total length of CP and the length of each region, the differences of length between the two species mainly existed in the LSC and IR regions, while the SSC was similar in size. Moreover, the composition and structure of the CP genomes of P. lobata and P. thomsonii are similar to that of most angiosperms, especially legumes, indicating that the CP genome has a high degree of genetic conservation. As a result, it provided a basis for phylogenetic analysis and the development of a molecular marker.

The Gepard comparison result just showed that there were no obvious discrepancies in structure and length between them, but mVISTA presented a more detailed version of the contrast. Through comparative analysis we found a few distinguishable sites; most of the discrepancies existed in the intergenic/intronic regions, and the corresponding sequence information was extracted from the CP genome sequences of P. lobata and P. thomsonii.

Through the statistical analysis of repeat sequences, it was found that the number of repeat sequences in the CP genome of P. lobata was higher than in P. thomsonii. The primary repeat sequence difference was reflected in the forward and complementary repeats. In general, the forward and palindromic repeats were most abundant and the result was consistent with other angiosperm CP genome sequences analyses [46]. In addition, most of the SSRs were located in intergenic/intronic regions. Among the detected repeat sequences, the A/T single nucleotide repeat sequences were the most common overall, and there were many tetranucleotide repeat sequences, while pentanucleotide and hexanucleotide repeats were not found.

The chloroplast genome is an important genome resource for accurate phylogenetic reconstruction and classification among related angiosperms [47]. Complete CP genome and protein‐coding gene have been commonly used to confirm phylogenetic relationships at nearly every taxonomic level [48]. In this study, the phylogenetic tree constructed with common genes for the 46 CP genomes showed that the bootstrap values in the legume clade were relatively high, indicating that CP genome sequences could be used for phylogenetic analysis and classification of intergeneric and interspecific relationships in the Fabaceae. With our method, the positions of P. lobata and P. thomsonii were verified: both were closely related, forming a single clade, which is consistent with the conclusion of the former Pueraria botanical classification research [49].

Through the global comparative analysis and the genetic distance analysis, the diversity and variety of the CP genomes of P. lobata and P. thomsonii were revealed; the hypervariable sites were mostly distributed in the intergenic/intronic regions. We identified a 60‐bp differential base fragment between sequences of P. lobata and P. thomsonii to be used as a molecular marker, located in the intronic region of gene rpl16. Finally, a pair of efficient primers was developed to distinguish these two species. Rpl16 is a protein‐coding gene, and the coded protein is named 50S ribosomal protein L16 (QGT34303.1). According to previous studies, the abundance of RPL16 increased in tolerant or sensitive seedlings under dehydration; [50]; the peptidyltransferase activity of RPL16 was inactivated by a photosensitizer [51]. Consequently, rpl16 is very likely related to the dehydration response, as well as photosensitivity, to some extent. As for the intron, it was reported that most of the genes expressed at higher levels tend to possess shorter introns. Natural selection has driven introns to smaller sizes in highly expressed genes to reduce the cost of transcription, and small introns may have evolved to fit more genes into smaller regions [52, 53]. Thus, shorter introns in P. lobata may be an ancestral characteristic of the highly expressed gene rpl16, intron length in rpl16 may have decreased as evolved. Taken together, it is quite possible that P. lobata has stronger dehydration resistance and photosensitive activity than P. thomsonii.

For the sake of further confirmation of the accuracy, with the total genomic DNA extracted from leaves of P. lobata and P. thomsonii collected from different regions as reference, the YF‐60 marker developed in this study was verified by PCR amplification and the 1% agarose gel electrophoresis. The novel molecular marker developed in this study could effectively distinguish the two Pueraria DC. species from different geographical regions. In addition, apart from the published P. thomsonii CP genome 19, we noticed another released P. lobata CP genome in NCBI when conducting nucleotide blast (https://www.ncbi.nlm.nih.gov/nucleotide/MT818508.1). Therefore, we further compared and verified the CP genome of P. lobata, and found no difference from P. thomsonii in the YF‐60 marker region where it should have. This result just indicated the phenomenon that P. thomsonii is easily mistaken as P. lobata, and further supported the availability and application value of our developed molecular marker YF‐60. In all, the developed molecular marker in this study will be beneficial to lay a theoretical foundation for identification of species of Pueraria DC. and promote available utilization and protection of wild Pueraria DC. resources.

Conflict of interest

The authors declare no conflicts of interest.

Author contributions

BW, MH, and CL conceptualized the project. MH and BW administrated the project. JL and MY did the formal analyzing. JL, MY and MJ analyzed and interpreted the data. MY and JL applied the software. JL and MY wrote the original draft. BW supervised the work. JL validated the work. JL, MH, YL, and BW reviewed and edited the article. All authors read and agreed on the published version of the article.

Supporting information

Fig. S1. Circular Gene map of the complete CP genome of Puerariaethomsonii. Genes drawn inside the circle are the transcribed clockwise, and those on the outside are transcribed counter‐clockwise. The dark gray area in the inner circle corresponds to the GC content, whereas the light gray refers to AT content. LSC: large single copy region, SSC: small single copy region, IRa, IRb: copies of inverted repeat regions.

Table S1. CP genome information for phylogenetic tree construction.

Table S2. Sample information.

Table S3. Annotated genes of CP genome.

Table S4. Different genes in different regions in Pueraria lobata.

Table S5. The lengths of introns for the splitting genes in Puerarialobata.

Table S6. The lengths of introns for the splitting genes in Puerariaethomsonii.

Table S7. k2p genetic distance of protein‐coding region of Puerarialobata and Puerariaethomsonii ≥ 0.1.

Table S8. k2p genetic distance of intergenic/intronic region of Puerarialobata and Puerariaethomsonii ≥ 0.5.

Table S9. SSR statistics of CP genome of Puerarialobata and Puerariaethomsonii.

Table S10. SSR distribution in Puerarialobata CP genome.

Table S11. SSR distribution in Puerariaethomsonii CP genome.

Acknowledgments

This work was supported by Integrated Innovation and Demonstration of Production Technology for Quality Improvement and Effectiveness of Genuine Medicinal Materials (HBHZD—ZB—2020—005). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the article.

Li J, Yang M, Li Y, Jiang M, Liu C, He M, et al. Chloroplast genomes of two Pueraria DC. species: sequencing, comparative analysis and molecular marker development. FEBS Open Bio.2022;12:349–361. 10.1002/2211-5463.13335

Jishuang Li and Meng Yang contributed equally to this work.

Contributor Information

Meijun He, Email: 840940513@qq.com.

Bin Wu, Email: bwu@implad.ac.cn.

Data Accessibility

The CP genomic sequences of P. lobata and P. thomsonii were submitted to GenBank and the IDs MZ901204 and MZ901205 were acquired, respectively. The raw data of DNA sequencing for P. lobata and P. thomsonii were deposited in the NCBI short read archive (SRA) under accession numbers SRR15508061 and SRR15508060, respectively.

References

  • 1. Commission CP. Pharmacopoeia of the People's Republic of China. The Chemical Industry Publishing House; 2020. [Google Scholar]
  • 2. Song W, Li YJ, Qiao X, Qian Y, Ye M. Chemistry of the Chinese herbal medicine Puerariae Radix (Ge‐Gen): a review. J Chin Pharm Sci. 2014;23:347–60. [Google Scholar]
  • 3. Wei SY, Chen Y, Xu XY. Progress on the pharmacological research of puerarin: a review. Chin J Nat Med. 2014;12:407–14. [DOI] [PubMed] [Google Scholar]
  • 4. Lowe ED, Gao G‐Y, Johnson LN, Keung WM. Structure of daidzin, a naturally occurring anti‐alcohol‐addiction agent, in complex with human mitochondrial aldehyde dehydrogenase. J Med Chem. 2008;51:4482–7. [DOI] [PubMed] [Google Scholar]
  • 5. Du G, Zhao HY, Zhang QW, Li GH, Yang FQ, Wang Y, et al. A rapid method for simultaneous determination of 14 phenolic compounds in Radix Puerariae using microwave‐assisted extraction and ultra high performance liquid chromatography coupled with diode array detection and time‐of‐flight mass spectrometry. J Chromatogr A. 2010;1217:705–14. [DOI] [PubMed] [Google Scholar]
  • 6. Li J, Li C, Gou J, Zhang Y. Molecular cloning and functional characterization of a novel isoflavone 3'‐O‐methyltransferase from Pueraria lobata . Front Plant Sci. 2016;7:793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Wang X, Fan R, Li J, Li C, Zhang Y. Molecular cloning and functional characterization of a novel (Iso)flavone 4',7‐O‐diglucoside glucosyltransferase from Pueraria lobata . Front Plant Sci. 2016;7:387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Jiang XH, Liu LK, She CW. Study on classification consistency based on morphology and rDNA ITS sequences of Pueraria species. Hubei Agric Sci. 2016;55:940–42. [Google Scholar]
  • 9. Reddy CK, Fei L, Xu B. Morphology, crystallinity, pasting, thermal and quality characteristics of starches from adzuki bean (Vigna angularis L.) and edible kudzu (Pueraria thomsonii Benth). Int J Biol Macromol. 2017;105(Pt:1):354–62. [DOI] [PubMed] [Google Scholar]
  • 10. Liu C, Liang D, Gao T, Pang X, Song J, Yao H, et al. PTIGS‐IdIt, a system for species identification by DNA sequences of the psbA‐trnH intergenic spacer region. BMC Bioinformatics. 2011;12(Suppl 13):S4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Trobajo R, Mann DG, Clavero E, Evans KM, Vanormelingen P, McGregor RC. The use of partialcox1, rbcL and LSU rDNA sequences for phylogenetics and species identification within theNitzschia paleaspecies complex (Bacillariophyceae). Eur J Phycol. 2010;45:413–25. [Google Scholar]
  • 12. Turenne CY, Sanche SE, Hoban DJ, Karlowsky JA, Kabani AM. Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. J Clin Microbiol. 1999;37:1846–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Jansen RK, Ruhlman TA. Plastid genomes of seed plants. Genomics Chloroplasts Mitochondria. 2012;103–26. [Google Scholar]
  • 14. Parks M, Cronn R, Liston A. Increasing phylogenetic resolution at low taxonomic levels using massively parallel sequencing of chloroplast genomes. BMC Biol. 2009;7:84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Daniell H, Lin CS, Yu M, Chang WJ. Chloroplast genomes: diversity, evolution, and applications in genetic engineering. Genome Biol. 2016;17:134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Biju VC, Shidhi S, Vijayan S, Rajan VS, Sasi A, Janardhanan A, et al. The complete chloroplast genome of Trichopus zeylanicus, and phylogenetic analysis with dioscoreales. Plant Genome. 2019;12:190032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Ye X, Hu D, Guo Y, Sun R. Complete chloroplast genome of Castanopsis sclerophylla (Lindl.) Schott: genome structure and comparative and phylogenetic analysis. PLOS ONE. 2019;14:e0212325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Shi H, Yang M, Mo C, Xie W, Liu C, Wu B, et al. Complete chloroplast genomes of two Siraitia Merrill species: comparative analysis, positive selection and novel molecular marker development. PLoS One. 2019;14:e0226865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Miao XR, Niu JQ, Wang AQ, Wang DB, Fan J. Complete chloroplast genome sequence of Pueraria thomsonii, an important traditional Chinese medicine plant. Mitochondrial DNA Part B. 2019;4:4163–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Stegemann S, Bock R. Experimental reconstruction of functional gene transfer from the tobacco plastid genome to the nucleus. Plant Cell. 2006;18:2869–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single‐cell sequencing. J Comput Biol. 2012;19:455–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Nicolas D, Patrick M, Guillaume S. NOVOPlasty: de novo assembly of organelle genomes from whole genome data. Nucleic Acids Res. 2017;45:e18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Dierckxsens N, Mardulyn P, Smits G. NOVOPlasty: de novo assembly of organelle genomes from whole genome data. Nucleic Acids Res. 2017;45:e18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Krumsiek J, Arnold R, Rattei T. Gepard: a rapid and sensitive tool for creating dotplots on genome scale. Bioinformatics. 2007;23:1026–8. [DOI] [PubMed] [Google Scholar]
  • 26. Sharp PM, Li WH. The codon Adaptation Index–a measure of directional synonymous codon usage bias, and its potential applications. Nucleic Acids Res. 1987;15:1281–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Wyman SK, Jansen RK, Boore JL. Automatic annotation of organellar genomes with DOGMA. Bioinformatics. 2004;20:3252–5. [DOI] [PubMed] [Google Scholar]
  • 28. Liu C, Shi L, Zhu Y, Chen H, Zhang J, Lin X, et al. CpGAVAS, an integrated web server for the annotation, visualization, analysis, and GenBank submission of completely sequenced chloroplast genome sequences. BMC Genom. 2012;13:715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Tillich M, Lehwark P, Pellizzer T, Ulbricht‐Jones ES, Fischer A, Bock R, et al. GeSeq – versatile and accurate annotation of organelle genomes. Nucleic Acids Res. 2017;45:W6–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Lee E, Harris N, Gibson M, Chetty R, Lewiss S. Apollo: a community resource for genome annotation editing. Bioinformatics. 2009;25:1836–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Lowe TM, Eddy SR. tRNAscan‐SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997;25:955–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Greiner S, Lehwark P, Bock R. OrganellarGenomeDRAW (OGDRAW) version 1.3.1: expanded toolkit for the graphical visualization of organellar genomes. Nucleic Acids Res. 2019;47(W1):W59–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Rice P, Longden I, Bleasby A. EMBOSS: the European molecular biology open software suite. Trends Genet. 2000;16:276–7. [DOI] [PubMed] [Google Scholar]
  • 34. Mayor C, Brudno M, Schwartz JR, Poliakov A, Rubin EM, Frazer KA, et al. VISTA: visualizing global DNA sequence alignments of arbitrary length. Bioinformatics. 2000;16:1046–7. [DOI] [PubMed] [Google Scholar]
  • 35. Dubchak I, Ryaboy DV. VISTA family of computational tools for comparative analysis of DNA sequences and whole genomes. Methods Mol Biol. 2006;338:69–89. [DOI] [PubMed] [Google Scholar]
  • 36. Kurtz S, Schleiermacher C. REPuter: fast computation of maximal repeats in complete genomes. Bioinformatics. 1999;15:426–7. [DOI] [PubMed] [Google Scholar]
  • 37. Beier S, Thiel T, Münch T, Scholz U, Mascher M. MISA‐web: a web server for microsatellite prediction. Bioinformatics. 2017;33:2583–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Katoh K, Kuma K, Miyata T, Toh H. Improvement in the accuracy of multiple sequence alignment program MAFFT. Genome Informatics. 2005;16:22–3. [PubMed] [Google Scholar]
  • 39. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30:2725–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Thompson JD, Gibson TJ, Higgins DG. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. 2002; Chapter 2:Unit 2.3. [DOI] [PubMed] [Google Scholar]
  • 41. Lalitha S. Primer premier 5. Biotech Softw Internet Rep. 2000;1:270–72. [Google Scholar]
  • 42. Tan W, Gao H, Zhang H, Yu X, Tian X, Jiang W, et al. The complete chloroplast genome of Chinese medicine (Psoralea corylifolia): Molecular structures, barcoding and phylogenetic analysis. Plant Gene. 2020;21:100216. [Google Scholar]
  • 43. Liu W, Kong H, Zhou J, Fritsch P, Hao G, Gong W. Complete chloroplast genome of cercis chuniana (Fabaceae) with structural and genetic comparison to six species in Caesalpinioideae. Int J Mol Sci. 2018;19:1286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Dong W, Xu C, Cheng T, Lin K, Zhou S. Sequencing angiosperm plastid genomes made easy: a complete set of universal primers and a case study on the phylogeny of saxifragales. Genome Biol Evol. 2013;5:989–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Xie DF, Yu Y, Deng YQ, Li J, Liu HY, Zhou SD, et al. Comparative analysis of the chloroplast genomes of the Chinese endemic genus Urophysa and their contribution to chloroplast phylogeny and adaptive evolution. Int JMol Sci. 2018;19:1847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Sugita M, Sugiura M. Regulation of gene expression in chloroplasts of higher plants. Plant Mol Biol. 1996;32:315–26. [DOI] [PubMed] [Google Scholar]
  • 47. Jansen RK, Raubeson LA, Boore JL. Methods for obtaining and analyzing whole chloroplast genome sequences. Methods Enzymol. 2005;395:348. [DOI] [PubMed] [Google Scholar]
  • 48. Li Y, Zhou J, Chen X, Cui Y, Xu Z, Li Y, et al. Gene losses and partial deletion of small single‐copy regions of the chloroplast genomes of two hemiparasitic Taxillus species. Sci Rep. 2017;7:12834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Chen D, Peng R, Li L, Zhang X, Wang Y. Analysis of genetic relationships of Pueraria thomsonii based on SRAP markers. J China J Chin Mater Med. 2011;36:538–41. [PubMed] [Google Scholar]
  • 50. Gietler M, Nykiel M, Orzechowski S, Fettke J, Zagdańska B. Proteomic analysis of S‐nitrosylated and S‐glutathionylated proteins in wheat seedlings with different dehydration tolerances. Plant Physiol Biochem. 2016;108:507–18. [DOI] [PubMed] [Google Scholar]
  • 51. Baxter RM, White VT, Zahid ND. The modification of the peptidyltransferase activity of 50‐S ribosomal subunits, LiCl‐split proteins and L16 ribosomal protein by pyridoxal phosphate. Eur J Biochem. 1980;110:161–6. [DOI] [PubMed] [Google Scholar]
  • 52. Castillo‐Davis CI, Mekhedov SL, Hartl DL, Koonin EV, Kondrashov FA. Selection for short introns in highly expressed genes. Nat Genet. 2002;31:415–8. [DOI] [PubMed] [Google Scholar]
  • 53. Prachumwat A, DeVincentis L, Palopoli MF. Intron size correlates positively with recombination rate in Caenorhabditis elegans . Genetics. 2004;166:1585–90. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1. Circular Gene map of the complete CP genome of Puerariaethomsonii. Genes drawn inside the circle are the transcribed clockwise, and those on the outside are transcribed counter‐clockwise. The dark gray area in the inner circle corresponds to the GC content, whereas the light gray refers to AT content. LSC: large single copy region, SSC: small single copy region, IRa, IRb: copies of inverted repeat regions.

Table S1. CP genome information for phylogenetic tree construction.

Table S2. Sample information.

Table S3. Annotated genes of CP genome.

Table S4. Different genes in different regions in Pueraria lobata.

Table S5. The lengths of introns for the splitting genes in Puerarialobata.

Table S6. The lengths of introns for the splitting genes in Puerariaethomsonii.

Table S7. k2p genetic distance of protein‐coding region of Puerarialobata and Puerariaethomsonii ≥ 0.1.

Table S8. k2p genetic distance of intergenic/intronic region of Puerarialobata and Puerariaethomsonii ≥ 0.5.

Table S9. SSR statistics of CP genome of Puerarialobata and Puerariaethomsonii.

Table S10. SSR distribution in Puerarialobata CP genome.

Table S11. SSR distribution in Puerariaethomsonii CP genome.

Data Availability Statement

The CP genomic sequences of P. lobata and P. thomsonii were submitted to GenBank and the IDs MZ901204 and MZ901205 were acquired, respectively. The raw data of DNA sequencing for P. lobata and P. thomsonii were deposited in the NCBI short read archive (SRA) under accession numbers SRR15508061 and SRR15508060, respectively.


Articles from FEBS Open Bio are provided here courtesy of Wiley

RESOURCES