Phylogenetic Characterization of Genotype 4 Hepatitis C Virus Isolates from Argentina

Abstract

Among 114 patients infected with hepatitis C virus, three genotype 4 isolates, unusual in Argentina, were detected by phylogenetic analysis over different genomic regions. The patients were not related. One sample was associated with Egyptian sequences, and the others were associated with a Zairean isolate, a fact which reinforces the idea that they are from independent sources.

Hepatitis C virus (HCV) is the major causative agent of chronic liver disease in developed countries. It belongs to the Flaviviridae family and has a positive-sense RNA genome and high mutation rate of its own. Different isolates show substantial nucleotide sequence variability distributed throughout the viral genome. This variability gives us the opportunity to classify the virus in six phylogenetically distinct groups, which have been previously denominated genotypes but are now described as clades 1 to 6 for standarization (19). Clades 1, 2, 4, and 5 may correspond to genotypes 1, 2, 4, and 5, while clades 3 and 6 may comprise the seven remaining genotypes.

Research to relate specific genotype groups to the outcome of infection has been done. Some associate genotypes with a predominant transmission route (15) or a particular interferon resistance profile (9).

It has been observed that the genotypes have a particular geographic distribution. Some seem to have spread worldwide (genotypes 1a, 1b, 2a, and 2c), while others have been found in very specific regions only (genotypes 5a, 6a, and 4).

Genotyping is a marker frequently required for the study and follow-up of patients chronically infected with HCV. Therefore, for regular monitoring, the HCV genotypes of isolates from 114 infected patients were determined by using the conventional methods of the line probe assay (24) and/or restriction fragment length polymorphism analysis (25). These procedures were carried out when the patients started their antiviral treatments. The ensuing general epidemiological pattern (genotype 1, 61.4% of isolates; genotype 2, 12.3%; genotype 3, 23.7%; genotype 4, 2.6%) squared with the prevalence previously reported in Argentina (7, 13, 16). Yet, it should be noted that three samples, which were denominated AR45, AR46, and AR47, turned out to be genotype 4.

Genotype 4 has been reported to be the most prevalent genotype in Central Africa, the Middle East, and Egypt but not in Western countries. Surprisingly, there is an unexpectedly high prevalence of genotype 4 in southern Spain (20) among intravenous drug users (IDUs).

In Argentina, several studies have ruled out the presence of this genotype (7, 14, 17). Only one study, which enrolled hemophiliac patients and used restriction fragment length polymorphism analysis for genotyping, has shown a small proportion of patients coinfected with multiple HCVs of different genotypes, including genotypes 4 and 5 (16).

There has been some argumentation over the most useful way to identify and assign genotypes of HCV, but now there is a consensus that the most suitable procedure involves comparisons based on phylogenetic analyses of nucleotide sequences of at least two coding regions (19).

The present phylogenetic study was performed for clear classification and also to allow a direct comparison of the evolutionary relationships of the three isolates that correspond to an unusual genotype in Argentina. Different genomic regions of these isolates were amplified and sequenced: NS5b, the core, and also the 5′ untranslated region (5′UTR). Viral RNA was reverse transcribed and amplified with the primers and parameters indicated in Table 1, according to Kwok and Higuchi's recommendations (10). Amplified DNA was purified and directly sequenced with a Thermo Sequenase radiolabeled terminator cycle sequencing kit (USB Corporation, Cleveland, Ohio) along both chains. Confirmatory sequencing was performed on reamplified DNA. The sequences obtained and sequences of representatives of the six HCV clades which were previously employed for standarization of genotyping (19) were used to reconstruct the phylogenetic trees with programs from the PHYLIP package (Neighbor and Seqboot) (6) and fastDNAml (5, 12).

TABLE 1.

Reverse transcription and PCR amplification parameters and primers

Region	Reactiona	Primer	Primer reference	Parameters
NS5b	RT	Random primers		90 min at 37°C
	PCR	5′ CTSGTCATAGCCTCCGTGAA 3′, positions 8294 to 8274; 5′ ATGATACCCGMTGCTTTGAC 3′, positions 7916 to 7935	Modified from reference 4	5 min at 94°C; 30 cycles of 1 min at 94°C, 1 min at 50°C, and 2 min at 72°C; and a final extension of 10 min at 72°C
Core	RT	Random primers		90 min at 37°C
	First-round PCR	5′ CTCCCGAACGCAGGGCAC 3′, positions 696 to 679; 5′ CGAAAGGCCTTGTGGTACTG 3′, positions −70 to −51	This paper	The same as for NS5b PCR
	Second-round PCR	5′ ATGCTTGAGTTGGAGCAGTCG 3′, positions 635 to 615; 5′ TTGTGGTACTGCCTGATAGGGT 3′, positions −61 to −40	This paper	The same as for NS5b PCR
5′ UT	RT	Random primers		90 min at 37°C
	PCR	5′ GGTGCACGGTCTACGAGACCT 3′, positions −1 to −21; 5′ CTGTGAGGAACTACTGTCTTCACGC 3′ positions −298 to −273	Modified from reference 24	5 min at 94°C; 40 cycles of 30 s at 94°C, 30 s at 55°C, and 45 s at 72°C; and a final extension of 7 min at 72°C

^aRT, reverse transcription. 

The different methods, which were applied to the different genomic regions, yielded congruent topologies (all of them assigned the three isolates to clade 4). The best clustering and robustness of the trees were achieved when we used the complete core region (positions 1 to 585) and a fragment of 304 nucleotides (nt) of NS5b (positions 7955 to 8259) (Fig. 1). Nucleotide positions were numbered according to the work of Choo et al. (3).

FIG. 1.

Maximum-likelihood analysis (fastDNAml) of representative HCV sequences (designation [GenBank accession numbers]: ED43 [Y11604], BEBE1 [D50409], EUH1480 [Y13184], EUHK2 [Y12083], HC-G9 [D14853], HC-J6 [D00944], HC-J8 [D10988], HCV-1 [M62321], HCV-J [D90208], JK046 [D63822], HCV-Tr [E10839], JK049 [D63821], NZL1 [D17763]) and the three isolates reported in this work (AR45, AR46, and AR47). The bootstrap value of neighbor-joining congruent trees is indicated for each genetic group. The branch lengths of the phylogenetic tree are proportional to the genetic distances. (A) Phylogenetic tree obtained by using the complete core region (positions 1 to 585); (B) phylogenetic tree obtained by using a fragment of 304 nt of NS5b (positions 7955 to 8259).

Although the 5′UTR is the most conserved region in the HCV genome, it was possible to identify many of the different genotypes from phylogenetic analysis with this genomic fragment (positions −251 to −72). However, clade 6 was not clearly defined, and the general robustness of the groups was lower than that obtained with the NS5b or core fragment (not shown).

Besides the variety of HCV genotypes, there is considerable diversity among isolates with the same genotype. In genotype 4 several subtypes have already been identified (1, 11, 13), even in the same geographic region where this virus type preponderates (8, 18, 23).

Further analysis was done to delve into the evolutionary relationships among the Argentinian isolates themselves and with other previously described genotype 4 viruses from different geographical areas. It has been taken into account that not all the sequences of genotype 4 available at present comprise both the core and NS5b regions. Therefore, phylogenetic comparison included, on the one hand, some sequences which comprised a common fragment of 222 nt of the NS5b region (positions 7975 to 8196) and, on the other hand, those isolates that shared a 210-nt sequenced fragment of the core gene (positions 39 to 248) (Fig. 2).

FIG. 2.

Maximum-likelihood analysis (fastDNAml) of representative HCV genotype 4 sequences (from Egypt, EG13, EG19 [21], EG21, EG29, EG33 [20], and ED43 [2]; from Zaire, DK13, Z6, and Z7 [1]; from Gabon, GB48, GB116, GB215, GB358, GB438, GB549, and GB809 [22]) and the three Argentinian isolates AR45, AR46, and AR47. The bootstrap values of neighbor-joining congruent trees are indicated. The horizontal branch lengths of the phylogram are proportional to the genetic distances. (A) Phylogenetic tree obtained by using a 210-nt sequenced fragment of the core region (positions 39 to 248); (B) phylogenetic tree obtained by using a 222-nt fragment of the NS5b region (positions 7975 to 8196).

The analysis of the NS5b fragment indicated that isolate AR45 was related to the Egyptian sequences EG13, EG19 (22), and ED43 (2). The association with Egyptian samples was also observed when the core fragments were compared, but in this case the available Egyptian sequences were EG21, EG29, EG33 (21) (collected in the same survey in which EG13 and EG19 were collected), and ED43.

As for isolate AR46, it was closely related to sample DK13 from Zaire (1) when the analysis was performed with the core fragment. This published sequence, described as subtype 4b, did not comprise an NS5b region and no related isolate was found previously (23). So sample AR46 appeared in the NS5b phylogenetic tree associated only with another Argentinian sample, AR47. The core fragment of this last sample could not be amplified.

These results suggest that at least two sources of infection were detected in the three Argentinian samples. One of them involved sample AR45. Samples AR46 and AR47 were genetically related, so a common source could not be ruled out in this case.

The patients, who attended the same hospital, were not related. Even though the majority of HCV genotype 4-harboring individuals in Spain were IDUs, our three patients did not display a common route of infection. Only one of them was an IDU, while a second patient was a health care worker. The third patient had only a tatoo as a risk factor. Moreover, the three patients denied having traveled to areas of endimicity. These facts reinforce the hypothesis that not all of the isolates had a common source.

It should be observed that the virus did not appear to be restricted to any specific population (such as the IDUs in Spain). In addition to this, Sánchez Quijano et al. (20) reported that most of the genotype 4 infections were detected in patients with troublesome genotyping and were exposed when a special procedure was applied. Therefore, the prevalence of genotype 4 in Argentina might be higher than expected.

In conclusion, three independent cases of HCV clade 4 infections were reported in Argentina, a country where this genetic group is infrequent. A phylogenetic characterization of these isolates was carried out based on the core, NS5b, and 5′UTR subgenomic regions. Genetic characteristics, reinforced by epidemiological aspects, indicated the existence of at least two sources of infection in the three cases. The coexistence of diverse subtypes of this genotype is described for regions which display a high prevalence of genotype 4 infections. Argentina has had a low prevalence of this HCV genotype up to now. Future detection of genotype 4 in this area may deserve special attention.

Nucleotide sequence accession numbers.

The GenBank accesion numbers for the sequences reported in this work are AF308573 to AF308580.