REAGENT or RESOURCE	SOURCE	IDENTIFIER
Bacterial and virus strains
Escherichia coli OP-50	NemaMetrix Co. Ltd.	LabTIE OP-50 V.2
Chemicals, peptides, and recombinant proteins
3.4-Dihydroxyphenethylamine Hydrochloride	FUJIFILM Wako Pure Chemical Corporation	4987481383029
polyethylene microsphere beads	Cospheric LLC	WPMS-1.00 ɸ250-300 μm (1.00 g / cc
DNase I (RNase-free)	Takara Bio	2270A
Western Lightning Plus-ECL chemifluorescence kit	PerkinElmer	NEL103001EA
TRI reagent	Molecular Research Center	TR 118200ML
PrimeScript RT Reagent Kit with gDNA Eraser	Takara Bio	RR047A
C. elegans Oligo Microarray 44 k version 2.0	Agilent Technologies	https://www.chem-agilent.com/contents.php?id=29452
Critical commercial assays
Dopamine ELISA kit - Research	ImmuSmol	BA-E-5300
Deposited data
C. elegans Microarray data (CERISE exp)	Higashibata et al., 2016	GEO: GSE71770
C. elegans Microarray data (EPIGENETICS exp)	Higashitani et al., 2021	GEO: GSE173985
Experimental models: Organisms/strains
C. elegans: Strain: N2 (WT).	Caenorhabditis Genetics Center	WB Strain: 00000001
C. elegans: Strain LX703: dop-3 (vs106).	Caenorhabditis Genetics Center	WB Strain: 00026374
C. elegans: Strain LX645: dop-1 (vs100).	Caenorhabditis Genetics Center	WB Strain: 00026369
C. elegans: Strain TG2435: vtIs1 [Pdat-1::GFP + rol-6].	Caenorhabditis Genetics Center	WB Strain: 00034694
C. elegans: Strain ATU2301: goeIs3 [Pmyo-3::GCaMP3.35::unc-54-3'utr, unc-119(+)] aceIs1 [Pmyo-3::mitochondrial LAR-GECO + Pmyo2::RFP].	This paper	N/A
Oligonucleotides
Forward Primer for comt-4: 5’ CGCTGCGATTCACGAGATG,	This paper	N/A
Reverse Primer for comt-4: 5’ GAAGCGCCGAGTAGGTACGAT	This paper	N/A
Forward Primer for eef-2: 5’ GACGCTATCCACAGAGGAGG,	This paper	N/A
Reverse Primer for eef-2: 5’ TTCCTGTGACCTGAGACTCC	This paper	N/A
Recombinant DNA
transgene aceIs1 [Pmyo-3::mitochondrial LAR-GECO + Pmyo2::RFP]	This paper	N/A
transgene goeIs3 [Pmyo-3::GCaMP3.35::unc-54-3'utr, unc-119(+)]	Caenorhabditis Genetics Center	WBTransgene00018927
transgene vtIs1 [Pdat-1::GFP + rol-6]	Caenorhabditis Genetics Center	WBTransgene00004906
Software and algorithms
CellSens imaging software	Olympus	CellSens Standard 2.2
ImageJ for fluorescent image analysis	NIH	https://imagej.nih.gov/ij/
one-way ANOVA followed by Tukey post hoc tests for statistics	RStudio Software	https://www.rstudio.com/products/rstudio/
Microsoft Excel 2019 for data presentation	Microsoft	https://www.microsoft.com/