Skip to main content
NCBI home page
Iranian Journal of Veterinary Research logoLink to Iranian Journal of Veterinary Research
. 2021 Autumn;22(4):277–287. doi: 10.22099/ijvr.2021.39586.5752

Detection, molecular characterization, and antibiogram of multi-drug resistant and methicillin-resistant Staphylococcus aureus (MRSA) isolated from pets and pet owners in Malaysia

M H Chai 1, M Z Sukiman 1, Y W Liew 2, M S Shapawi 2, F S Roslan 2, S N Hashim 2, N M Mohamad 3, S M Z Ariffin 4, M F Ghazali 5,*
PMCID: PMC8806171  PMID: 35126535

Abstract

Background:

The emergence of multidrug-resistant strains such as methicillin-resistant Staphylococcus aureus (MRSA) and multidrug-resistant Staphylococcus aureus (MDRSA) in animals and humans with continuous contact are a great zoonotic concern.

Aims:

This cross-sectional study was performed to investigate the carriage rate, genotypic characteristics, and to determine the antibiogram of S. aureus isolated from pets and pet owners in Malaysia.

Methods:

Nasal and oral swab samples from 40 cats, 30 dogs, and 70 pet owners were collected through convenient sampling. Presumptive colonies on mannitol salt agar were subjected to biochemical identification. S. aureus and MRSA were confirmed by PCR detection of nuc and mecA genes, respectively. Molecular profiles for antimicrobial resistance and virulence genes in S. aureus were also determined. The antibiogram was carried out via Kirby-Bauer test using 18 antibiotics.

Results:

17.5% of cats, 20% of dogs, and 27% of pet owners were S. aureus positive. MRSA was also detected in dogs, and pet owners. S. aureus isolates displayed high resistance against penicillin (72.7%), and amoxicillin/clavulanate (66.7%). 39.4% of S. aureus isolates showed multidrug-resistance traits, phenotypically. Molecular characterization of S. aureus revealed the presence of mecA, tetk, tetL, ermA, ermB, ermC, msrA, scn, chp, sak, sep, and sea genes.

Conclusion:

This study showed the emergence of MRSA and MDRSA in pets and pet owners in Malaysia. The antibiogram findings showed resistance of S. aureus to multiple antibiotics. Furthermore, molecular analysis of immune evasion cluster (IEC) strongly suggests the spread of animal-adapted S. aureus lineages among pets and pet owners.

Key Words: Antibiogram, Methicillin-resistant Staphylococcus aureus, Multidrug-resistant Staphylococcus aureus, Pet animals, Pet owners

Introduction

Staphylococcus aureus is a Gram-positive bacterium that causes a wide array of infections in both humans and animals. In humans, S aureus is considered to be a major human pathogen in both community and medical settings, causing a variety of diseases ranging from mild skin infections to potentially fatal diseases such as toxic shock syndrome, pneumonia, and endocarditis (Suhaili et al., 2018 ▶; Che Hamzah et al., 2019 ▶). Meanwhile, S. aureus in dogs and cats was previously associated with several clinical conditions, including skin, and wound infections, otitis, conjunctivitis, upper respiratory disease as well as post-surgical infections (Qekwana et al., 2017 ▶; Bierowiec et al., 2019 ▶). Although S. aureus infections are considered to be relatively rare in veterinary settings, domestic animals such as cats and dogs can act as vectors for the direct transmission and colonization of S. aureus in humans and animals (Peacock and Paterson, 2015 ▶).

Recently, the emergence of antimicrobial resistance (AMR) bacteria that are resistant to multiple classes of antibiotics, such as methicillin-resistant S. aureus (MRSA), is a public health threat in both humans and animals (Kanagarajah et al., 2017 ▶). Several previous studies reported the emergence of multidrug-resistance bacterial pathogens from different origins such as pet, livestock, fishes as well as animal products that could be transmitted to humans and cause serious illness (Enany et al., 2018 ▶; Algammal et al., 2020 ▶; Chai et al., 2020 ▶; Miranda et al., 2021 ▶). The widespread of multidrug-resistance pathogenic bacteria in humans and animals often is related to persistent infections, a higher rate of complications incidences, and increase in morbidity and mortality (Kanagarajah et al., 2017 ▶). Previous studies showed that S. aureus often harbors various antimicrobial resistance (AMR) genes, making treatment of staphylococcal infections a great challenge (Lim et al., 2012 ▶; Suhaili et al., 2018 ▶; Che Hamzah et al., 2019 ▶). Furthermore, S. aureus is capable of producing virulence factors that allow the bacterium to evade the immune responses of the host and prevent bacterial elimination (Van Wamel et al., 2006 ▶). Five of these virulence factors commonly found in S. aureus from humans include staphylococcal complement inhibitory protein (SCIN), staphylokinase (SAK), chemotaxis inhibitory protein (CHIPS), staphylococcal enterotoxin type A (SEA), and staphylococcal enterotoxin type P (SEP). These immune modulators are encoded by immune evasion cluster (IEC) comprising of scn, chp, sak, sea, and sep genes (Van Wamel et al., 2006 ▶). In addition, S. aureus is capable of causing severe infections in human through the secretion of toxic shock syndrome toxin 1 (TSST-1) and Panton-Valentine leukocidin )PVL( (Lim et al., 2012 ▶). PVL toxin induces the expression of proinflammatory cytokines and lysing of inflammatory cells, which in turn exaggerate the host inflammatory response while TSST can causes neonatal toxic shock syndrome-like exanthematous disease and staphylococcal Purpura fulminans (Bien et al., 2011 ▶; Lim et al., 2012 ▶).

In Malaysia, the carriage rate, as well as the genotypic characteristics of S. aureus and MRSA isolated from humans in medical and community background, were well studied (Sit et al., 2017 ▶; Suhaili et al., 2018 ▶). However, information on the latest prevalence and antibiogram of S. aureus from pet owners and pets in Malaysia is limited. In addition, the occurrence rates of tetracycline and erythromycin resistance as well as IEC genes in Malaysian pet animals were not previously reported. Therefore, this study aims to investigate the carriage rate, antibiotic susceptibility profile, and genotypic characteristics of S. aureus isolated from both pets and pet owners.

Materials and Methods

Sampling

In the cross-sectional study, a total of 70 pet owners constantly exposed to pet animals were invited to join this research voluntarily. 140 swab samples (70 nasal and 70 oral) were collected from the pet owners using sterile cotton swabs. Besides, swab samples from 70 pet animals (70 nasal and 70 oral swabs), including 30 dogs and 40 cats were also collected. The collected swab samples were kept in transport media under 4°C and transported to Microbiology Laboratory in UniSZA, Besut Campus for further analysis.

Isolation and identification of S. aureus

The swab samples were streaked onto mannitol salt agar (MSA, Oxoid, UK) and incubated at 37°C up to 48 h. Yellow colonies with yellow zones that grew on MSA were suspected to be S. aureus. The suspected S. aureus colonies were then sub-cultured onto nutrient agar (NA, Oxoid, UK) supplemented with 6.5% sodium chloride (NaCl) and incubated at 37°C for 24 overnight. The bacterial colonies that grew on NA were then subjected to DNA extraction using heat lysis method as described by Suhaili et al. (2018) ▶. The extracted DNAs were kept in -20°C prior to polymerase chain reaction (PCR). PCR was carried out to screen the presence of the nuc gene of S. aureus and mecA gene of MRSA using the primers and protocol described by Saiful et al. (2006) ▶. Bacteria isolates with the presence of DNA bands of 278 bp were S. aureus, while isolates with both nuc and mecA (533 bp) genes were identified as MRSA.

Antimicrobial susceptibility test (AST)

The antimicrobial susceptibility profile of S. aureus isolated from swab samples of pet owners, cats, and dogs in Peninsular Malaysia were determined using the Kirby-Bauer test on Mueller-Hinton agar (Oxoid, UK), according to the Clinical and Laboratory Standards Institute (CLSI). S. aureus isolated from pets and pet owners were first suspended in sterile Mueller-Hinton broth (Oxoid, UK) adjusted to a 0.5 McFarland standard. The bacterial isolate in the broth was then streaked on Mueller-Hinton agar (Oxoid, UK) plates. Selected antibiotic disks listed in Table 1 were placed on the streaked Mueller-Hinton agar plates and incubated at 37°C up to 24 h. The diameter of inhibition zones of each isolate was measured and compared to the antibiotic susceptibility breakpoints according to CLSI (2018). Antibiotics commonly used to treat staphylococcal infections in humans and animals were selected in this test. S. aureus ATCC 700699 was used as the control strain for the AST test. For the screening of cefoxitin-resistant S. aureus, 30 μg of cefoxitin discs (Oxoid, UK) were tested against isolated S. aureus. Cefoxitin-resistance S. aureus were considered to be MRSA, phenotypically. S. aureus resistant to at least one antibiotic, from three or more antimicrobial categories, are classified as multidrug-resistant S. aureus (MDRSA) as suggested by Magiorakos et al. (2012) ▶.

Table 1.

The antibiogram of MRSA from dogs and pet owners (n=3)

Isolates Antimicrobials Disk potency Number of isolates (%)
Resistant Intermediate Sensitive
MRSA (n=3) Penicillin 10 units 3 (100) 0 (0) 0 (0)
Amoxicillin/clavulanate 10 µg 3 (100) 0 (0) 0 (0)
Norfloxacin 10 µg 3 (100) 0 (0) 0 (0)
Oxacillin 1 µg 3 (100) 0 (0) 0 (0)
Cefoxitin 30 µg 3 (100) 0 (0) 0 (100)
Erythromycin 15 µg 2 (66.7) 0 (0) 1 (33.3)
Tetracycline 30 µg 2 (66.7) 0 (0) 1 (33.3)
Cephalothin 30 µg 1 (33.3) 0 (0) 2 (66.7)
Chloramphenicol 30 µg 1 (33.3) 0 (0) 2 (66.7)
Clindamycin 2 µg 1 (33.3) 0 (0) 2 (66.7)
Doxycycline 30 µg 1 (33.3) 0 (0) 2 (66.7)
Cefotaxime 30 µg 0 (0) 2 (66.7) 1 (33.3)
Amikacin 30 µg 0 (0) 0 (0) 3 (100)
Ciprofloxacin 5 µg 0 (0) 0 (0) 3 (100)
Gentamicin 30 µg 0 (0) 0 (0) 3 (100)
Linezolid 30 µg 0 (0) 0 (0) 3 (100)
Quinupristin/Dalfopristin 15 µg 0 (0) 0 (0) 3 (100)
Trimethoprim/sulfamethoxazole 25 µg 0 (0) 0 (0) 3 (100)
Open in a new tab

Detection of antimicrobial resistance and virulence genes

S. aureus and MRSA isolates were further screened using PCR to detect the presence of various antimicrobial resistance genes, including methicillin-resistant genes (mecA, mecB, and mecC), tetracycline-resistant (tetK, tetL, tetM, and tetO), erythromycin-resistant (ermA, ermB, ermC, and msrA), and vancomycin-resistant (vanA). S. aureus isolates harboring mecA, mecB, and mecC genes were considered to be MRSA. In addition, the presence of virulence determinants, including tst, lukPV, and IEC gene cluster (scn, chp, sak, sea, and sep), among the S. aureus isolates have also been investigated using PCR. S. aureus ATCC 700699 was used as the positive control for nuc and mecA genes detection. The primer sequences and their band sizes are shown in Table 3. In regard to IEC genes, S. aureus isolates were later classified into 8 different IEC types as described by (Ariyarad et al., 2019 ▶). The presence of scn gene is mandatory for the consideration of the IEC types (Van Wamel et al., 2006 ▶).

Table 3.

Primer sequences used for the detection of antimicrobial and virulence genes in S. aureus

No. Primers Primer sequence (5´-3´) Amplicon band size (bp) Accession number Reference
1 nuc F: GCGATTGATGGTGATACGGTT
R: AGCCAAGCCTTGACGAACTAAAGC		 278 MN704287
2 mecA F: AAAATCGATGGTAAAGGTTGG
R: AGTTCTGCAGTACCGGATTTG		 533 NG_047945
3 mecB F: TTAACATATACACCCGCTTG
R: TAAAGTTCATTAGGCACCTCC		 2264 MK422159
4 mecC F: GAAAAAAAGGCTTAGAACGCCTC
R: GAAGATCTTTTCCGTTTTCAGC		 138 NG_047955
5 ermA F: GTTCAAGAACAATCAATACAGAG
R: GGATCAGGAAAAGGACATTTTAC		 421 MG778116
6 ermB F: CCGTTTACGAAATTGGAACAGGTAAAGGGC
R: GAATCGAGACTTGAGTGTGC		 359 LC146993
7 ermC F: GCTAATATTGTTTAAATCGTCAATTCC
R: GGATCAGGAAAAGGACATTTTAC		 572 MG787087
8 msrA F: GGCACAATAAGAGTGTTTAAAGG
R: AAGTTATATCATGAATAGATTGTCCTGTT		 940 X52085
9 tetK F: TCGATAGGAACAGCAGTA
R: CAGCAGATCCTACTCCTT		 169 KR362247
10 tetL F: TCGTTAGCGTGCTGTCATTC
R: GTATCCCACCAATGTAGCCG		 267 JN970906
11 tetM F: GTGGACAAAGGTACAACGAG
R: CGGTAAAGTTCGTCACACAC		 406 AY057894
12 tetO F: AACTTAGGCATTCTGGCTCAC
R: TCCCACTGTTCCATATCGTCA		 515 KC915030
13 vanA F: ATGAATAGAATAAAAGTTGC
R: TCACCCCTTTAACGCTAATA		 1032 MG592387
14 scn F: AGCACAAGCTTGCCAACATCG
R: TTAATATTTACTTTTTAGTGC		 258 MF185201
15 sak F: AAGGCGATGACGCGAGTTAT
R: GCGCTTGGATCTAATTCAAC		 223 EF122253
16 sea F: AGATCATTCGTGGTATAACG
R: TTAACCGAAGGTTCTGTAGA		 408 MT906848
17 sep F: AATCATAACCAACCGAATCA
R: TCATAATGGAAGTGCTATAA		 500 EF534985
18 chp F: GAAAAAGAAATTAGCAACAACAG
R: CATAAGATGATTTAGACTCTCC		 410 MF185201
19 lukPV F: ATCATTAGGTAAAATGTCTGGACATGATCCA
R: GCATCAASTGTATTGGATAGCAAAAGC		 433 MK975993
20 tst F: TTATCGTAAGCCCTTTGTTG
R: TAAAGGTAGTTCTATTGGAGTAGG		 398 MT906812 Zarizal et al. (2018)
Open in a new tab

Statistical analysis

The occurrence rates of the different genes were counted and presented in percentages (%.) Categorical data were analysed and compared using Chi-square and Fisher’s exact test (Minitab 19, 2019) with a 95% confidence interval (P<0.05) was set to indicate the significant difference. The antibiotic resistance rate was calculated as the proportion of the isolates having an inhibition zone below the respective antibiotic breakpoint. The relationships between antibiotic exposure and overall antibiotic resistance in S. aureus isolates were assessed using a multiple antimicrobial resistance index (MARI). MARI was calculated as the proportion of antibiotics tested to which the isolate was phenotypically resistant. A dendrogram was generated via Unweighted Pair Group Method with Arithmetic Mean (UPGMA) method using BioNumerics version 8.0 software (Applied Maths, Texas) to visualize the relatedness between S. aureus isolates based on their phenotypic antibiotic resistance profile.

Ethics approval

Written informed consent was obtained from each pet owner before obtaining swabs samples. The study and method for sampling of pet owners were approved by the University Sultan Zainal Abidin Human Research Ethnic Committee (UHREC) with protocol code: UniSZA/UHREC/2019/85. The study and method of sampling involving pet animals were approved by the University Sultan Zainal Abidin Animal and Plant Research Ethnic Committee (UAPREC) with Protocol code: UAPREC/04/18/006.

Results

The presence of S. aureus and MRSA

After nuc gene (Fig. 1) detection, 20 (28.5%; 20/70) pet owners were found carrying S. aureus, while the carriage rates of S. aureus in cats and dogs were 17.5% (7/40), and 20% (6/30), respectively. Screening of mecA gene (Fig. 2) revealed that three (9.1%; 3/33) of the S. aureus isolates were MRSA of which one belonged to the pet owner (1.4%; 1/70) and another two were from dogs (6.7%; 2/30). MRSA was not detected in cat samples.

Fig. 1.

Fig. 1

Open in a new tab

Representative agarose gel electrophoresis image of nuc gene (278 bp). Lane M+: 100 bp DNA markers, and Lane C: Positive control (ATCC700699)

Fig. 2.

Fig. 2

Open in a new tab

Representative agarose gel electrophoresis image of mecA gene (533 bp). Lane M+: 100 bp DNA markers, and Lane C: Positive control (ATCC700699)

Antibiotic susceptibility test (AST)

AST results for both MRSA and S. aureus are summarized in Table 1 and Table 4, respectively. Kirby-Bauer test revealed that S. aureus isolates of pets and pet owners were highly resistant against penicillin (72.7; 24/33), followed by amoxicillin/clavulanate (66.7; 22/33) and oxacillin (60.6; 20/33). 27% of the isolates showed cefoxitin-resistance and were considered to be MRSA, phenotypically. Nonetheless, the S. aureus isolates were fully susceptible to gentamicin and ciprofloxacin. On the other hand, mecA gene-positive MRSA was fully resistant (100% resistant) against penicillin, amoxicillin/clavulanate, norfloxacin, cefoxitin, and oxacillin. Meanwhile, three of the mecA-positive MRSA isolates were susceptible to amikacin, ciprofloxacin, gentamicin, linezolid, quinupristin/dalfopristin, and trimethoprim/sulfamethoxazole. S. aureus from humans tend to be more resistant against penicillin and amoxicillin/clavulanate compared to isolates from cats and dogs (P<0.05). 87.8% (29/33) of S. aureus isolates from humans and pets were resistant to at least one antibiotic. Furthermore, 13 S. aureus isolates were confirmed to be MDRSA as they were resistant to agents from 3 and above the different classes of antibiotics. All MDRSA were also found to have a multiple antimicrobial resistance index (MARI) of 2.0 and above, suggesting the isolates originated from an environment with high antibiotic usage (Table 5). Figure 3 shows the dendrogram illustrating relatedness between S. aureus isolates from cats, dogs, and pet owners based on their phenotypic antibiotic resistance profile.

Table 4.

The antibiogram of S. aureus from pets and pet owners (n=33)

Isolates Antimicrobials Disk potency Number of isolates (%)
Resistant Intermediate Sensitive
S. aureus (n=33) Penicillin 10 units 24 (72.7) 0 (0) 9 (27.3)
Amoxicillin/clavulanate 10 µg 22 (66.7) 0 (0) 11 (33.3)
Oxacillin 1 µg 20 (60.6) 0 (0) 13 (39.4)
Erythromycin 15 µg 12 (36.4) 2 (6.1) 19 (57.5)
Clindamycin 2 µg 10 (30.3) 3 (9.1) 20 (60.6)
Cefoxitin 30 µg 9 (27.3) 0 (0) 24 (72.7)
Quinupristin/Dalfopristin 15 µg 7 (21.2) 0 (0) 26 (78.8)
Cephalothin 30 µg 6 (18.2) 0 (0) 27 (81.8)
Tetracycline 30 µg 5 (15.2) 1 (3.0) 27 (81.8)
Cefotaxime 30 µg 3 (9.1) 6 (18.2) 24 (72.7)
Linezolid 30 µg 3 (9.1) 0 (0) 30 (90.9)
Norfloxacin 10 µg 2 (6.1) 0 (0) 31 (93.9)
Chloramphenicol 30 µg 1 (3.0) 2 (6.1) 30 (90.9)
Doxycycline 30 µg 1 (3.0) 1 (3.0) 31 (94.0)
Trimethoprim/sulfamethoxazole 25 µg 0 (0) 1 (3.0) 32 (97.0)
Amikacin 30 µg 0 (0) 2 (6.1) 31 (94.0)
Gentamicin 30 µg 0 (0) 0 (0) 33 (100)
Ciprofloxacin 5 µg 0 (0) 0 (0) 33 (100)
Open in a new tab

Table 5.

Multiple antibiotic resistance index (MARI) of S. aureus

Number of antibiotic Number of isolates Total (%) MARI
0 4 12.1 0
1 4 12.1 0.05
2 6 18.2 0.11
3 6 18.2 0.16
4 2 6.1 0.21
5 1 3.0 0.26
6 and above 10 30.3 0.32 and above
Open in a new tab

Fig. 3.

Fig. 3

Open in a new tab

Dendrogram of relatedness based on antibiogram of S. aureus. Black columns represent resistance, and dark grey columns represent intermediate resistance, while light grey columns represent antibiotic susceptibility

Detection of antimicrobial resistance and virulence genes

The number of antimicrobial resistance and virulence genes detected from both pets and pet owners is summarized in Table 6. The mecA genes (9.1%; 3/33) were detected from the S. aureus isolates, with the absence of mecB and mecC genes. For tetracycline resistance genes, only tetK and tetL genes (9.1%; 3/33) were detected from both humans and animals S. aureus isolates. Meanwhile, all four erythromycin resistance genes were detected from the 33 S. aureus isolates, with ermB, the prominent gene (15.2%; 5/33). None of tetM, tetO, and vanA genes were detected. In regards to virulence genes, high prevalence rates of scn (48.5%), and sak (45.5%) were detected from the S. aureus as demonstrated by Fig. 4. Six S. aureus carried chp (18.2%), while one isolate from dog harbored sep gene (3.3%). Eleven S. aureus isolates (35.0% of humans, and 30.1% of animal isolates) did not carry any IEC genes. A total of sixteen S. aureus harbored scn gene and thus, can be categorised into IEC types (Table 7). The predominant IEC type in this study was type E (7 isolates). Six S. aureus isolates (3 pet owners, and 3 pets) could not be categorised into any IEC types due to the absence of scn gene. No vanA, tst, luk-PV, and sea genes were detected from any of the S. aureus isolates. The antibiotic resistance pattern and genotypic profile of MDRSA isolates were summarized in Table 2.

Table 6.

Prevalence rate of antimicrobial resistance and virulence genes in S. aureus (n=33)

Genes S. aureus (n=33)
Number of genes in pet owners (n=20) (%) Number of genes in dog and cats (n=13) (%) Total number of genes (%)
Antimicrobial resistance genes
mecA 1 (5.0) 2 (10.0) 3 (9.1)
mecB 0 (0) 0 (0) 0 (0)
mecC 0 (0) 0 (0) 0 (0)
tetM 0 (0) 0 (0) 0 (0)
tetK 1 (5.0) 2 (10.0) 3 (9.1)
tetL 2 (10.0) 1 (7.8) 3 (9.1)
tetO 0 (0) 0 (0) 0 (0)
ermA 1 (10.0) 1 (7.7) 2 (6.0)
ermB 3 (15.0) 2 (15.4) 5 (15.2)
ermC 3 (15.0) 3 (23.10) 6 (18.2)
msrA 2 (10.0) 0 (0) 1 (3.0)
vanA 0 (0) 0 (0) 0 (0)
Virulence genes
tst 0 (0) 0 (0) 0 (0)
luk-PV 0 (0) 0 (0) 0 (0)
scn 9 (45.0) 8 (61.5) 17 (51.1)
sak 12 (60.0) 5 (25.0) 17 (51.1)
chp 4 (20.0) 3 (15) 7 (21.2)
sea 0 (0) 1 (7.7) 1 (3.0)
sep 0 (0) 1 (7.7) 1 (3.0)
Open in a new tab

Fig. 4.

Fig. 4

Open in a new tab

Representative agarose gel electrophoresis image of IEC genes (scn gene at 258 bp, chp gene at 410 bp and sak gene at 223 bp). M+: 100 bp DNA markers

Table 7.

Summary of IEC types of S. aureus from pets and pet owners (n=33)

IEC type IEC genes composition S. aureus isolates (n=33) Total number of isolates (%)
Pet owners (n=20) Pets (n=13)
A scn, chp, sak, sea 0 0 0 (0)
B scn, chp, sak 3 0 3 (9.1)
C scn, chp 0 1 1 (3.0)
D scn, sak, sea 0 0 0 (0)
E scn, sak 5 2 7 (21.2)
F scn, chp, sak, sep 1 0 1 (3.0)
G scn, sak, sep 0 0 0 (0)
H Scn 1 3 4 (12.1)
Non-typeable Absent of scn gene 3 3 6 (18.2)
No type Absent of all IEC genes 7 4 11 (33.3)
Total 20 13 33 (100)
Open in a new tab

Table 2.

The distribution of the multi-drug resistance patterns, antimicrobial resistance genes, and virulence genes among the MDRSA strains (n=13)

No. Phenotypic resistance pattern Antimicrobial resistance genes Virulence genes
1 AMC-P-OX-FOX-E-NOR mecA scn
2 AMC-P-FOX-KF-TE-E-DA-LZD mecA, tetL, ermB scn, sep
3 AMC-P-OX-TE-E-C tetK, ermB scn
4 AMC-QD-CTX-FOX-KF-DA-E-LZD-P ermA, ermC scn, chp
5 AMC-CTX-FOX-KF-DA-E-LZD-P ermA, ermC scn
6 AMC-DO-NOR-OX-P-TE mecA, tetK scn, sak
7 AMC-QD-FOX-DA-E-OX-P ermB scn
8 AMC-QD-FOX-KF-DA-E-OX-P-TE tetL, ermA, msrA -
9 P-E-TE tetK, ermC -
10 AMC-CTX-FOX-DA-E-OX-P ermC scn, chp, sak
11 AMC-QD-FOX-KF-DA-E-OX-P ermC -
12 AMC-QD-FOX-KF-DA-E-OX-P msrA -
13 AMC-QD-FOX-DA-E-OX-P ermB scn, sak
Open in a new tab

Discussion

The existence of zoonotic bacteria is a reason for concern owing to their capability of resistance against multiple antibiotics among animals and their human handlers. This study demonstrated the presence of AMR strains of S. aureus, particularly MRSA and MDRSA in both pets and pet owners in Malaysia, highlighting the possibilities of further outspread and transmission of such bacteria in the coming future. In the present study, the carriage rates of S. aureus among pet owners and pets are slightly higher compared to previous studies (Boost et al., 2008 ▶; Walther et al., 2012 ▶; Van Balen et al., 2017 ▶). Meanwhile, both cefoxitin resistant test and PCR detection confirmed the MRSA isolates in dog and pet owners. In Malaysia, multiple previous studies have reported the presence of MRSA in pet animals and pet handlers from different settings with the carriage rate ranging from 1.9% to 30% (Saleha et al., 2006 ▶; Ahmad et al., 2009 ▶; Saleha and Zunita, 2010 ▶; Aklilu et al., 2012 ▶; Aklilu et al., 2013 ▶; Kanagarajah et al., 2017 ▶). The main differences in carriage rates may be due to different sampling sizes, years, and geographical factors. In addition, different detection methods, phenotypic or genotypic methods, may also affect the prevalence rate of MRSA. In this study, the cefoxitin disc diffusion (phenotypic) method and PCR (genotypic) detection of methicillin-resistant genes were used to identify the presence of MRSA. Indeed, the cefoxitin disc diffusion test showed a higher prevalence rate of MRSA compared to PCR assay. However, the absence of mecA gene within cefoxitin-resistant staphylococcal isolates was previously reported (Kandel et al., 2020 ▶). Although the expression of mecA gene is considered to be an important mechanism for the expression of methicillin resistance in S. aureus, other mechanisms such as hyperproduction of beta-lactamase and alterations of amino acids of protein binding protein cascade (PBPs 1, 2, and 3) by S. aureus could be the basis of beta-lactam resistance (Kandel et al., 2020 ▶). Furthermore, the expression of cefoxitin resistance may also be affected by variants such as differences in types of medium, inoculums size, temperature, and sodium chloride concentration in the medium (Kandel et al., 2020 ▶).

The development of antimicrobial resistance in microorganisms is nearly always the result of repeated therapeutic or indiscriminate use of antibiotics (Ariffin et al., 2019 ▶). More than often, antibiotic resistance in bacteria is acquired through the transfer of antimicrobial resistance genes (Nicolaou and Rigol, 2018 ▶). Therefore, it is possible to foresee that S. aureus isolates resistant against commonly used antibiotics such as penicillin, tetracycline, and erythromycin carry resistance genes encoding the production of defensive enzymes, efflux pumps, or ribosomal protection mechanisms (Vyletělova et al., 2011 ▶; Foster, 2017 ▶). Indeed, further genotypic detection of antimicrobial resistance genes revealed the presence of several antibiotic resistance genes, where the majority of the genes were detected from MDRSA. The presence of such a wide variety of AMR genes in S. aureus isolated from pets and pet owners alarms that these genes can be transmitted to new clones or other bacteria, causing the further emergence of multidrug-resistant strains (Zehra et al., 2017 ▶). Nonetheless, all MDR isolates were fully susceptible to gentamicin and ciprofloxacin, suggesting that these two antibiotics can be used to treat persistent S. aureus infections in pets and pet owners in Malaysia. However, the usage of gentamicin and ciprofloxacin should be strictly regulated as they are critically important antibiotics by the World Health Organization (Collignon et al., 2016 ▶). In addition, further investigations involving more isolates of S. aureus from pets and their owners with different environmental exposures should be carried out to gain more insightful data on the antibiogram of the bacteria.

Immune evasion virulence factor is one of the important virulence factors produced by S. aureus that aid the survival of the pathogens in the human host. Past studies have mentioned the importance of IEC genes in disrupting or inhibiting the normal function of the human immune system as well as causing food poisoning (Rooijakkers et al., 2005 ▶; Van Wamel et al., 2006 ▶). In the current study, the prevalence rate of IEC genes among pet handlers was lower than in previous studies (Van Wamel et al., 2006 ▶; Verkaik et al., 2011 ▶; Ariyarad et al., 2019 ▶). The low prevalence of IEC positive S. aureus isolates in this research may be due to different samples origin. Cuny et al. (2015) ▶ suggested that IEC genes are highly specific to humans and the absence of scn gene is a strong indicator for animal-derived strains. Thus, S. aureus isolate colonizing the pet owners may originate from pets or other animals. Similar findings are also reported where the majority of S. aureus isolates from individuals with constant exposure to animals lacked IEC genes (Hau et al., 2015 ▶; You et al., 2018 ▶). Interestingly, some of MDRSA from pets carried IEC genes, highlighting the possibilities of transmission of S. aureus from humans to animals. The predominant IEC type in this study is type E (seven isolates) similar to the study of Ariyarad et al. (2019) ▶. Nonetheless, multiple studies have reported that type B was the predominant IEC type (Van Wamel et al., 2006 ▶; Verkaik et al., 2011 ▶; Hau et al., 2015 ▶; Ahmadrajabi et al., 2017 ▶). These findings suggest that there are variations in IEC types among S. aureus isolated from different geographical regions (Ariyarad et al., 2019 ▶). In addition, all S. aureus isolates, including MRSA found in this study were negative for the luk-PV and tst genes coding PVL, and TSST. Our finding is similar to the results by Köck et al. (2009) ▶, and Neela et al. (2009) ▶ that they reported the absence of PVL and TSST encoding genes among MRSA isolates. However, Rankin et al. in 2005 reported the presence of PVL encoding genes among MRSA isolated from dogs in the USA. Huang and Chou (2019) ▶ also reported the tst gene-positive MRSA isolated from dogs in Taiwan.

In conclusion, this study demonstrates the presence of S. aureus and MRSA in both pets and pet owners in Peninsular Malaysia. 39.3% of S. aureus were considered to be MDRSA, suggesting the emergence of multidrug-resistance S. aureus in both human and pet owners, in this study. The isolated S. aureus showed the highest resistance rate against penicillin, but was fully susceptible to gentamicin and ciprofloxacin. Furthermore, S. aureus isolates carry several antibiotic resistance genes which may cause the further establishment of antimicrobial resistance in bacteria from pets and pet owners. However, the isolates were found to be less pathogenic as they carry a relatively low number of tested virulence genes. Nonetheless, the screening of IEC genes in this research suggests the spread of animal-adapted S. aureus lineages among pets and pet owners. Due to the rapid emergence of multidrug-resistant strains observed in both animals and humans, coordinated antibiotic stewardship programs, and continuous surveillance on the development of AMR patterns in S. aureus are highly recommended in order to determine the suitable antibiotics for successful treatment.

Conflict of interest

None of the authors have any potential conflict of interest to declare.

Acknowledgements

The authors thank the Ministry of Higher Education, Malaysia for funding this study via the Research Acculturation Grant Scheme (RAGS) (Project code: RAGS/1/2015/SG0/UNISZA/02/1). Special thanks to the Department of Veterinary Services, Malaysia.

References

  1. Abolghait SK, Fathi AG, Youssef FM, Algammal AM. Methicillin-resistant Staphylococcus aureus (MRSA) isolated from chicken meat and giblets often produces staphylococcal enterotoxin B (SEB) in non-refrigerated raw chicken livers. Int. J. Food Microbiol. 2020;328:1–9. doi: 10.1016/j.ijfoodmicro.2020.108669. [DOI] [PubMed] [Google Scholar]
  2. Ahmad N, Ruzan IN, Ghani MKA, Hussin A, Nawi S, Aziz MN, Maning N, Eow VLK. Characteristics of community- and hospital-acquired meticillin-resistant Staphylococcusaureus strains carrying SCCmec type IV isolated in Malaysia. J. Med. Microbiol. 2009;58:1213–1218. doi: 10.1099/jmm.0.011353-0. [DOI] [PubMed] [Google Scholar]
  3. Ahmadrajabi R, Khavidaki SL, Kalantar-Neyestanaki D, Fasihi Y. Molecular analysis of immune evasion cluster (IEC) genes and intercellular adhesion gene cluster (ICA) among methicillin-resistant and methicillin-sensitive isolates of Staphylococcusaureus. J. Prev. Med. Hyg. 2017;58:E308–E314. doi: 10.15167/2421-4248/jpmh2017.58.4.711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Aklilu E, Zakaria Z, Hassan L, Chen HC. Molecular relatedness of methicillin-resistant aureus isolates from staff, environment and pets at university veterinary hospital in Malaysia. PLoS One. 2012;7:e43329. doi: 10.1371/journal.pone.0043329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Aklilu E, Zakaria Z, Hassan L, Chen HC. Molecular epidemiology of methicillin-resistant Staphylococcusaureus (MRSA) among veterinary students and personnel at a veterinary hospital in Malaysia. Vet. Microbiol. 2013;164:352–358. doi: 10.1016/j.vetmic.2013.02.030. [DOI] [PubMed] [Google Scholar]
  6. Algammal AM, El-Sayed ME, Youssef FM, Saad SA, Elhaig MM, Batiha GE, Hozzein WN, Ghobashy MO. Prevalence, the antibiogram and the frequency of virulence genes of the most predominant bacterial pathogens incriminated in calf pneumonia. AMB Express. 2020;10:1–8. doi: 10.1186/s13568-020-01037-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ariffin MF, Hasmadi N, Chai MH, Ghazali MF, Ariffin SMZ. Prevalence and antimicrobial sensitivity pattern of Staphylococcusaureus isolated from clinical and subclinical mastitis in small ruminant in Besut and Setiu, Terengganu, Malaysia. Malays. J. Microbiol. 2020;16:104–110. [Google Scholar]
  8. Ariffin SM, Hasmadi N, Syawari NM, Sukiman MZ, Ariffin MFT, Chai MH, Ghazali MF. Prevalence and antibiotic susceptibility pattern of Staphylococcusaureus, Streptococcusagalactiae and Escherichiacoli in dairy goats with clinical and subclinical mastitis. J. Anim. Health Prod. 2019;7:32–37. [Google Scholar]
  9. Ariyarad S, Rezatofighi SE, Motamedi H. Evaluation of antimicrobial resistance and immune evasion cluster genes in clinical methicillin-resistant Staphylococcusaureus (MRSA) isolates from Khuzestan Province, Iran. Epidemiol. Infect. 2019;5:7–14. [Google Scholar]
  10. Becker K, Van Alen S, Idelevich EA, Schleimer N, Seggewiß J, Mellmann A, Kaspar U, Peters G. Plasmid-encoded transferable mecB-mediated methicillin resistance in Staphylococcusaureus. Emerg. Infect. Dis. 2018;24:242–248. doi: 10.3201/eid2402.171074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Bien J, Sokolova O, Bozko P. Characterization of virulence factors of Staphylococcusaureus: Novel function of known virulence factors that are implicated in activation of airway epithelial proinflammatory response. J. Pathog. 2011;2011:1–13. doi: 10.4061/2011/601905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Bierowiec K, Korzeniowska-Kowal A, Wzorek A, Rypuła K, Gamian A. Prevalence of Staphylococcus species colonization in healthy and sick cats. BioMed. Res. Int. 2019;2019:1–10. doi: 10.1155/2019/4360525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Boost MV, O’Donoghue M, James A. Investigation of the role of dogs as reservoirs of Staphylococcusaureus and the transmission of strains between pet owners and their dogs. Hong Kong Med. J. 2008;14:15–18. [PubMed] [Google Scholar]
  14. Chai MH, Arrifin MFT, Ariffin SMZ, Suhaili Z, Sukiman MZ, Ghazali MF. Prevalence of methicillin-resistant Staphylococcusaureus in raw goat milks from selected farms in Terengganu, Malaysia. Trop. Anim. Sci. J. 2020;43:64–69. [Google Scholar]
  15. Che Hamzah AM, Yeo CC, Puah SM, Chua KH, Chew CH. Staphylococcusaureus infections in Malaysia: A review of antimicrobial resistance and characteristics of the clinical isolates, 1990-2017. Antibiotics. 2019;8:1–29. doi: 10.3390/antibiotics8030128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Collignon PJ, Conly JM, Andremont A, McEwen SA, Aidara-Kane A. World Health Organization ranking of antimicrobials according to their importance in human medicine: a critical step for developing risk management strategies to control antimicrobial resistance from food animal production. Clin. Infect. Dis. 2016;63:1087–1093. doi: 10.1093/cid/ciw475. [DOI] [PubMed] [Google Scholar]
  17. Corona F, Martinez JL. Phenotypic resistance to antibiotics. Antibiotics. 2013;2:237–255. doi: 10.3390/antibiotics2020237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Cuny C, Abdelbary M, Layer F, Werner G, Witte W. Prevalence of the immune evasion gene cluster in Staphylococcusaureus CC398. Vet. Microbiol. 2015;177:219–223. doi: 10.1016/j.vetmic.2015.02.031. [DOI] [PubMed] [Google Scholar]
  19. De Haas CJC, Veldkamp KE, Peschel A, Weerkamp F, Van Wamel WJB, Heezius ECJM, Poppelier MJJG, Van Kessel KPM, Van Strijp JAG. Chemotaxis inhibitory protein of Staphylococcusaureus, a bacterial antiinflammatory Agent. J. Exp. Med. 2004;199:687–695. doi: 10.1084/jem.20031636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Enany ME, Algammal AM, Shagar GI, Hanora AM, Elfeil WK, Elshaffy NM. Molecular typing and evaluation of Sidr honey inhibitory effect on virulence genes of MRSA strains isolated from catfish in Egypt. Pak. J. Pharma. Sci. 2018;31:1865–1870. [PubMed] [Google Scholar]
  21. Foster TJ. Antibiotic resistance in Staphylococcusaureus Current status and future prospects. FEMS Microbiol. Rev. 2017;41:430–449. doi: 10.1093/femsre/fux007. [DOI] [PubMed] [Google Scholar]
  22. Ghanbari F, Ghajavand H, Havaei R, Jami MS, Khademi F, Heydari L, Shahin M, Havaei S. Distribution of erm genes among Staphylococcusaureus isolates with inducible resistance to clindamycin in Isfahan, Iran. Adv. Biomed. Res. 2016;5:1–5. doi: 10.4103/2277-9175.179184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Gómez-Sanz E, Torres C, Lozano C, Zarazaga M. High diversity of Staphylococcusaureus and Staphylococcuspseudintermedius lineages and toxigenic traits in healthy pet-owning household members Underestimating normal household contact? Comp. Immunol. Microbiol. Infect. Dis. 2013;36:83–94. doi: 10.1016/j.cimid.2012.10.001. [DOI] [PubMed] [Google Scholar]
  24. Hau SJ, Sun J, Davies PR, Frana TS, Nicholson TL. Comparative prevalence of immune evasion complex genes associated with β-hemolysin converting bacteriophages in mrsa st5 isolates from swine, swine facilities, humans with swine contact, and humans with no swine contact. PLoS One. 2015;10:1–13. doi: 10.1371/journal.pone.0142832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Holmes A, Ganner M, McGuane S, Pitt TL, Cookson BD, Kearns AM. Staphylococcusaureus isolates carrying panton-valentine leukocidin genes in England and Wales: Frequency, characterization, and association with clinical disease. J. Clin. Microbiol. 2005;43:2384–2390. doi: 10.1128/JCM.43.5.2384-2390.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Huang T, Chou C. Methicillin-sensitive and methicillin-resistant Staphylococcus aureus strains and their toxin genes in the nostrils of dogs and workers at an animal shelter. J. Appl. Microbiol. 2019;126:1899–1909. doi: 10.1111/jam.14266. [DOI] [PubMed] [Google Scholar]
  27. Kanagarajah RR, Lee DCW, Lee DZF, Yusoff K, Paramasivam SJ, Low WY, Jeevaratnam K, Lim SHE. Antibiotic profiling of Methicillin-Resistant Staphylococcusaureus (MRSA) isolates in stray canines and felines. Cogent Biol. 2017;3:1–10. [Google Scholar]
  28. Kandel SN, Adhikari N, Dhungel B, Shrestha UT, Angbuhang KB, Karki G, Adhikari B, Banjara MR, Rijal KR andGhimire P. Characteristics of Staphylococcusaureus isolated from clinical specimens in a tertiary care hospital, Kathmandu, Nepal. Microbiol. Insights. 2020;13:1–6. doi: 10.1177/1178636120972695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Köck R, Harlizius J, Bressan N, Laerberg R, Wieler LH, Witte W, Deurenberg RH, Voss A, Becker K, Friedrich AW. Prevalence and molecular characteristics of Methicillin-Resistant Staphylococcusaureus (MRSA) among pigs on German farms and import of livestock-related MRSA into hospitals. Eur. J. Clin. Microbiol. Infect. Dis. 2009;28:1375–1382. doi: 10.1007/s10096-009-0795-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lim KT, Yeo CC, Suhaili Z, Thong KL. Comparison of methicillin-resistant and methicillin-sensitive Staphylococcusaureus strains isolated from a tertiary hospital in Terengganu, Malaysia. Jpn. J. Infect. Dis. 2012;65:502–509. doi: 10.7883/yoken.65.502. [DOI] [PubMed] [Google Scholar]
  31. Lina G, Piémont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, Vandenesch F, Etienne J. Involvement of Panton-Valentine leukocidin-producing Staphylococcusaureus in primary skin infections and pneumonia. Clin. Infect. Dis. 1999;29:1128–1132. doi: 10.1086/313461. [DOI] [PubMed] [Google Scholar]
  32. Ma Y, Zhao Y, Tang J, Tang C, Chen J, Liu J. Antimicrobial susceptibility and presence of resistance & enterotoxins/enterotoxin-likes genes in Staphylococcusaureus from food. CYTA J. Food. 2018;16:76–84. [Google Scholar]
  33. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Harbarth S, Hindler JF, Kahlmeter G, Olsson-Liljequist B, Paterson DL, Rice LB, Stelling J, Struelens MJ, Vatopoulos A, Weber JT, Monnet DL. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012;18:268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
  34. Miranda C, Silva V, Igrejas G, Poeta P. Impact of European pet antibiotic use on enterococci and staphylococci antimicrobial resistance and human health. Future Microbiol. 2021;16:185–203. doi: 10.2217/fmb-2020-0119. [DOI] [PubMed] [Google Scholar]
  35. Neela V, Zafrul AM, Mariana NS, Van Belkum A, Liew YK, Rad EG. Prevalence of ST9 methicillin-resistant Staphylococcusaureus among pigs and pig handlers in Malaysia. J. Clin. Microbiol. 2009;47:4138–4140. doi: 10.1128/JCM.01363-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Ng L, Martin I, Alfa M, Mulvey M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell Probes. 2001;15:209–215. doi: 10.1006/mcpr.2001.0363. [DOI] [PubMed] [Google Scholar]
  37. Nicolaou KC, Rigol S. A brief history of antibiotics and select advances in their synthesis. J. Antibiot. 2018;71:153–184. doi: 10.1038/ja.2017.62. [DOI] [PubMed] [Google Scholar]
  38. Peacock SJ, Paterson GK. Mechanisms of methicillin resistance in Staphylococcusaureus. Annu. Rev. Biochem. 2015;84:577–601. doi: 10.1146/annurev-biochem-060614-034516. [DOI] [PubMed] [Google Scholar]
  39. Qekwana DN, Oguttu JW, Sithole F. Burden and predictors of Staphylococcusaureus and S pseudintermedius infections among dogs presented at an academic veterinary hospital in South Africa (2007-2012) PeerJ. 2017;5:e3198. doi: 10.7717/peerj.3198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Rankin S, Roberts S, O’Shea K, Maloney D, Lorenzo M, Benson CE. Panton valentine leukocidin (PVL) toxin positive MRSA strains isolated from companion animals. Vet. Microbiol. 2005;108:145–148. doi: 10.1016/j.vetmic.2005.02.013. [DOI] [PubMed] [Google Scholar]
  41. Riaz S, Faisal M, Hasnain S. Antibiotic susceptibility pattern and multiple antibiotic resistances (MAR) calculation of extended spectrum β-lactamase (ESBL) producing escherichia coli and klebsiella species in Pakistan. Afr. J. Biotechnol. 2011;10:6325–6331. [Google Scholar]
  42. Rooijakkers SHM, Ruyken M, Roos A, Daha MR, Presanis JS, Sim RB, van Wamel WJB, van Kessel KPM, van Strijp JAG. Immune evasion by a staphylococcal complement inhibitor that acts on C3 convertases. Nat. Immunol. 2005;6:920–927. doi: 10.1038/ni1235. [DOI] [PubMed] [Google Scholar]
  43. Saiful AJ, Mastura M, Zarizal S, Mazurah MI, Shuhaimi M, Ali AM. Detection of methicillin-resistant Staphylococcusaureus using mecA/nuc genes and antibiotic susceptibility profile of Malaysian clinical isolates. World J. Microbiol. Biotechnol. 2006;22:1289–1294. [Google Scholar]
  44. Saleha AA, Shamzarina M, Othman F, Zunita Z. Methicillin-resistant Staphylococcusaureus (MRSA) isolated from pet animals and pet and non-pet owners. J. Vet. Malays. 2006;18:13–16. [Google Scholar]
  45. Saleha AA, Zunita Z. Methicillin resistant Staphylococcusaureus (MRSA): An emerging veterinary and zoonotic pathogen of public health concern and some studies in Malaysia. J. Anim. Vet. Adv. 2010;9:1094–1098. [Google Scholar]
  46. Sit PS, Teh CSJ, Idris N, Sam IC, Syed Omar SF, Sulaiman H, Thong KW, Adeeba Kamarulzaman A, Ponnampalavanar S. Prevalence of methicillin-resistant Staphylococcusaureus (MRSA) infection and the molecular characteristics of MRSA bacteraemia over a two-year period in a tertiary teaching hospital in Malaysia. BMC Infect. Dis. 2017;17:1–14. doi: 10.1186/s12879-017-2384-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Stegger M, Liu CM, Larsen J, Soldanova K, Aziz M, Contente-Cuomo T, Petersen A, Vandendriessche S, Jiménez JN, Mammina C, Van Belkum A, Salmenlinna S, Laurent F, Skov RL, Larsen AR, Andersen PS, Price LB. Rapid differentiation between livestock-associated and livestock-independent Staphylococcusaureus CC398 Clades, PLoS One. 2013;8:e79645. doi: 10.1371/journal.pone.0079645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Suhaili Z, Yeo CC, Ghazali MF, Chew CH, Zainul AZ, Mazen MJAO, Nordin SA, Mohd Desa MN. Nasal colonisation, antimicrobial susceptibility and genotypic pattern of staphylococcus aureus among agricultural biotechnology students in besut, terengganu, east coast of malaysia. Trop. Med. Int. Health. 2018;23:905–913. doi: 10.1111/tmi.13090. [DOI] [PubMed] [Google Scholar]
  49. Trzcinski K, Cooper BS, Hryniewicz W, Dowson CG. Expression of resistance to tetracyclines in strains of methicillin-resistant Staphylococcusaureus. J. Antimicrob. Chemother. 2000;45:763–770. doi: 10.1093/jac/45.6.763. [DOI] [PubMed] [Google Scholar]
  50. Van Balen JC, Landers T, Nutt E, Dent A, Hoet AE. Molecular epidemiological analysis to assess the influence of pet-ownership in the biodiversity of Staphylococcusaureus and MRSA in dog- and non-dog-owning healthy households. Epidemiol. Infect. 2017;145:1135–1147. doi: 10.1017/S0950268816003228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Van Wamel WJ, Rooijakkers SH, Ruyken M, Van Kessel KP, Van Strijp JA. The innate immune modulators staphylococcal complement inhibitor and chemotaxis inhibitory protein of Staphylococcusaureus are located on β-hemolysin-converting bacteriophages. J. Bacteriol. 2006;188:1310–1315. doi: 10.1128/JB.188.4.1310-1315.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Verkaik NJ, Benard M, Boelens HA, De Vogel CP, Nouwen JL, Verbrugh HA, Melles DC, Van Belkum A, Van Wamel WJB. Immune evasion cluster-positive bacteriophages are highly prevalent among human Staphylococcusaureus strains, but they are not essential in the first stages of nasal colonization. Clin. Microbiol. Infect. 2011;17:343–348. doi: 10.1111/j.1469-0691.2010.03227.x. [DOI] [PubMed] [Google Scholar]
  53. Vyletělova M, Hanuš O, Karpíšková R, Štástková Z. Occurrence and antimicrobial sensitivity in staphylococci isolated from goat, sheep and cow’s milk. Acta Univ. Agric. Silvic. Mendel. Brun. 2011;59:209–213. [Google Scholar]
  54. Walther B, Hermes J, Cuny C, Wieler LH, Vincze S, Elnaga YA, Stamm I, Kopp PA, Kohn B, Witte W, Jansen A, Conraths FJ, Semmler T, Eckmanns T, Lübke-Becker A. Sharing more than friendship - Nasal colonization with coagulase-positive staphylococci (CPS) and co-habitation aspects of dogs and their owners. PLoS One. 2012;7 doi: 10.1371/journal.pone.0035197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. You Y, Song L, Nonyane BAS, Price LB, Silbergeld EK. Genomic differences between nasal Staphylococcusaureus from HOG slaughterhouse workers and their communities. PLoS One. 2018;13:e0193820. doi: 10.1371/journal.pone.0193820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Zehra A, Singh R, Kaur S, Gill JPS. Molecular characterization of antibiotic-resistant Staphylococcusaureus from livestock (bovine and swine) Vet. World. 2017;10:598–604. doi: 10.14202/vetworld.2017.598-604. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Iranian Journal of Veterinary Research are provided here courtesy of Shiraz University

RESOURCES