Abstract
Purpose. To explore the relationship between the death receptor (DR) and the pathological progression of Kashin-Beck disease (KBD). Design. KBD cartilage samples were collected from 15 patients diagnosed according to the “National Diagnostic Criteria of KBD” in China. In vitro monolayer chondrocytes were cultured in complete medium. Caspase-3 and caspase-8 activities in chondrocytes were analyzed using a kit. Nuclear morphology was observed by Hoechst 33258 staining, apoptosis was verified by flow cytometry analysis, and DR molecules were detected using Western blotting and quantitative real-time reverse transcription polymerase chain reaction analysis. Results. Early apoptotic rates of KBD and osteoarthritis (OA) chondrocytes were higher than those of normal control (NC) cells. Excessive apoptotic nuclei were observed in OA and KBD cells after Hoechst 33258 staining. Activities of both caspase-3 and caspase-8 were higher in KBD and OA cells than in NC cells. The average DR4 mRNA level in KBD cells was 3.301-fold higher than that in NC cells, Fas-associating protein with death domain (FADD) transcript level in KBD cells was 2.528-fold higher than that in NC cells. Western blot analyses showed that FAS, DR4, DR5, caspase-3, and FADD were upregulated in the KBD and OA groups compared with the NC group. High expression of caspase-8 in KBD compared with NC was verified, whereas cellular FLICE-inhibitory protein (c-FLIP) in KBD was significantly downregulated. Conclusions. KBD and OA chondrocytes showed obvious FADD-caspase-dependent apoptosis, which is related to the DR pathway. Apoptosis in KBD articular cartilage is mainly related to FAS/DR4-FADD-caspase signaling, and OA is associated with FAS/DR4/DR5-FADD-caspase signaling.
Keywords: Kashin-Beck disease, osteoarthritis, death receptor, apoptosis, pathogenesis
Introduction
Kashin-Beck disease (KBD) is a unique joint disease endemic to China, with 177,000 cases at the end of 2018. 1 KBD is related to necrosis in deep cartilage, though the pathological progression remains unclear. Currently, apoptosis is believed to consist of 4 major pathways 2 : the mitochondrial pathway, DR pathway, JNK/P38 pathway, and endoplasmic reticulum stress pathway. These 4 signaling pathways interact to form a complex apoptotic signal network.
Using gene chip technology combined with quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR), researchers have found obvious differences in gene expression profiles between normal cartilage and KBD cartilage. The main mechanisms of KBD cartilage destruction are cartilage metabolism and apoptosis. 3 Additionally, some gene chip studies have shown differences in gene expression profiles between osteoarthritis (OA) and KBD.4,5 For example, 195 genes and 38 genes in the KBD group were significantly upregulated and downregulated, respectively, compared with those in the OA group. Differentially expressed genes associated with apoptosis have also been found, and the results suggest that KBD cartilage destruction might be mainly related to cartilage matrix metabolism, degeneration, and chondrocyte apoptosis. Although the pathogeneses of KBD and OA are related to apoptosis, the pathological mechanisms of KBD and OA differ significantly.
Ingenuity pathway analysis and hub gene analysis have shown that selenium metabolism and apoptosis contribute to the pathogenesis of KBD through the MYC-mediated signaling pathway. 6 Fas-associating protein with death domain (FADD) protein expression in KBD cartilage tissue is significantly higher than that in both normal control (NC) cartilage tissue and in OA. 7 These results suggest that the expression of each key signaling molecule in the death receptor (DR) pathway changes significantly in KBD.
However, there are few studies to date reporting on which apoptosis pathway participates in the progression of KBD cartilage injury. Therefore, this study examined the pathways related to chondrocyte apoptosis, such as the mitochondrial and JNK-P38 pathways,8,9 though the role of the DR in early cartilage destruction is unknown. Herein, we identify the link between the DR and KBD.
Materials and Methods
Sources of Cartilage Samples
In total, 15 KBD patients were diagnosed with second- and third-degree disease based on the National Diagnostic Criteria of KBD (WS/T 207-2010, Ministry of Health, People’s Republic of China; Table 1 ) and Hematoxylin-Eosin (HE) histological verification. Diagnostic criteria 10 : (1) the patient who has resided in a KBD area at least 6 months, symptoms, signs, and the X-ray; (2) abnormal changes of X-ray include multiple symmetrical depressions, sclerosis, destruction and deformation of the metacarpophalangeal or and wrist joints, and in metaphyseal calcification zone of phalanges, and excluded the osteoarthritis and rheumatoid arthritis and (3) abnormal changes of at distal end of the middle and proximal phalanges in X-ray films.
Table 1.
Different Stages of Kashin-Beck Disease.
| Degree | Clinical Manifestation |
|---|---|
| 1 | Multiple symmetrical swollen finger joints, or other 4 limbs joints swollen, limited flexion and extension activities, pain, mild muscle atrophy. |
| 2 | Based on degree 1, both symptoms and signs are aggravated, short finger (toe) deformities. |
| 3 | Based on degree 2, symptoms and signs are aggravated, short limbs, dwarf. |
Samples of KBD cartilage were collected from those who underwent total knee arthroplasty (TKA) or debridement (9 males and 6 females, average age 57 years). In addition, 25 OA cartilage samples were obtained from tissue discarded during TKA (14 males and 11 females, average age 59 years). Ten healthy cartilage samples were collected from patients with irreparable articular cartilage injury (5 males and 4 females, average age 37 years). This retrospective investigation was approved by the Institutional Review Board of Xi’an JiaoTong University. Documents of informed consent for each sample were signed by KBD patients and their family members.
In Vitro Chondrocyte Culture
Each cartilage sample was immediately placed in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) and cleared using phosphate-buffered saline (PBS). Chondrocytes were extracted from the articular cartilage extracellular matrix and then cultured using previously described methods. 9 Primary cells and second-passage cells were used in all experiments.
Measurement of Caspase-3 and Caspase-8 Activities
Changes in the enzyme activity of caspase-3 and caspase-8 were detected using Caspase-3 Activity Assay Kit (C1115, Beyotime, Jiangsu, China) and Caspase-8 Activity Assay Kit (C1152, Beyotime, Jiangsu, China). Absorbance at 450 nm was measured using an Infinite F200 PRO microplate reader (Tecan, Switzerland).
Hoechst 33258 Staining Assay
Nuclear morphological changes were determined by Hoechst 33258 staining assays and fluorescence microscopy. First, more than 80% of single-layer adherent chondrocytes were mixed, digested with 0.25% trypsin (containing 0.02% EDTA-Na2), washed with PBS and centrifuged; this procedure was repeated 3 times to prepare a cell suspension, A clean coverslip was soaked in 75% absolute ethanol for 30 minutes, rinsed with sterile PBS 3 times on a clean bench, and placed in a 6-well plate. Second, Hoechst 33258 staining solution (5 μg/mL) was prepared according to the instruction manual (Beyotime, Jiangsu, China) in the dark, filtered using a Millipore sterile needle filter(diameter = 0.22 μm) and stored at 4°C. Third, the culture solution was discarded when 80% of the chondrocytes had attached to the coverslip, and the chondrocytes in each well were mixed with 0.5 mL of 4% paraformaldehyde at room temperature for 15 minutes and rinsed twice with PBS or 0.9% saline for 3 minutes each time. The chondrocytes in each well were stained with 5 mL Hoechst 33258 solution at room temperature for 5 minutes and observed under a fluorescence microscope (excitation wavelength: 350 nm); image acquisition was performed immediately.
Flow Cytometry
For observation of apoptotic cells in the KBD, OA, and NC groups, chondrocytes were labeled with annexin V-FITC and propidium iodide (PI), and the fluorescence signal was detected by FACS Calibur flow cytometry (Becton Dickinson, USA) to quantitatively analyze the early apoptotic rate. The entire procedure was performed according to the manual for Annexin V-FITC Apoptosis Detection Kit (KeyGen Biotech Co., Nanjing, China).
Detection of DR Protein Expression by Western Blotting
Extraction of cellular proteins was executed according to the procedure for Cell RIPA Lysate Kit (Walson Biosystems, Xian, China). The cellular protein concentration was determined by measuring absorbance at 595 nm using an ND-1000 full wavelength spectrophotometer according to Bradford Protein Assay Kit (No. P0006, Biyuntian, Jiangsu, China). The protein samples (80 µg) were mixed with loading buffer (1:4) and denatured at 100°C for 5 minutes, followed by 12% sodium dodecyl sulfate (SDS)–polyacrylamide gels electrophoresis at 100 V for approximately 60 minutes using a Hoefer Vertical Slab Gel Unit Electrophoresis system (SE600, Hoefer Scientific, USA). The separated proteins were transferred to polyvinylidene difluoride (PVDF) membranes in buffer at 350 mA for 90 minutes. The membranes containing target proteins were blocked with 5% nonfat dry milk in Tris-HCl buffer for 2 hours at room temperature. Primary antibodies (rabbit monoclonal anti-FAS at 1:1000 dilution, rabbit monoclonal anti-FADD at 1:1000 dilution, rabbit monoclonal anti-FLIP at 1:1000 dilution, rabbit monoclonal anti-caspase-3 at 1:1000 dilution, rabbit monoclonal anti-caspase-8 at 1:1000 dilution, CST, USA; rabbit polyclonal anti-DR4 at 1:1000 dilution, rabbit monoclonal anti-DR5 at 1:1000 dilution, Abcam, USA; rabbit polyclonal anti-β-actin at 1:2500 dilution, Bioworld, USA) were incubated with the membranes in 0.05% TBST (0.5 mL Tween-20, 1000 mL Tris-buffered saline [TBS]) at 4°C overnight and then with horseradish peroxidase (HRP)–conjugated goat anti-rabbit IgG. Chemiluminescent HRP Substrate (Millipore, USA) was used to detect the protein-antibody complexes. Densitometric analysis of JPE files was performed using Gel-Pro Analyzer software, and the ratio of integrated optical density (IOD) for the target protein and β-actin was calculated for relative quantitative analysis.
Detection of DR Gene Expression
Total RNA was collected from cultured cells using the TRIzol method (Invitrogen; Thermo Fisher Scientific, Inc.), and the 260 nm/280 nm OD value and concentration of total RNA were determined using an ND-1000 ultraviolet ultra-differential photometer (NanoDrop, USA). cDNA was obtained by reverse transcription using a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA), and fluorogenic quantitative PCR was utilized to amplify the cDNA with a qPCR Detection System (Bio-Rad Laboratories, USA). TaKaRa designed and synthesized the primers, as follows: caspase-8—forward CTCCCCAAACTTGCTTTATG and reverse AAGACCCCAGAGCATTGTTA; caspase-3—forward GAGTGCTCGCAGCTCATACCT and reverse CCTCACGGCCTGGGATTT; DR4—forward CTACCTCCATGGGACAGCAC and reverse TGCAGCTGAGCTAGGTACGA; DR5—forward AAGACCCTTGTGCTCGTTGT and reverse AGGTGGACACAATCCCTCTG; FAS—forward TGCACCCGGACCCAGAATACCA and reverse AAGAAGAAGACAAAGCCACCCCAAGTTAGA; FADD—forward GGCTCGTCAGCTCAAAGTCTC and reverse TGCGTTCTCCTTCTCTGTGTTC; c-FLIP—forward GTCTCACAGCTCACCATCCCTGTA and reverse TCTAGTAAGATGCATCCGAGGCTTG; GAPDH—forward TGCACCACCAACTGCTTAGC and reverse GGCATGGACTGTGGTCATGAG.
Statistical Analysis
All the results are shown as the mean ± standard deviation. The 3 sets of data were analyzed by a completely random-design analysis of variance (ANOVA). Differences among multiple samples were tested by the LSD (least significant difference) multiple comparison method. Nonparametric chi-square tests were used when data were not normally distributed or when the variance was not uniform. Analyses were performed using SPSS 17.0 software. P ≤ 0.05 and P ≤ 0.01 were considered significant and highly significant, respectively.
Results
Expression of Caspases in Chondrocytes
Significant differences in caspase-8 enzyme activity were observed among the NC group (10.52 ± 1.70 μmol/L), OA group (32.36 ± 8.53 μmol/L), and KBD group (65.55 ± 6.91 μmol/L) (F = 19.039, P = 0.001). Caspase-8 enzyme activity in KBD chondrocytes was significantly higher than that in NC and OA chondrocytes (P = 0.001 and P = 0.003, respectively). In addition, caspase-8 activity in the OA group was higher than that in the NC group (P = 0.032). Significant differences in caspase-3 activity were also observed among the NC (7.56 ± 2.48 μmol/L), OA (22.93 ± 1.28 μmol/L), and KBD (25.33 ± 1.45 μmol/L) groups (F = 168.733, P = 0.001). Caspase-3 activity in OA and KBD group chondrocytes was significantly higher than that in NC chondrocytes (P = 0.001), and activity in the KBD group was higher than that in the OA group (P = 0.037) (see Fig. 1 ).
Figure 1.
Caspase-8 (left) and caspase-3 (right) expression among the 3 groups. (*indicates P < 0.05, **indicates P < 0.01).
Morphological Changes in Apoptotic Cells
Under fluorescence microscopy, the nuclei of NC chondrocytes exhibited an elliptical or irregular shape with uniform blue fluorescence ( Fig. 2a ), whereas the OA and KBD chondrocytes appeared dense, plaque-like, and bright blue. Overall, the fluorescence color, cell size, and nuclear morphogenesis changed significantly (red arrow in Fig. 2b and 2c ), indicating excessive apoptotic nuclei in the OA and KBD groups, though no classical morphological changes, such as apoptotic bodies, were observed.
Figure 2.
Chondrocyte nuclear fluorescence staining: (a) normal control (NC) cells, (b) osteoarthritis (OA) cells, and (c) Kashin-Beck disease (KBD) cells; ×100.
Apoptotic Ratios for 3 Groups
To observe the general situation of KBD, OA, and NC chondrocyte apoptosis, we labeled the chondrocytes with annexin V-FITC and propidium iodide (PI) and detected fluorescence signals by flow cytometry to quantitatively analyze the early stage of chondrocyte apoptosis. Because of the unevenness of the data in the 3 groups, nonparametric test analysis was performed, showing that the early apoptotic rates of the 3 groups of cells differed significantly (χ2 = 5.873, P = 0.025). Specifically, early apoptotic cells were increased in KBD chondrocytes (17.63% ± 5.22%) and OA chondrocytes (22.24% ± 12.31%) (P = 0.021 and P = 0.021, respectively) compared with normal chondrocytes, though apoptosis was not significantly different between the KBD and OA groups (P > 0.05).
Key Proteins in the Apoptosis Pathway
Cumulative OD analysis of Western blot bands revealed significant differences in FAS protein expression among the NC, OA, and KBD groups (F = 9.405, P = 0.001). LSD (least significant difference) t test results showed that expression of the FAS membrane protein in the KBD and OA groups was significantly upregulated compared with that in the NC group (P = 0.001 and P = 0.021, respectively). However, there was no significant difference in expression between the OA and the KBD groups (P = 0.050).
DR4 membrane protein expression also differed significantly among the NC, OA, and KBD groups (F = 4.099, P = 0.028). The DR4 protein level in chondrocytes of the OA and KBD groups was higher than that in the NC group (P = 0.011 and P = 0.045), but there was no significant difference between the OA and KBD groups (P = 0.536).
In addition, nonparametric test results showed that DR5 membrane protein expression in the NC, OA, and KBD groups was significantly different (χ2 = 16.609, P = 0.001), with a significantly higher level in the KBD group than that in the NC group (P = 0.001). The DR5 level in the OA group was higher than that of the NC group (P = 0.024), though the difference between the KBD and OA groups was not significant (P > 0.05).
The relative level of caspase-8 expression was also quantitatively analyzed, and the nonparametric test showed that there were significant differences among the NC, OA, and KBD chondrocytes (χ2 = 4.638, P = 0.014). Expression of caspase-8 in the KBD group was significantly higher than that in the NC group (P = 0.004), but there was no significant difference between the NC and OA groups or the OA and KBD groups (P = 0.125 and P = 0.143, respectively).
Western blot cumulative optical density analysis of caspase-3 demonstrated statistically significant differences among the NC, OA, and KBD groups (F = 2.744, P = 0.001). Although expression of caspase-3 in the OA group was significantly higher than that in the NC chondrocyte group (P = 0.001 and P = 0.006), there was no significant difference between the KBD and OA groups (P > 0.05).
Furthermore, relative quantitative analysis of FADD protein levels showed significantly different expression in NC, OA, and KBD chondrocytes (χ2 = 13.911, P = 0.001). The KBD and OA groups had significantly higher levels than did the NC group (P = 0.001 and P = 0.002, respectively), with no difference between the KBD and OA groups (P = 0.638).
Analysis of the c-FLIP protein showed a significant difference among the 3 groups (F = 5.074, P = 0.018).According to the LSD-t test, expression of c-FLIP in the KBD group was significantly lower than that in the NC group (P = 0.005), but there was no significant difference between the NC versus OA groups or the OA versus KBD groups (P = 0.105 and P = 0.157, respectively). The Western blot bands and cumulative optical density analysis results for each target protein are presented in Figure 3 .
Figure 3.
Immunoblot detection and image densitometry analysis. (a) Western blot bands and (b) cumulative optical density analysis results for each target protein molecule tested (*indicates P < 0.05, **indicates P < 0.01).
Changes in Key Genes Among the 3 Groups
DR4 transcript expression in the KBD group was 3.301 times that in the NC group (P = 0.048), and FADD expression in the KBD group was 2.528 times that in the NC group (P = 0.012). Additionally, expression of FAS in the KBD group was 2.407 times higher than that in the NC group(P > 0.05), that of caspase-8 in the KBD group was 1.400 times higher than that in the NC group (P > 0.05), and that of caspase-3 in the KBD group was 1.601 times higher than that in the NC group (P > 0.05). However, the expression level of DR5 was lower than that in the NC group by 0.677 times (P > 0.05), though c-FLIP transcript expression in the KBD group was 0.505 times higher than that in the NC group (P > 0.05). These results indicate that the mRNA expression of DR4 and FADD in the KBD group was significantly upregulated compared with that in the NC group (see Table 2 ).
Table 2.
Gene Expression in Kashin-Beck Disease (KBD) Compared With Normal Controls (NC).
| Gene | ∆Ct(Avg. − Avg.GAPDH)KBD | ∆Ct(Avg. − Avg.GAPDH)NC | ∆∆Ct(Avg∆CtKBD − ∆CtNC) | Fold Change |
|---|---|---|---|---|
| DR4 | 10.236 | 12.049 | –1.723 | 3.301 |
| FAS | 5.629 | 5.661 | –0.033 | 2.407 |
| DR5 | 5.477 | 4.219 | 1.258 | 0.677 |
| FADD | 3.345 | 5.228 | –1.883 | 2.528 |
| c-FLIP | 7.347 | 6.122 | 1.244 | 0.505 |
| Caspase-8 | 3.548 | 3.664 | –0.116 | 1.400 |
| Caspase-3 | 6.023 | 6.645 | –0.622 | 1.601 |
Boldfaced values indicate a P value less than 0.05.
Discussion
Despite many studies on KBD, the precise pathological mechanism is unknown. Many researchers have shown the relationship between arthritis and apoptosis. KBD is a type of special regional arthritis, though it has remained unclear whether the DR is involved in the pathological progression of KBD. The results of this study confirm the relationship between KBD and apoptosis activated by the DR.
DR family proteins, such as FAS, DR4, DR5, DR3, and TNF (tumor necrosis factor), are reported to be closely related to the pathogenesis of OA. Some studies have suggested that the TNF/TNFR system does not cause chondrocyte apoptosis in vitro and that TNF-α antibodies cannot inhibit apoptosis. 11 Therefore, the DR-FADD-dependent complex signaling pathway was selected in this study as one of the main components of KBD injury.
This study revealed that damage in KBD cartilage is associated with DR signaling impairment and that KBD and OA chondrocytes undergo excessive apoptosis, accompanied by upregulated gene and protein levels of intracellular FAS, DR4, caspase-3, caspase-8, and FADD, with decreased c-FLIP expression. However, there were insignificant differences in the expression levels of these molecules in the KBD and OA groups.
The genes encoding DR4/5 (TRAIL-R1/-R2) are located at8p21-22. The encoded DR protein is an important membrane protein of the exogenous apoptosis pathway. These molecules are activated by complementary binding to TRAIL and then transmit a death signal in conjunction with FADD in the cytosol.12,13 TRAIL-induced apoptosis is associated with upregulation of DR4 and DR5 and downregulation of c-FLIP,14,15 and O-glycosylation of DR4 and DR5 promotes receptor aggregation and DISC formation and sensitivity to TRAIL. 16
Chondrocyte apoptosis induced by the TRAIL-DR4/DR5 signaling pathway is associated with the pathological process of OA. 17 For example, DR4 and TRIAL are upregulated and DR5 downregulated in cartilage tissues of induced OA animal models, and these changes are associated with TRIAL-induced apoptosis. 17 The anti-inflammatory analgesic drug ibuprofen also activates TRAIL-induced apoptosis by upregulating DR5 expression. 18 Apoptosis associated with DR signaling is closely related to oxidative stress. DR4 and DR5 activate NADPH oxidase-1 via riboflavin kinase, which in turn induces reactive oxygen species (ROS)–mediated apoptosis. 19 Curcumin can upregulate DR5 via the ROS pathway and induce TRAIL-mediated apoptosis. 20 In general, antioxidants significantly inhibit DR5 upregulation-mediated apoptosis. Another study showed that the JNK signaling pathway can promote apoptosis by upregulating DR5 but that ROS are not involved. 21 Although DR4 and DR5 are structurally highly homologous, when the signal recognition particle complex (SRP) gene is knocked out, DR4 pathway-induced apoptosis is inhibited but DR5 signaling is unaffected, indicating that SRP is a DR4 apoptotic signaling pathway component. The key component of the DR4 death signaling pathway is different from that of the DR5 cell death signaling pathway. 22
In this study, we explored the relationship between DR4 and DR5 expression and the pathogenesis of KBD. RT-PCR analysis showed that the expression level of the DR4 gene in KBD chondrocytes was 3.371 times that in NC chondrocytes. At the protein level, Western blot analysis showed that expression of the DR4 membrane protein in the KBD group was significantly higher than that in the NC group. Furthermore, expression of DR4 was upregulated in the OA group, but there was no significant difference between the OA group and the KBD group. This finding indicates that apoptosis in KBD chondrocytes and OA chondrocytes is closely related to high DR4 expression. The mechanism underlying KBD and OA chondrocyte apoptosis may be related to the DR4 signaling pathway.
In conclusion, we confirmed from different experimental perspectives that KBD chondrocytes undergo excessive apoptosis, with abnormal expression of key molecules of the DR pathway observed at both the gene and protein levels, which suggests that pathological apoptosis and DR signals occur in KBD chondrocytes. These changes may result in enhancement of the pro-apoptotic signal and attenuation of the anti-apoptotic signal. The FAS/DR4-FADD-Caspase signaling pathway is involved in the apoptosis of chondrocytes in KBD and in OA.
Acknowledgments
We acknowledge the funding support from the National Natural Scientific Foundation of China (81620108026) and the Social Development Science and Technology Project of Shaanxi Province (2015SF138).
Footnotes
Declaration of Conflicting Interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Ethical Approval: This retrospective investigation was approved by the Institutional Review Board of Xi’an JiaoTong University.
Informed Consent: Written informed consent for each sample were signed by KBD patients and their family members.
Trial Registration: Not applicable.
References
- 1. National Health Commission of the People’s Republic of China. Statistical Bulletin on the Development of China’s Health Care Industry in 2018 [in Chinese]. Available from: http://www.nhc.gov.cn/guihuaxxs/s10748/201905/9b8d52727cf346049de8acce25ffcbd0.shtml
- 2. Kühn K, D’Lima DD, Hashimoto S, Lotz M. Cell death in cartilage. Osteoarthritis Cartilage. 2004;12(1_suppl):1-16. [DOI] [PubMed] [Google Scholar]
- 3. Wang WZ, Guo X, Duan C, Ma WJ, Zhang YG, Xu P, et al. Comparative analysis of gene expression profiles between the normal human cartilage and the one with endemic osteoarthritis. Osteoarthritis Cartilage. 2009;17(1_suppl):83-90. [DOI] [PubMed] [Google Scholar]
- 4. Duan C, Guo X, Zhang XD, Yu HJ, Yan H, Gao Y, et al. Comparative analysis of gene expression profiles between primary knee osteoarthritis and an osteoarthritis endemic to Northwestern China, Kashin-Beck disease. Arthritis Rheum. 2010;62(3):771-80. [DOI] [PubMed] [Google Scholar]
- 5. Wu S, Duan C, Zhang F, Mckenzie RP, Zheng J, Farooq U, et al. Difference in apoptosis-associated genes expression profiling and immunohistology analysis between Kashin-Beck disease and primary osteoarthritis. Chin Sci Bull. 2014;59(9):833-9. [Google Scholar]
- 6. Wu SX, Wang WZ, Zhang F, Wu CY, Dennis BS, Qu CJ, et al. Expression profiles of genes involved in apoptosis and selenium metabolism in articular cartilage of patients with Kashin-Beck osteoarthritis. Gene. 2014;535(2):124-30. [DOI] [PubMed] [Google Scholar]
- 7. Wu SX, Guo X, Liu JT, Zhang ZT, Dennis BS, Zhang YG. Changes of death receptor regulator expression in the articular cartilage of patients with Kashin-Beck disease [in Chinese]. Nan Fang Yi Ke Da Xue Xue Bao. 2011;31(11):1851-4. [PubMed] [Google Scholar]
- 8. Han J, Guo X, Tan WH, Zhang F, Liu JT, Wang W, et al. The expression of p-ATF2 involved in the chondeocytes apoptosis of an;endemic osteoarthritis, Kashin-Beck disease. BMC Musculoskelet Disord. 2013;14(1_suppl):209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Liu JT, Guo X, Ma WJ, Zhang YG, Xu P, Yao JF, et al. Mitochondrial function is altered in articular chondrocytes of an endemic osteoarthritis, Kashin-Beck disease. Osteoarthritis Cartilage. 2010;18(9):1218-26. [DOI] [PubMed] [Google Scholar]
- 10. National Health Commission of the People’s Republic of China. Diagnosis of Kashin-Beck disease [in Chinese]. Available fromhttp://www.nhc.gov.cn/wjw/s9500/201006/47920.shtml [DOI] [PMC free article] [PubMed]
- 11. Yoshimura F, Kanno H, Uzuki M, Tajima K, Shimamura T, Sawai T. Downregulation of inhibitor of apoptosis proteins in apoptotic human chondrocytes treated with tumor necrosis factor-alpha and actinomycin D. Osteoarthritis Cartilage. 2006;14(5):435-41. [DOI] [PubMed] [Google Scholar]
- 12. Kuang AA, Diehl GE, Zhang J, Winoto A. FADD is required for DR4- and DR5-mediated apoptosis: lack of trail-induced apoptosis in FADD-deficient mouse embryonic fibroblasts. J Biol Chem. 2000;275(33):25065-8. [DOI] [PubMed] [Google Scholar]
- 13. Schneider P, Thome M, Burns K, Bodmer JL, Hofmann K, Kataoka T, et al. TRAIL receptors 1 (DR4) and 2 (DR5) signal FADD-dependent apoptosis and activate NF-κB. Immunity. 1997;7(6):831-6. [DOI] [PubMed] [Google Scholar]
- 14. Kim SY, Kim JH, Song JJ. c-Cbl shRNA-expressing adenovirus sensitizes TRAIL-induced apoptosis in prostate cancer DU-145 through increases of DR4/5. Cancer Gene Ther. 2013;20(2):82-7. [DOI] [PubMed] [Google Scholar]
- 15. Zhuang H, Jiang WW, Zhang XY, Qiu F, Gan Z, Cheng W, et al. Suppression of HSP70 expression sensitizes NSCLC cell lines to;TRAIL-induced apoptosis by upregulating DR4 and DR5 and downregulating c-FLIP-L expressions. J Mol Med (Berl). 2013;91(2):219-35. [DOI] [PubMed] [Google Scholar]
- 16. Wagner KW, Punnoose EA, Januario T, Lawrence DA, Pitti RM, Lancaster K, et al. Death-receptor O-glycosylation controls tumor-cell sensitivity to the proapoptotic ligand Apo2L/TRAIL. Nat Med. 2007;13(9):1070-7. [DOI] [PubMed] [Google Scholar]
- 17. Lee SW, Lee HJ, Chung WT, Mee CS, Rhyu SH, Kim DK, et al. TRAIL induces apoptosis of chondrocytes and influences the pathogenesis of experimentally induced rat osteoarthritis. Arthritis Rheum. 2004;50(2):534-42. [DOI] [PubMed] [Google Scholar]
- 18. Todo M, Horinaka M, Tomosugi M, Tanaka R, Ikawa H, Sowa Y, et al. Ibuprofen enhances TRAIL-induced apoptosis through DR5 upregulation. Oncol Rep. 2013;30(5):2379-84. [DOI] [PubMed] [Google Scholar]
- 19. Park KJ, Lee CH, Kim A, Jeong KJ, Kim CH, Kim YS. Death receptors 4 and 5 activate Nox1 NADPH oxidase through riboflavin kinase to induce reactive oxygen species-mediated apoptotic cell death. J Biol Chem. 2012;287(5):3313-25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Jung EM, Lim JH, Lee TJ, Park JW, Choi KS, Kwon TK. Curcumin sensitizes tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis through reactive oxygen species-mediated upregulation of death receptor 5 (DR5). Carcinogenesis. 2005;26(11):1905-13. [DOI] [PubMed] [Google Scholar]
- 21. Lei FU, Lin YD, Elrod HA, Ping Y, Oh Y, Bo L, et al. c-Jun NH2-terminal kinase-dependent upregulation of DR5 mediates cooperative induction of apoptosis by perifosine and TRAIL. Mol Cancer. 2010;9(1_suppl):315. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Ren YG, Wagner KW, Knee DA, Aza-Blanc P, Nasoff M, Deveraux QL. Differential regulation of the TRAIL death receptors DR4 and DR5 by the signal recognition particle. Mol Biol Cell. 2004;15(11):5064-74. [DOI] [PMC free article] [PubMed] [Google Scholar]



