Abstract
Background:
Extended spectrum beta-lactamase (ESBL) has been described in Escherichia coli strains that have been isolated from humans and animals; it has induced a main concern with antibiotic resistance in serious bacterial infections.
Aims:
This study aimed to investigate the frequency of ESBL-producing E. coli (EPE) strains in meat and intestinal contents of turkey, and to compare the antibiotic resistance profile between EPE and non-EPE strains.
Methods:
Totally, 70 and 110 E. coli strains were isolated from turkey meat and turkey intestinal content samples, respectively. To determine EPE strains, double disc synergy test was applied by that 20 and 22 EPE strains were finally identified in meats and intestinal contents of the turkeys, respectively. Antibiotic susceptibility was exerted using disc diffusion method. Escherichia coli isolates were then characterized for virulence genes (stx-1 and stx-2) and ESBL genes (TEM, SHV, and CTX-M).
Results:
None of the E. coli strains harbored stx genes. The EPE strains in comparison with non-EPE strains were significantly more resistant to ciprofloxacin (47.6 vs 26.5%), tetracycline (80.9 vs 67.3%), ampicillin (47.6 vs 22.4%), penicillin (23.8 vs 10.2%), ceftazidime (57.1 vs 16.3%), ceftriaxone (38.1 vs 18.4%), and cefotaxime (47.6 vs 8.2%). The majority of EPE strains carried CTX-M gene. SHV showed the lowest frequency and it was not detected in EPE strains isolated from the intestinal contents. In this study, 75% of TEM-producing E. coli strains and 33% of SHV-producing E. coli strains were resistant to ampicillin. In addition, 41.7% of TEM-producing E. coli strains were resistant to penicillin, and 76.9% of CTX-producing E. coli were resistant to cefotaxime. Furthermore, 4.7% of EPE strains isolated from turkey meat were imipenem resistant.
Conclusion:
The resistance to cefotaxime and imipenem in EPE strains induces a concern in growing antibiotic resistance against broad spectrum antibiotics in E. coli strains.
Key Words: ESBL genes, ESBL-producing Escherichia coli, Turkey meat
Introduction
Escherichia coli is usually a commensal bacterium of humans and animals. Although many E. coli strains are non-pathogens, some strains are pathogens. Pathogenic strains cause intestinal and extra-intestinal infections such as urinary tract infection, gastroenteritis, peritonitis, meningitis, and septicemia (Roberts, 1996 ▶). Some E. coli strains cause bloody diarrhea, anemia, and kidney failure which can lead to death. Most E. coli strains can produce shiga toxin that is harmful to the epithelium of the small intestine. This bacterium causes many forms of infections, including colisepticemia, yolk sac infection, coligranuloma, cellulitis, and swollen head syndrome, commonly described as colibacillosis in birds. Colibacillosis often requires antimicrobial therapy (Gholami-Ahangaran and Zia-Jahromi, 2014 ▶). Widespread and incorrect use of antibiotics may potentially lead to antibiotic resistance emergence in the bacteria (Gholami-Ahangaran et al., 2021a ▶; Sengeløv et al., 2003 ▶). Antibiotic resistance is a major problem in the treatment and control of infections, and various strategies are used by bacteria to protect themselves from the harmful effects of antibiotics (Chopra and Roberts, 2001 ▶).
Increasing antibiotic resistance is a global concern. Receiving antibiotic-resistant bacteria through food can play a role in developing antibiotic resistance in humans (Rahimi et al., 2012 ▶). Programs for controlling antibiotic resistance are well defined in most governments (Birgand et al., 2018 ▶). Resistance in E. coli can be an indicator of antibiotic resistance in a country (Chopra and Roberts, 2001 ▶). Antibiotic resistance usually occurs more rapidly in the antibiotics more widely used (Teimuri et al., 2008 ▶).
Beta-lactam antibiotics are one of the most antibiotics widely used in the treatment of bacterial infections in animals and humans; due to their low toxicity and strong antimicrobial activity (Carvalho et al., 2020 ▶). The production of beta-lactamase enzymes is the main mechanism of bacterial resistance to the beta-lactam family (Badri et al., 2017 ▶; Kuralayanapalya et al., 2019 ▶). One of these mechanisms used in Gram-negative bacteria against antibiotics is beta-lactamase production (Mobasseri et al., 2019 ▶). Broad-spectrum beta-lactamases are mainly produced by Klebsiella as well as other Enterobacteriaceae bacteria e.g. E. coli (Samanta et al., 2018 ▶). Extensive beta-lactamases (ESBL) are enzymes produced by some bacteria that inactivate the lethality of beta-lactams via breaking the beta-lactam ring (Carvalho et al., 2020 ▶). These enzymes develop resistance to these antibiotics by hydrolyzing the beta-lactam ring (Haeggman et al., 2004 ▶). Due to the widespread use of antimicrobial agents to treat animals; the genus E. coli is highly resistant to most antibiotics (Gholami-Ahangaran et al., 2021b ▶). Production of extensive beta-lactamases in strains isolated from poultry increases the possibility of transferring extensive beta-lactamase-producing genes to other microbial flora, as well as to human microflora through non-compliance with hygiene principles. Due to the importance of detecting bacterial contaminations in animal protein sources, especially meat, this study aimed to investigate the prevalence of ESBL-producing E. coli (EPE) strains in meat and intestinal contents of turkey and also to compare the antibiotic resistance profile between EPE and non-EPE strains.
Materials and Methods
Sample collection
Totally, 400 samples were collected from 200 meats and 200 swabs from intestinal contents of turkeys that were prepared from different slaughterhouses in Isfahan province from spring 2019 to 2020. Approximately, 25 g meat sample was collected from neck, thigh, and breast muscles, and homogenized with 225 ml buffered peptone water in a stomacher. The mixture was incubated at 37°C overnight.
Isolation and identification of E. coli strains
All samples were firstly cultured in peptone water and then streaked on MacConkey’s agar and incubated at 37°C for 24 h. E. coli was confirmed after the growth of the isolates on the Eosin methylene blue (EMB) agar medium. The Gram-negative colonies from EMB were subjected to biochemical tests (IMViC test: Indole, methyl red test, Voges Proskauer test, and citrate utilization test) to confirm the colonies as E. coli. The isolates with typical IMViC patterns (positive Indol and MR, and negative VP and citrate utilization) were considered as E. coli (Gholami-Ahangaran and Zia-Jahromi, 2014 ▶).
For extraction of DNA, colonies of overnight growth bacteria were used. The colonies were put in a test tube containing 1 ml of distilled water and boiled for 10 min, and then centrifuged for 5 min at 10000 × g. Five microliters of the supernatant were used for the PCR. Molecular confirmation of the colonies was achieved according to the 16S rRNA gene of E. coli described by Sabat et al. (2000) ▶.
The primer set of ECP79F (forward, targeting bases 79 to 96, 59-GAA GCT TGC TTC TTT GCT-39) and ECR620R (reverse, targeting bases 602 to 620, 59-GAG CCC GGG GAT TTC ACA T-39) were used for identification of E. coli (Sabat et al., 2000 ▶). E. coli ATCC 25922 was used as a reference and quality control organism in the PCR method for 16S rRNA amplification confirmation.
The PCR mixture (25 μL) contained 2 mM MgCl2, 500 mM KCl, 100 mM Tris-HCl (pH = 9.0), 0.1% Triton X-100, 200 μm of each dNTP (Fermentas, Germany), 1 μm primers, 1.5 IU of Taq DNA polymerase (Fermentas, Germany), and 5 μL (200 ng/μL) of DNA.
The PCR reaction was established in a DNA thermocycler (Eppendorf Mastercycler, Eppendorf-Netheler-Hinz GmbH, Biorad, Germany) for 5 min of initial denaturation at 94°C; followed by 35 cycles of 94°C for 50 s; 55°C for 50 s, and 72°C for 90 s. The PCR products were finally analyzed by gel electrophoresis in a 1.5% (w/v) agarose gel.
Detection of stx-1 and stx-2 genes
For detection of stx-1 and stx-2 genes, 5 μL of the extracted DNA was added to the PCR reaction mixture (50 μL) containing 1 μL of each primer (CinnaGen, Iran) in a 25-pmol concentration, 1 μL of 0.2 mM for each dNTPs (Fermentase, Germany), 5 μL of 10x concentrated PCR buffer, 2 μL of 50 mM Mgcl2, and 0.2 μL of Taq polymerase (1 U/ml) (Fermentase). The DNA-sequencing of oligonucleotide primers, and the size of amplified fragments are listed in Table 1. The amplification products were analyzed by gel electrophoresis on a 1% agarose gel, stained with ethidium bromide, and photographed at UV exposure (Gholami-Ahangaran and Zia-Jahromi, 2014 ▶).
Table 1.
Oligonucleotide sequences, and sizes of amplified fragments
| Gene | Oligonucleotide sequences (5´-3´) | Fragment sizes (bp) |
|---|---|---|
| Stx-1 | CGCTGAATGTCATTCGCTCTGC | 302 |
| CGTGGTATAGCTACTGTCACC | ||
| Stx-2 | CTTCGGTATCCTATTCCCGG | 516 |
| CTGCTGTGACAGTGACAAAACGC |
Antibiotic sensitivity
To evaluate the susceptibility of E. coli strains to antibiotics, disc diffusion method (Kirby-Bauer method) was established according to the Clinical & Laboratory Standards Institute (CLSI) guidelines (CLSI, 2018). The commercial antibiotic discs (Padtan-Teb, Iran) comprised cefotaxime (30 µg), imipenem (10 µg), ceftazidime (30 µg), gentamicin (10 µg), ampicillin (10 µg), cefexime (5 µg), ciprofloxacin (5 µg), ceftriaxone (30 µg), nitrofurantoin (300 µg), furazolidone (100 µg), tetracycline (30 µg), amoxicillin (25 µg), amikacin (30 µg), and nalidixic acid (30 µg). A suspension of pure bacterial culture equivalent to 0.5 McFarland (1.5 × 108 CFU/ml) was firstly prepared. The bacteria were then cultured on Müller-Hinton agar and after disc placement, incubated at 37°C for 24 h. The diameter of the growth inhibition zone was measured and interpreted according to the standard antibiograme protocol.
Phenotypic identification of ESBL-producing E. coli (EPE)
To evaluate the ability of bacteria to produce extensive beta-lactamase, a standard microbial suspension was prepared from the isolated E. coli strains according to a concentration of 0.5 McFarland and spread on Müller-Hinton agar. After 20 min, the discs of cefotaxime (30 μg), cefotaxime-clavulanic acid (30 plus 10 μg), ceftazidime (30 μg), and ceftazidime clavulanic (30 plus 10 μg) (MAST, UK) were placed at a distance of at least 25 mm from each other. The growth inhibition zone around the disc with clavulanic acid was measured using a ruler, and compared to that without clavulanic acid. So that, if the growth inhibition zone around the discs containing clavulanic acid is greater than or equal to 5 mm in comparison with the same disc alone, it is known as a beta-lactamase-containing strain according to CLSI (CLSI, 2018 ▶). Klebsiella pneumoniae (ATCC 700603) and E. coli (ATCC 25922) were respectively used as a beta-lactamase-producing strain (positive control) and a negative control for quality control of antibiogram.
Genotypic identification of EPE
The purified bacteria were incubated in nutrient broth at 37°C for 1 day and the bacterial DNA was extracted by the boiling method. The extracted DNA was stored at -70°C until the achievement of the experiments. PCR was performed to identify ESBL genes comprising TEM, CTX, and SHV. The characteristics of primers for ESBL genes are presented in Table 2. The PCR reaction was performed in a final volume of 25 μL, including 20 μL of PCR buffer (50 mmol KCL, 50 mmol Tris-HCL and 50 mmol Mgcl2), 1.5 μL dNTPs (0.2 mmol), 1 μL of each primers (1 μL); 0.5 μL of Taq DNA polymerase (Fermentas), and 1 μL of extracted DNA (200 nmol). Primers targeting the CTX, TEM, and SHV genes amplified 214, 847, and 590 bp products (Acikgoz et al., 2007 ▶; Junyoung et al., 2009 ▶; Yazdi et al., 2010 ▶). Amplification of target genes in a thermocycler (Eppendorf, Germany) with a thermal cycle program including the primary denaturation at 94°C for 5 min, 35 cycles of denaturation at 94°C for 60 s, 58°C (for TEM gene annealing), 60°C (for CTX gene annealing), and 61°C (for SHV gene annealing) for 60 s, 72°C for 60 s, and the final extension at 72°C for 5 min. In this study, a 100 bp marker was used to determine the amplified fragment size. The PCR products were analyzed by electrophoresis in 1% agarose gels and stained with ethidium bromide.
Table 2.
The characteristics of primers for ESBL genes amplification
| Gene name | Sequence of primer | Product size (bp) | Reference |
|---|---|---|---|
| blaCTX-M-F | 5-GATGAACGCTTTCCCATGATG-3 | 214 | |
| blaCTX-M-R | 5-CGCTGTTATCGCTCATGGTAA-3 | ||
| blaSHV-F | 5-GATGAACGCTTTCCCATGATG-3 | 590 | |
| blaSHV-R | 5-CGCTGTTATCGCTCATGGTAA-3 | ||
| blaTEM-F | 5-ATGAGTATTCAACATTTCCG-3 | 847 | |
| blaTEM-R | 5-GTCACAGTTACCAATGCTTA-3 |
In each assay, K. pneumoniae ATCC 700603, and E. coli ATCC 25922 were used as positive and negative controls for ESBL production, respectively.
Results
The E. coli strains were identified by microbiological, biochemical, and molecular (Fig. 1) examinations. 110 and 70 E. coli strains were respectively detected from 200 intestinal contents and 200 meat samples of turkeys. In this study, none of the E. coli strains carried the stx genes (stx-1 or stx-2 genes).
Fig. 1.
Electrophoresis of PCR product of 16S rRNA gene of E. coli in the samples. Lane M: Marker with a size of 100 bp DNA, Lanes 1 and 2: Positive samples, Lane 3: Positive control (E. coli, ATCC 25922), and Lane 4: Negative control (ddH2O)
Details of the antibiotic resistance in E. coli strains isolated from intestinal contents and meat samples are presented in Table 3.
Table 3.
The frequency/percentage of antibiotic resistance in E. coli strains isolated from intestinal contents and meat samples in turkey
| Antibiotics | Meat (70 strains) | Intestinal content (110 strains) | ||||
|---|---|---|---|---|---|---|
| Resistance | Intermediate | Sensitive | Resistance | Intermediate | Sensitive | |
| Cefotaxime (30 µg) | 14 (20) | 13 (18.6) | 43 (61.4) | 17 (15.5) | 35 (31.8) | 58 (52.7) |
| Imipenem (10 µg) | 2 (2.8) | 3 (4.3) | 65 (92.8) | 2 (1.8) | 5 (4.6) | 103 (93.6) |
| Ceftazidime (30 µg) | 20 (28.6) | 17 (24.3) | 33 (47.1) | 22 (20) | 45 (40.9) | 43 (39.1) |
| Gentamicin (10 µg) | 5 (7.1) | 11 (15.7) | 54 (77.2) | 5 (4.5) | 17 (15.5) | 88 (80) |
| Ampicillin (10 µg) | 21 (30) | 18 (25.7) | 31 (44.3) | 27 (24.5) | 3 (2.7) | 80 (72.7) |
| Ciprofloxacin (5 µg) | 23 (32.9) | 22 (31.4) | 25 (35.7) | 32 (29) | 35 (31.8) | 43 (39.1) |
| Ceftriaxone (30 µg) | 17 (24.3) | 16 (22.9) | 37 (52.9) | 18 (16.4) | 35 (31.8) | 57 (51.8) |
| Nitrofurantoin (300 µg) | 14 (20) | 19 (27.1) | 37 (52.9) | 16 (14.5) | 34 (30.9) | 60 (54.6) |
| Furazolidone (100 µg) | 11 (15.7) | 12 (17.1) | 47 (67.1) | 14 (12.7) | 24 (21.8) | 72 (65.5) |
| Tetracycline (30 µg) | 50 (71.4) | 11 (15.7) | 9 (18.4) | 50 (45.5) | 38 (34.5) | 22 (20) |
| Amoxicillin (25 µg) | 25 (35.7) | 20 (28.6) | 25 (35.7) | 30 (27.3) | 62 (56.4) | 18 (16.4) |
| Amikacin (30 µg) | 21 (30) | 25 (35.7) | 24 (34.3) | 22 (20) | 58 (52.7) | 30 (27.3) |
| Nalidixic acid (30 µg) | 57 (81.4) | 5 (7.1) | 8 (11.4) | 77 (70) | 16 (14.5) | 17 (15.5) |
| Cefixime (5 µg) | 28 (40) | 17 (24.3) | 25 (35.7) | 25 (22.7) | 57 (51.8) | 28 (25.5) |
| Oxytetracycline (30 µg) | 26 (37.2) | 25 (35.7) | 19 (27.1) | 33 (30) | 31 (28.2) | 46 (41.8) |
| Doxycycline (30 µg) | 21 (30) | 24 (34.3) | 26 (37.1) | 22 (20) | 40 (36.4) | 50 (45.5) |
| Trimethoprim + sulfamethoxazole | 21 (30) | 21 (30) | 28 (40) | 27 (24.5) | 44 (40) | 39 (35.5) |
| Erythromycin (15 µg) | 56 (80) | 11 (15.7) | 3 (4.3) | 77 (70) | 18 (16.4) | 15 (13.6) |
| Penicilline (10 µg) | 10 (14.3) | 15 (21.4) | 45 (64.3) | 22 (20) | 39 (35.5) | 49 (44.5) |
| Amoxicilline + Clavulanic acid | 14 (20) | 25 (35.7) | 31 (44.3) | 17 (15.4) | 34 (30.9) | 59 (53.6) |
| Lincomycin (2 µg) | 29 (41.4) | 16 (22.9) | 25 (35.7) | 36 (32.7) | 48 (43.7) | 26 (23.6) |
| Chloramphenicol (30 µg) | 18 (25.7) | 24 (34.3) | 28 (40) | 21 (19.1) | 40 (36.4) | 49 (44.5) |
According to cephalosporin plus clavulanic acid sensitivity, 21 and 22 ESBL-producing E. coli strains isolated from meats and intestinal contents of turkeys were identified, respectively. The percentages of antibiotic resistance in ESBL and non-ESBL-producing E. coli strains isolated from meat samples are presented in Table 4.
Table 4.
The frequency/percentage of antibiotic resistance in EPE- and non-EPE-producing E. coli strains
| Antibiotics | EPE isolated from meat (21 strains) | Non-EPE isolated from meat (49 strains) | ||||
|---|---|---|---|---|---|---|
| Resistance | Intermediate | Sensitive | Resistance | Intermediate | Sensitive | |
| Cefotaxime (30 µg) | 10 (47.6) | 7 (33.3) | 4 (19.1) | 4 (8.2) | 6 (12.2) | 39 (79.6) |
| Imipenem (10 µg) | 1 (4.75) | 1 (4.75) | 19 (90.5) | 1 (2.0) | 2 (4) | 46 (94) |
| Ceftazidime (30 µg) | 12 (57.1) | 6 (28.6) | 3 (14.3) | 8 (16.3) | 11 (22.5) | 30 (61.2) |
| Gentamicin (10 µg) | 3 (14.3) | 4 (19.1) | 14 (66.6) | 2 (4.1) | 7 (14.3) | 40 (81.6) |
| Ampicillin (10 µg) | 10 (47.6) | 5 (23.8) | 6 (28.6) | 11 (22.4) | 13 (26.5) | 25 (51) |
| Ciprofloxacin (5 µg) | 10 (47.6) | 6 (28.6) | 5 (23.8) | 13 (26.5) | 16 (32.7) | 20 (40.8) |
| Ceftriaxone (30 µg) | 8 (38.1) | 6 (28.6) | 7 (33.3) | 9 (18.4) | 10 (20.4) | 30 (61.2) |
| Nitrofurantoin (300 µg) | 7 (33.3) | 7 (33.3) | 7 (33.3) | 7 (14.3) | 12 (24.5) | 30 (61.2) |
| Furazolidone (100 µg) | 6 (28.6) | 7 (33.3) | 8 (38.1) | 5 (10.2) | 5 (10.2) | 39 (79.6) |
| Tetracycline (30 µg) | 17 (81) | 1 (4.7) | 3 (14.3) | 33 (67.3) | 10 (20.4) | 6 (12.3) |
| Amoxicillin (25 µg) | 10 (47.6) | 5 (23.8) | 6 (28.6) | 15 (30.6) | 15 (30.6) | 19 (38.8) |
| Amikacin (30 µg) | 7 (33.3) | 9 (42.8) | 5 (23.8) | 14 (28.6) | 16 (32.7) | 19 (38.8) |
| Nalidixic acid (30 µg) | 17 (81) | 2 (9.5) | 2 (9.5) | 40 (81.6) | 3 (6.1) | 6 (12.3) |
| Cefixime (5 µg) | 10 (47.6) | 6 (28.5) | 5 (23.8) | 18 (36.7) | 11 (25.5) | 20 (40.8) |
| Oxytetracycline (30 µg) | 10 (47.6) | 7 (33.3) | 4 (19.1) | 16 (32.7) | 18 (36.7) | 15 (30.6) |
| Doxycycline (30 µg) | 8 (38.1) | 6 (28.6) | 7 (33.3) | 13 (26.5) | 17 (34.7) | 19 (38.8) |
| Trimethoprim + sulfamethoxazole | 8 (38.1) | 5 (23.8) | 8 (38.1) | 13 (26.5) | 16 (32.7) | 20 (40.8) |
| Erythromycin (15 µg) | 19 (90.5) | 1 (4.75) | 1 (4.75) | 37 (75.7) | 10 (20.4) | 2 (4.1) |
| Penicilline (10 µg) | 5 (23.8) | 6 (28.6) | 10 (47.6) | 5 (10.2) | 9 (18.4) | 35 (71.4) |
| Amoxicilline + Clavulanic acid | 5 (23.8) | 5 (23.8) | 11 (52.4) | 9 (18.4) | 20 (40.8) | 20 (40.8) |
| Lincomycin (2 µg) | 10 (47.6) | 5 (23.8) | 6 (28.6) | 19 (38.8) | 11 (22.5) | 19 (38.8) |
| Chloramphenicol (30 µg) | 7 (33.3) | 6 (28.6) | 8 (38.1) | 11 (22.4) | 18 (36.7) | 20 (40.8) |
The comparison of antibiotic resistance frequencies between ESBL and non-ESBL E. coli strains represents that the mean percent of antibiotic resistance in ESBL-producing E. coli strains was significantly higher than non-ESBL-producing E. coli strains (43.26 ± 20.77 vs 28.10 ± 21.56) (P=0.022). This statistical difference is higher about Cefotaxime, Ceftazidime, Ceftriaxone, and Cefixime (47.57 ± 7.57 vs 19.10 ± 12.03) (P=0.008).
The detection of ESBL genes in ESBL-producing E. coli strains showed that TEM (Fig. 2), CTX-M (Fig. 3), and SHV (Fig. 4) detected from 21 out of 70 E. coli strains from meats (30%), and 22 out of 110 E. coli strains from intestinal contents (20%). The frequency of each ESBL genes in E. coli strain isolated from meat presented in Table 5. The results represent that SHV did not detect from E. coli strains isolated from intestinal content of turkeys.
Fig. 2.
Electrophoresis of PCR product of TEM gene in the E. coli strains. Lanes 1-5: Positive samples, Lane 6: Positive control (K. pneumonia, ATCC 700603), Lane 7: Marker with a size of 100 bp DNA, and Lane 8: Negative control (E. coli, ATCC 25922)
Fig. 3.
Electrophoresis of PCR product of CTX gene in the E. coli strains. Lane M: Marker with a size of 100 bp DNA, Lanes 1-5: Positive samples, Lane 6: Positive control (K. pneumonia, ATCC 700603), and Lane 4: Negative control (E. coli, ATCC 25922)
Fig. 4.
Electrophoresis of PCR product of SHV gene in the E. coli strains. Lane M: Marker with a size of 100 bp DNA, Lanes 1 and 2: Positive samples, Lane 3: Negative control (E. coli, ATCC 25922), and Lane 4: Positive control (K. pneumonia, ATCC 700603)
Table 5.
The frequency (and percentage) of ESBL genes in E. coli strains isolated from meats and intestinal contents of turkeys
| ESBL genes | E. coli strains isolated from meat (70 strains) | E. coli strains isolated from intestinal content (110 strains) |
|---|---|---|
| TEM | 6 (8.57) | 6 (5.45) |
| CTX | 7 (10) | 13 (11.81) |
| SHV | 2 (2.85) | 0 (0) |
| TEM and CTX | 5 (7.14) | 3 (2.72) |
| TEM and SHV | 0 (0) | 0 (0) |
| CTX and SHV | 0 (0) | 0 (0) |
| TEM; CTX and SHV | 1 (1.42) | 0 (0) |
| Total ESBL genes | 21 (30) | 22 (20) |
Discussion
In this study, the frequency of CTX-M, TEM, and SHV genes in E. coli strains isolated from the meats and digestive contents of turkeys was evaluated and the relationship between antibiotic resistance and the presence of ESBL-producing genes was studied. As result, 30% of E. coli strains isolated from turkey meats, and 20% of E. coli strains isolated from the digestive contents of turkeys were ESBL-producing strains that showed high resistance to antibiotics. The average rate of antibiotic resistance in ESBL-producing E. coli strains was significantly higher than E. coli strains without the ability to produce ESBL (43.26 vs 28.1%). Also, the relationship between the presence of CTX-M gene and resistance to cefotaxime was investigated; high resistance to cefotaxime was found in EPE strains, which may be due to the presence of CTX-M gene in these strains. The comparison among the frequencies of ESBL-producing genes showed that the highest ESBL-producing gene was CTX-M in E. coli isolates.
There are many reports about the prevalence of EPE in poultry meat in different countries. In Pakistan (46/70%) (Rahman et al., 2019 ▶), Ghana (29%) (Falgenhauer et al., 2019 ▶), Turkey (81%) (Pehlivanlar Ennen et al., 2015 ▶), and the Netherlands (94%) (Leverstein-van Hall et al., 2011 ▶), the strains isolated from poultry had the ability to produce ESBL. In Iran, Jafari et al. (2016) ▶ detected at least one ESBL gene in 48% of E. coli strains isolated from broilers. In Belgium, Smet et al. (2008) ▶ isolated EPE strains in 45% of cloaca swabs collected from five broiler farms. In Tunisia, 7 out of 26 (26.92%) food samples with chicken and turkey origins contained EPE strains (Ben Slama et al., 2010 ▶). In another study, 22 out of 26 E. coli strains isolated from cloaca swabs of broiler chicken were possessed ability to produce ESBL (Dierikx et al., 2013 ▶). In one study in Germany, 86.60% of carcasses and 72.50% of cecums contained ESBL-producing bacteria that most of them were E. coli (Reich et al., 2013 ▶). Overdevest et al. (2011) ▶ detected EPE strains in 76.80% of chicken samples collected in the Netherlands. However, EPE strains are rising all over the world, which could raise concerns about the treatment of E. coli infection in humans and animals.
Regarding the frequency of ESBL-producing genes, there is always an epidemiological change (Jafari et al., 2016 ▶). In the 1990s, E. coli strains containing the TEM and SHV genes were recognized as the main EPE, but now CTX-M is the most prevalent ESBL gene, which has been appeared since 1987 (Li et al., 2010 ▶). In our study, CTX-M was the predominant ESBL gene in E. coli strains isolated from turkeys, and SHV was not detected in EPE strains isolated from gastrointestinal contents. This has been reported in similar studies. Jafari et al. (2016) ▶ identified 34.67% E. coli strains with ESBL production ability in chickens among that the CTX-M gene was higher than TEM and SHV genes in isolates. Pehlivanlar Önen et al. (2015) ▶ in Turkey, detected ESBL genes in 81% of E. coli strains isolated from chicken, with the most frequency of CTX. There are reports that did not detect SHV gene in EPE strains, similar to our study. Momtaz et al. (2012) ▶ did not find any E. coli strain with SHV gene in 57 E. coli strains isolated from chicken in Shahrekord slaughterhouse. In another study, out of 22 strains with ampicillin-resistant E. coli from feces of healthy chickens, 17 isolates had TEM gene and no SHV gene was detected in these strains (Dierikx et al., 2013 ▶). In Portugal, 38.20% of E. coli strains isolated from broiler fecal samples in a slaughterhouse were positive for CTX-M and TEM (Costa et al., 2009 ▶). Recently, there are some reports from Germany and the United States that represented the presence of CTX-M in E. coli strains isolated from human infections (Xu et al., 2011 ▶; Bezabihe et al., 2021 ▶).
In our study, EPE strains showed high resistance to beta-lactam and other antibiotics. This subject may be caused by the co-transfer of resistance genes located in the same plasmid as ESBL genes. EPE in comparison with non-EPE strains were significantly more resistant to ciprofloxacin (47.6 vs 26.5), tetracycline (80.9 vs 67.3), ampicillin (47/22 vs 22.4), penicillin (23.8 vs 10.2), ceftazidime (47.6 vs 8.2), ceftriaxone (38.1 vs 18.4), and cefotaxime (47.6 vs 8.2). Previous studies have shown that EPE strains, in addition to resistance to beta-lactam antibiotics, are also highly resistant to aminoglycosides, fluoroquinolones, and tetracyclines (Kar et al., 2015). Also, Koga et al. (2015) found high resistance to tetracycline (97.4%), and nalidixic acid (79.5%) in EPE strains isolated from chicken carcasses in Brazil. This could be due to the common location of ESBL resistance genes and other resistance determinants on the plasmid, which in turn transmits resistance to other antibiotics. However; differences in antibiotic resistance may be due to geographical location. Antibiotic availability, arbitrary consumption of antibiotics, and various antibiotic susceptibility tests play main roles in diversifying the pattern of antibiotic resistance in different geographical areas. EPE strains are reported to be highly resistant to cefotaxime that mainly had CTX-M gene. The presence of high resistance, as well as the frequency of CTX-M gene, can be related to the presence of the ESBL gene and resistance to cefotaxime. Several reports have evaluated the relation between the presence of CTX-M gene and the presence of resistance to cefotaxime. Botelho et al. (2015) ▶ reported 58% resistance to cefotaxime in EPE strains isolated from 16 chicken carcasses. Also, Li et al. (2010) ▶ reported the frequency of cefotaxime resistance in CTX-producing E. coli strains isolated from cloacal swabs of broiler chickens on various Chinese farms ranged from 2 to 90%.
In the recent study, 75% of TEM-producing E. coli strains (9 out of 12) and 33% of SHV-producing E. coli strains (one out of 3) were resistant to ampicillin. In addition, 41.7% of TEM-producing E. coli strains (5 out of 12) were resistant to penicillin and 76.9% of CTX-producing E. coli (9 out of 13) were resistant to cefotaxime. The resistance to cefotaxime in CTX-producing E. coli strains is more than that of other studies. This indicates the increasing spread of cefotaxime resistance genes among E. coli strains. Another concern from our results is the resistance to imipenem, a broad-spectrum antibiotic, observed in 4.7% of EPE strains isolated from turkey meat. Although this is the lowest resistance percentage among the antibiotics, frequent monitoring of this antibiotic resistance is highly recommended because imipenem is the last line of treatment for serious and complicated E. coli infections in humans. In India, the rate of imipenem resistance in E. coli strains isolated from poultry feces has been reported by 27% (Kar et al., 2015 ▶), while other studies have not reported any imipenem resistance in bacteria isolated from poultry meat (Pehlivanlar Önen et al., 2015 ▶). The main reason for this variation among the countries may be due to the widespread use of broad-spectrum antibiotics in health care facilities. Extensive use of broad-spectrum antibiotics, especially third-generation of cephalosporins and penems can contaminate wastewater and even the environment and transfer resistance genes to other bacteria. Although imipenem is not used in livestock and poultry, the occurrence of this resistance may increase the transmission of the antibiotic resistance genes among bacteria; it is necessary to take more care to prevent infectious diseases by replacing safe biological compounds instead of antibiotic consumption in poultry production. These actions can prevent the increase of antibiotic resistance to broad-spectrum antibiotics used against serious infectious diseases in humans.
In conclusion, the appearance of transferable antibiotic resistance and ESBL genes in E. coli strains isolated from turkey, especially cefotaxime, and imipenem resistance, possesses a high public health threat and induces a concern in the growing of antibiotic resistance against broad spectrum antibiotics in E. coli strains.
Conflict of interest
The authors declare no conflict of interest.
Acknowledgements
The authors thank all those who helped us in collecting the samples and performing the molecular experiments.
References
- Acikgoz ZC, Koseoglu EO, Kocagoz S. CTX-M-3 Beta lactamase produsing Shigella sonnei isolated from pediatric bacillary dysentery cases. Jpn. J. Infect. Dis. 2007;61:135–137. [PubMed] [Google Scholar]
- Badri A, Ibrahim I, Mohamed S, Garbi M, Kabbashi A, Arbab M. Prevalence of extended-spectrum beta-lactamase (ESBL) producing Escherichia coli and Klebsiella pneumoniae isolated from raw milk samples in Al Jazirah State; Sudan. Mol. Biol. 2017;7:201–209. [Google Scholar]
- Ben Slama K, Jouini A, Ben Sallem R, Somalo S, Sáenz Y, Estepa V, Torres C. Prevalence of broad-spectrum cephalosporin-resistant Escherichia coli isolates in food samples in Tunisia; and characterization of integrons and antimicrobial resistance mechanisms implicated. Int. J. Food Microbiol. 2010;137:281–286. doi: 10.1016/j.ijfoodmicro.2009.12.003. [DOI] [PubMed] [Google Scholar]
- Bezabih YM, Sabiiti W, Alamneh E, Bezabih A, Peterson GM, Bezabhe WM, Roujeinikova A. The global prevalence and trend of human intestinal carriage of ESBL-producing Escherichia coli in the community. J. Antimicrob. Chemother. 2021;76:22–29. doi: 10.1093/jac/dkaa399. [DOI] [PubMed] [Google Scholar]
- Birgand G, Castro-Sánchez E, Hansen S, Gastmeier P, Lucet J, Ferlie E, Holmes A, Ahmed R. Comparison of governance approaches for the control of antimicrobial resistance: Analysis of three European countries. Antimicrob. Resist. Infect. Control. 2018;7:1–12. doi: 10.1186/s13756-018-0321-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Botelho LAB, Kraychete GB, Costa e Silva JL, Regis DVV, Picão RC, Moreira BM, Bonelli RR. Widespread distribution of CTX-M and plasmid-mediated AmpC β-lactamases in Escherichia coli from Brazilian chicken meat. Mem. I. Oswaldo. Cruz. 2015;110:249–254. doi: 10.1590/0074-02760140389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carvalho I, Alonso CA, Silva V, Pimenta P, Cunha R, Martins C, Poeta P. Extended-spectrum beta-lactamase-producing Klebsiella pneumoniae isolated from healthy and sick dogs in Portugal. Microb. Drug Resist. 2020;26:709–715. doi: 10.1089/mdr.2019.0205. [DOI] [PubMed] [Google Scholar]
- Chopra I, Roberts M. Tetracycline antibiotics: mode of action; applications; molecular biology; and epidemiology of bacterial resistance. Mic. Mol. Biol. Rev. 2001;65:232–260. doi: 10.1128/MMBR.65.2.232-260.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- CLSI . Wayne, Pennsylvania, Clinical and Laboratory Standards Institute. 28th Edn. 2018. Performance standards for antimicrobial susceptibility testing; pp. 1–258. [Google Scholar]
- Costa D, Vinue L, Poeta P, Coelho AC, Matos M, Sáenz Y, Torres C. Prevalence of extended-spectrum beta-lactamase-producing Escherichia coli isolates in fecal samples of broilers. Vet. Microbiol. 2009;138:339–344. doi: 10.1016/j.vetmic.2009.03.029. [DOI] [PubMed] [Google Scholar]
- Dierikx C, Van der Goot J, Fabri T, van Essen-Zandbergen A, Smith H, Mevius D. Extended-spectrum β-lactamase and Ampc β-lactamase-producing Escherichia coli in Dutch broilers and broiler farmers. J. Antimicrob. Chemother. 2013;68:60–67. doi: 10.1093/jac/dks349. [DOI] [PubMed] [Google Scholar]
- Falgenhauer L, Imirzalioglu C, Oppong K, Akenten CW, Hogan B, Krumkamp R, Eibach D. Detection and characterization of ESBL-producing Escherichia coli from humans and poultry in Ghana. Front. Microbiol. 2019;9:3358–3366. doi: 10.3389/fmicb.2018.03358. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gholami-Ahangaran M, Ahmadi-Dastgerdi A, Azizi S, Basiratpour A, Zokaei M, Derakhshan M. Thymol and carvacrol supplementation in poultry health and performance. Vet. Med. Sci. 2021a doi: 10.1002/vms3.663. doi: 10.1002/vms3.663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gholami-Ahangaran M, ZiaJahromi N. Identification of shiga toxin and intimin genes in Escherichia coli detected from canary (Serinus canaria domestica) Toxicol. Ind. Health. 2014;30:724–727. doi: 10.1177/0748233712462480. [DOI] [PubMed] [Google Scholar]
- Gholami-Ahangaran M, Zinsaz P, Pourmahdi O, Ahmadi-Dastgerdi A, Ostadpour M, Soltani M Tetracycline resistance genes in Escherichia coli strains isolated from biofilm of drinking water system in poultry farms. Acta Vet. Euracia . 2021b doi: 10.5152/actavet. 2021.20070. [Google Scholar]
- Haeggman S, Löfdahl S, Paauw A, Verhoef J, Brisse S. Diversity and evolution of the class A chromosomal beta-lactamase gene in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 2004;48:2400–2408. doi: 10.1128/AAC.48.7.2400-2408.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jafari RA, Motamedi H, Maleki E, Ghanbarpour R, Mayahi M. Phylogenetic typing and detection of extended-spectrum β-lactamases in Escherichia coli isolates from broiler chickens in Ahvaz; Iran. Vet. Res. Forum. 2016;7:227–232. [PMC free article] [PubMed] [Google Scholar]
- Junyoung K, Semi J, Hogeun R, Bokkwon L, Misun P, Hoanjong L, Jina L, Seonghan K. Rapid detection of extended spectrum β-lactamase (ESBL) for Enterobacteriaceae by use of a multiplex PCR-based method. Infect. Chemother. 2009;41:181–184. [Google Scholar]
- Kar D, Bandyopadhyay S, Bhattacharyya D, Samanta I, Mahanti A, Nanda PK, Singh RK. Molecular and phylogenetic characterization of multidrug resistant extended spectrum beta-lactamase producing Escherichia coli isolated from poultry and cattle in Odisha; India. Infect. Genet. Evol. 2015;29:82–90. doi: 10.1016/j.meegid.2014.11.003. [DOI] [PubMed] [Google Scholar]
- Khezri A, Avershina E, Ahmad R. Plasmid identification and plasmid-mediated antimicrobial gene detection in Norwegian isolates. Microorganisms. 2021;9:52–65. doi: 10.3390/microorganisms9010052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kuralayanapalya SP, Patil SS, Hamsapriya S, Shinduja R, Roy P. Amachawadi RG Prevalence of extended-spectrum beta-lactamase producing bacteria from animal origin A systematic review and meta-analysis report from India. PloS One. 2019;14:e0221771. doi: 10.1371/journal.pone.0221771. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Leverstein-van Hall MA, Dierikx CM, Cohen Stuart J, Voets GM, Van Den Munckhof MP, van Essen-Zandbergen A. Dutch patients; retail chicken meat and poultry share the same ESBL genes; plasmids and strains. Clin. Microbiol. Infect. 2011;17:873–880. doi: 10.1111/j.1469-0691.2011.03497.x. [DOI] [PubMed] [Google Scholar]
- Li J, Ma Y, Hu C, Jin S, Zhang Q, Ding H, Cui S. Dissemination of cefotaxime-M-producing Escherichia coli isolates in poultry farms; but not swine farms; in China. Foodborne Pathog. Dis. 2010;7:1387–1392. doi: 10.1089/fpd.2010.0581. [DOI] [PubMed] [Google Scholar]
- Mobasseri G, The CSJ, Ooi PT, Tan SC, Thong KL. Molecular characterization of multidrug-resistant and extended-spectrum beta-lactamase-producing Klebsiella pneumoniae isolated from swine farms in Malaysia. Microb. Drug Resist. 2019;25:1087–1098. doi: 10.1089/mdr.2018.0184. [DOI] [PubMed] [Google Scholar]
- Momtaz H, Rahimi E, Moshkelani S. Molecular detection of antimicrobial resistance genes in E coli isolated from slaughtered commercial chickens in Iran. Vet. Med. 2012;57:193–197. [Google Scholar]
- Overdevest I, Willemsen I, Rijnsburger M, Eustace A, Xu L, Hawkey P, Kluytmans J. Extended-spectrum β-lactamase genes of Escherichia coli in chicken meat and humans; The Netherlands. Emerg. Infect. Dis. 2011;17:1216–1222. doi: 10.3201/eid1707.110209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pehlivanlar Önen S, Aslantaş Ö, Şebnem Yılmaz E, Kürekci C. Prevalence of β-lactamase producing Escherichia coli from retail meat in Turkey. J. Food Sci. 2015;80:M2023–M2029. doi: 10.1111/1750-3841.12984. [DOI] [PubMed] [Google Scholar]
- Rahimi E, Hormozipoor H, Gholami Ahangaran M, Yazdi F Prevalence of Arcobacter species on chicken carcasses during processing in Iran. J. Appl. Poult. Res. 2012;21:407–412. [Google Scholar]
- Rahman SU, Ahmad S, Khan I. Incidence of ESBL-producing Escherichia coli in poultry farm environment and retail poultry meat. Pak. Vet. J. 2019;39:116–120. [Google Scholar]
- Reich F, Atanassova V, Klein G. Extended-spectrum β-lactamase and Ampc-producing Enterobacteria in healthy broiler chickens; Germany. Emerg. Infect. Dis. 2013;19:1253–1259. doi: 10.3201/eid1908.120879. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Roberts MC. Tetracycline resistance determinants: mechanisms of action; regulation of expression; genetic mobility; and distribution. FEMS Mic. Rev. 1996;19:1–24. doi: 10.1111/j.1574-6976.1996.tb00251.x. [DOI] [PubMed] [Google Scholar]
- Sabat G, Rose P, Hickey WJ, Harkin JM. Selective and sensitive method for PCR amplification ofEscherichia coli 16S rRNA genes in soil. Appl. Environ. Microbiol. 2000;66:844–849. doi: 10.1128/aem.66.2.844-849.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Samanta A, Mahanti A, Chatterjee S, Joardar SN, Bandyopadhyay S, Sar TK, Samanta I. Pig farm environment as a source of beta-lactamase or AmpC-producing Klebsiella pneumoniae and Escherichia coli. Ann. Microbiol. 2018;68:781–791. [Google Scholar]
- Sengeløv G, Halling-Sørensen B, Aarestrup FM. Susceptibility of Escherichia coli and Enterococcus faecium isolated from pigs and broiler chickens to tetracycline degradation products and distribution of tetracycline resistance determinants in E. coli from food animals. Vet. Mic. 2003;95:91–101. doi: 10.1016/s0378-1135(03)00123-8. [DOI] [PubMed] [Google Scholar]
- Smet A, Martel A, Persoons D, Dewulf J, Heyndrickx M, Catry B, Butaye P. Diversity of extended-spectrum β-lactamases and class C β-lactamases among cloacal Escherichia coli isolates in Belgian broiler farms. Antimicrob. Agents Chemother. 2008;52:1238–1243. doi: 10.1128/AAC.01285-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Teimuri S, Gholami-Ahangaran M, Shakerian A. The comparison of enrofloxacin residue in chicken and turkey meat; by high performance liquid chromatography in Isfahan province. Iran. Food Hyg. 2008;8:95–100. [Google Scholar]
- Xu L, Shabir S, Bodah T, McMurray C, Hardy K, Hawkey P, Nye K. Regional survey of CTX-M type extended-spectrum β-lactamses among Entero-bacteriaceae reveals heterogenecity in the distribution of the ST131 clone. J. Antimicrob. Chemother. 2011;66:505–511. doi: 10.1093/jac/dkq482. [DOI] [PubMed] [Google Scholar]
- Yazdi M, Nazemi A, Mirinargasi M, Khataminejad MR, Sharifi S, Babaikochkaksaraei M. Prevalence of SHV/CTXM/TEM (ESBL) beta-lactamase resistance genes in Escherichia coli isolated from urinary tract infections in Tehran; Iran. Iran. Med. Lab. J. 2010;4:67–73 (persian). [Google Scholar]