Skip to main content
American Journal of Physiology - Endocrinology and Metabolism logoLink to American Journal of Physiology - Endocrinology and Metabolism
. 2021 Dec 27;322(2):E181–E196. doi: 10.1152/ajpendo.00382.2021

Tissue-specific responses that constrain glucose oxidation and increase lactate production with the severity of hypoxemia in fetal sheep

Amanda K Jones 1, Dong Wang 1, David A Goldstrohm 1, Laura D Brown 1, Paul J Rozance 1, Sean W Limesand 2, Stephanie R Wesolowski 1,✉
PMCID: PMC8816623  PMID: 34957858

graphic file with name e-00382-2021r01.jpg

Keywords: fetal, hypoxemia, hypoxia, insulin, lactate, metabolism

Abstract

Fetal hypoxemia decreases insulin and increases cortisol and norepinephrine concentrations and may restrict growth by decreasing glucose utilization and altering substrate oxidation. Specifically, we hypothesized that hypoxemia would decrease fetal glucose oxidation and increase lactate and pyruvate production. We tested this by measuring whole body glucose oxidation and lactate production, and molecular pathways in liver, muscle, adipose, and pancreas tissues of fetuses exposed to maternal hypoxemia for 9 days (HOX) compared with control fetal sheep (CON) in late gestation. Fetuses with more severe hypoxemia had lower whole body glucose oxidation rates, and HOX fetuses had increased lactate production from glucose. In muscle and adipose tissue, expression of the glucose transporter GLUT4 was decreased. In muscle, pyruvate kinase (PKM) and lactate dehydrogenase B (LDHB) expression was decreased. In adipose tissue, LDHA and lactate transporter (MCT1) expression was increased. In liver, there was decreased gene expression of PKLR and MPC2 and phosphorylation of PDH, and increased LDHA gene and LDH protein abundance. LDH activity, however, was decreased only in HOX skeletal muscle. There were no differences in basal insulin signaling across tissues, nor differences in pancreatic tissue insulin content, β-cell area, or genes regulating β-cell function. Collectively, these results demonstrate coordinated metabolic responses across tissues in the hypoxemic fetus that limit glucose oxidation and increase lactate and pyruvate production. These responses may be mediated by hypoxemia-induced endocrine responses including increased norepinephrine and cortisol, which inhibit pancreatic insulin secretion resulting in lower insulin concentrations and decreased stimulation of glucose utilization.

NEW & NOTEWORTHY Hypoxemia lowered fetal glucose oxidation rates, based on severity of hypoxemia, and increased lactate production. This was supported by tissue-specific metabolic responses that may result from increased norepinephrine and cortisol concentrations, which decrease pancreatic insulin secretion and insulin concentrations and decrease glucose utilization. This highlights the vulnerability of metabolic pathways in the fetus and demonstrates that constrained glucose oxidation may represent an early event in response to sustained hypoxemia and fetal growth restriction.

INTRODUCTION

Pregnancies at high altitude and those complicated by ischemic placental diseases, placental insufficiency, or gestational diabetes expose the fetus to hypoxemia and often produce growth restriction (1–4). Glucose and lactate are major substrates for fetal oxidative metabolism and growth (5–8). In the ovine fetus, the fraction of glucose and lactate oxidized is 60% and 70%, respectively (9). The supply of glucose from the placenta to the fetus is sufficient to meet the demand for glucose utilization under normal conditions and there is no endogenous glucose production. In contrast, fetal lactate utilization is supplied by both placental and endogenous fetal production (10, 11). There also is a net output of pyruvate from the fetus to the placenta that represents ∼1/8 of the carbon atom uptake from glucose and lactate by the fetus (12, 13). The effects of chronic hypoxemia on the utilization of glucose, pyruvate, and lactate by the fetus and tissue-specific responses remain largely unknown as most studies have been limited to acute exposures (3–4 h) and whole body outcomes (14–17). Studies in experimental sheep models of placental insufficiency-induced intrauterine growth restriction (PI-IUGR) produce hypoxemic fetuses and provide insight about the metabolic effects of chronic hypoxemia. PI-IUGR fetuses have decreased glucose uptake rates yet increased glucose utilization rates due to an early activation of endogenous glucose production (18–20). These whole body adaptations in glucose metabolism include tissue-specific differences in glucose utilization and oxidation in liver and skeletal muscle (19, 21–25). In addition to hypoxemia, however, PI-IUGR fetuses have decreased glucose and insulin concentrations and increased lactate and norepinephrine concentrations (10, 19), making it hard to discern the specific contribution of hypoxemia.

Previous studies in late gestation ovine fetuses have demonstrated that glucose utilization and oxidation rates decrease or increase, respectively, with acute and chronic decreases or increases in glucose and insulin concentrations, demonstrating that fetal tissues are sensitive to glucose and insulin signaling in utero (19, 26–31). Increased catecholamines and cortisol have the opposite effects and decrease fetal glucose uptake and utilization (32, 33); yet neither experimentally increased norepinephrine in normal fetuses nor adrenal demedullation in IUGR fetuses alter glucose or oxidation rates (20, 32). Fetuses with anemic-hypoxemia, however, have reduced muscle growth (34). These findings indicate that hypoxemia may have effects on fetal glucose metabolism with tissue-specific differences that are independent of, or in addition to, endocrine effects.

Fetal whole body nutrient metabolism rates are driven by organ-specific metabolism and nutrient shuttles between tissues. Fetal skeletal muscle is a major site of insulin-dependent glucose utilization, and studies across the catheterized fetal hindlimb demonstrate net glucose uptake and release of lactate (10, 11). In comparison, the normal fetal liver has a smaller net uptake of glucose yet 10-fold higher uptake of lactate and a net output of pyruvate that constitutes the flux of pyruvate from the fetus to the placenta (12, 35–37). These tissue differences allow for nutrient shuttles between organs and different responses to endocrine signals. Insulin stimulates glucose utilization via insulin receptor-mediated signaling and activation of AKT protein phosphorylation. Glucose utilization also can be stimulated by AMPK activation to promote energy production. Cellular glucose uptake is regulated by the family of GLUT transporters (GLUT1, GLUT2, GLUT4 genes). Glycolysis is regulated by phosphofructokinase (PFK1) and pyruvate kinase (muscle isoform, PKM, liver and red blood cell isoform, PKLR). Pyruvate is the main product of glycolysis and can enter the mitochondria for oxidation in the TCA cycle or be reduced to lactate (38). Pyruvate is transported into the mitochondria via two transporters, encoded by MPC1 and MPC2 genes (39). Within the mitochondria, pyruvate is converted to acetyl CoA via pyruvate dehydrogenase (PDH). PDH activity is inhibited by phosphorylation via PDH kinases (PDK1, PDK2, PDK4). The interconversion between lactate and pyruvate is regulated by the activity of lactate dehydrogenase (LDH) and NAD levels. The LDH enzyme is a tetramer that comprises LDH-A and LDH-B subunits (also referred to as LDH-M and LDH-H, respectively), encoded by LDHA and LDHB genes. LDH enzymes with more LDH-A (LDHA gene) subunits favor the reduction of pyruvate to lactate, whereas those with more LDH-B (LDHB gene) favor the oxidation of lactate to pyruvate (40). There are two lactate transporters, MCT1 and MCT4 (monocarboxylate transporter 1 and 4) genes, that regulate uptake and export into the cell and mitochondria (40). There also is an intracellular lactate-pyruvate shuttle whereby lactate is transported into the mitochondrial via MCT1 and oxidized to pyruvate via mitochondrial LDH activity (41, 42). In addition, glycolysis is tightly coupled with TCA cycle activity and mitochondrial metabolism of pyruvate; however, cells can uncouple this association by using MCTs and LDH to metabolize lactate and pyruvate (38).

Here, we utilized an established 9-day model of sustained fetal hypoxemia to test the effects on pathways that regulate fuel production and utilization in the fetus. Previously, we have shown that despite a 20% reduction in arterial Po2, these fetuses have maintained oxygen consumption rates yet have lower insulin concentrations, lower glucose utilization rates, and greater pyruvate output (13, 43). Accordingly, we hypothesized herein that sustained hypoxemia would decrease fetal glucose oxidation and increase lactate production with tissue-specific responses that initiate these whole body outcomes. To test this, we measured signaling pathways and targets regulating glucose utilization, glucose and pyruvate oxidation, and lactate production in three major metabolic tissues in the fetus: liver, muscle, and adipose tissue. We also measured pancreatic tissue responses to evaluate mechanisms that may produce lower insulin concentrations in HOX fetuses (43). To determine the contributions of these tissue responses to whole body metabolism, we measured glucose oxidation rates and assessed lactate production from glucose. Our results provide new information regarding whole body and tissue-specific nutrient and endocrine crosstalk during sustained hypoxemia in the fetus.

METHODS

Ethical Approval

All animal procedures were approved by the Institutional Animal Care and Use Committee at the University of Colorado School of Medicine (IACUC Protocol No. 00465). Pregnant animals were supplied from Nebeker Ranch (Lancaster, CA) and studied at the Perinatal Research Center (Aurora, Colorado). The Perinatal Research Center is accredited by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) and is compliant with US guidelines, including the Animal Welfare Act and Public Health Service Policy. Experimental work was performed and reported according to the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines (44).

Hypoxemia Model in Pregnant Sheep

The hypoxemia model and animals used in this study have been previously reported (13, 43). A brief description and related methodological details are provided. Pregnant Columbia-Rambouillet ewes carrying singletons were studied. Ewes were fed ad libitum alfalfa pellets (Standlee Hay) and had free access to water. Feed and water intake logs and medical records were maintained daily. Ewes were housed in individual carts during the duration of experimental procedures. Surgery was performed at ∼119 days of gestation (∼147 days gestation length) to surgically place indwelling catheters in the maternal and fetal vasculature. Ewes were fasted for 24 h before surgery. A maternal jugular catheter was placed for administration of diazepam (0.2 mg/kg) and ketamine (17.5 mg/kg) and ewes were then maintained on isoflurane inhalation anesthesia (2%–5%) for the remainder of the surgical procedure. At surgery, procaine penicillin G (600,000 U, im) and ampicillin (500 mg, intra-amniotically) were administered before closing uterine and abdominal incisions. Flunixin meglumine analgesic (Banamine, 2.2 mg/kg, im) and probiotics (Probios, 10 g, oral) were administered for 72 h postoperatively to the ewe. During surgery, the uterus was exteriorized with a midline incision to surgically place indwelling polyvinyl catheters (20 G) in the fetal vasculature. Fetal catheters were placed in the common umbilical vein, fetal artery (advanced into the abdominal aorta), and femoral vein (advanced into the inferior vena cava). Additional catheters were placed in the uterine vein and maternal femoral artery and femoral vein via a groin incision but were not used in this study. Catheters were filled with 5% heparinized saline and subcutaneously tunneled to the ewe’s flank, exteriorized through the skin, and kept in a plastic pouch sutured to the skin. A tracheotomy was performed to place a nonocclusive catheter (Formulation ND-100-65; 13 G) in the maternal trachea (13, 43). A vertical skin incision was made below the endotracheal tube cuff and the trachea was cauterized between two cartilaginous rings. The catheter was advanced through the tracheotomy and anchored to the surrounding tissue using suture and the skin incision was sutured closed. The tracheal catheter was subcutaneously tunneled to the ewe’s shoulder and kept in a plastic pouch sutured to the skin. Ewes were allowed to recover for at least 5 days before experimental procedures began.

Beginning at ∼125 days of gestation (sheep gestation is ∼147 days), ewes were randomly assigned to hypoxemia (HOX; n = 11) or control (CON; n = 7) groups, after which the study was performed unblinded to maintain fetal experimental conditions. Maternal hypoxemia was induced using tracheal insufflation of humidified nitrogen gas (100% N2) to reduce maternal and subsequently fetal arterial Po2 for ∼9 days. Control ewes received humidified compressed air gas (21% O2, 78% N2, 1% other trace gases) by tracheal insufflation for the same duration. Daily whole blood samples were collected from the maternal and fetal artery to monitor fetal Po2, and the rate of N2 gas was subsequently adjusted to target and maintain a fetal arterial Po2 between 12 and 16 mmHg in the HOX group for the study duration. This fetal Po2 range was chosen to mimic fetal hypoxemia in age-matched fetuses with placental insufficiency-induced IUGR (19, 22). The fetal Po2 at the end of study in CON and HOX fetuses is shown in Table 1 (43). Previously, we reported daily air and nitrogen insufflation rates and maternal and fetal arterial Po2 measurements across the duration of treatment in CON and HOX groups (43).

Table 1.

Real-time PCR primers

Symbol Forward Primer Reverse Primer
GLUT1 TGGGAGGCATGATTGGTTCC TGAGAAGCCCATGAGCACAG
GLUT2 AGCTGGCTGTTGTCACGGGC GGCTGGCACAGCAGACAAACCA
GLUT4 AGCAGCTGTCAGGCATCAAT CCGATGGTAGCATAGGCTGG
PDH GTTAAGGGGGCTGCTAGGTG AGCCACTGCGTACTGTGAAA
PDK1 TGGAGCATCACGCTGACAAA CTCAGAGGAACACCACCTCC
PDK2 TACATGGCCTCTCCTGACCT AAGCATGTGGTAGAGGTGGG
PDK4 CCCAGAGGACCAAAAGGCAT GGGTCAGCTGTACAGGCATC
PFK1 TGGTGGCTCCATGCTGGGGA GCAGGGCGTGGATGCTGTGA
MCT1 GTGGCTTGATTGCTGCTTCC GCCAATCATGGTCAAAGCCG
MCT4 CGGTGGTTACCTGGCATTGA ACAGCCATCCCAGCAAAGAA
LDHA CATGGCCTGTGCCATCAGTA GGAAAAGGCTGCCATGTTGG
LDHB GAGGGAGCGATCCCAAACAA CAGAATGCTGATGGCACACG
PKM GTGTTTAGCGGCAGCTTTGA CTGTCTGGTGATTCCGGGTC
PKLR TGGCGGGAAAGCCCGTTGTC CCAGAACGGCGTTGGCCACA
MPC2 TAAAGTGGAGCTCCTGCTGC ATGTCAGCCAATCCAGCACA
MPC1 TCGGAACTGGCTCCTGTTTG GCCGGTTCTTCATCTCCCAT
INS TCAGCAAACAGGTCCTCGCAAG GGGCCAGGTCTAGTTACAGTAG
GCG TCACTCTCTCTTCACCTGCTCTGT GACACACTTACTTCCTGTCAG
PDX1 TTTCCCGTGGATGAAGTCTAC CGGTGCGTGTCCGCTTGTTCT
HGF AGGAGACGAGAAACGCAAACAGGT ATAGCAGGCCTAGCAAGCTTCAGT
VEGFA GAGGGCAGAAACCCCATGAA GTCCACCAGGGTCTCAATGG
GCK AGGCCTCGGGAGCAGAAGGC CACCATCGCCACCACGTCCA
RPL41 TATGAGCAAGTGGACCAGCA TTCACGTAGGGCTTGAGCTT
RPL37A ACCAAGAAGGTCGGAATCGT GGCACCACCAGCTACTGTTT
RPL32 AATCAAGCGGAACTGGCG GGCATTGGGATTGGTGATT
MLF2 CTCAGCATCACAGATGGCAA CATGTCGTTCATCATCCCAA
RPS15 ATCATTCTGCCCGAGATGGTG CGGGCCGGCCATGCTTTACG
HPRT1 AGCGTGGTGATTAGCGATGA CACATCTCGAGCCAGTCGTT
ACTB TGCAGAAAGAGATCACTGCC GACAGCGAGGCAGGATGG

Metabolic Study and Tissue Collection

Metabolic studies were performed on the final day of treatment (∼134 days) to measure glucose oxidation rates using [U-13C] glucose tracer and lactate production from [U-13C] glucose. We have reported the details for the [U-13C] glucose tracer experiment, glucose utilization rates, and umbilical blood flow using 3H2O (13, 43). Briefly, a 3-mL bolus of 3H2O and [U-13C] glucose was infused followed by a continuous infusion at 3 mL/h (15 µCi/mL 3H2O, 30 mg/mL [U-13C] glucose) (13, 43). After 90–120 min, blood was simultaneously sampled from the umbilical vein and fetal artery four times at 20–30 min intervals to characterize the steady-state period. Whole blood Po2, O2 content, hemoglobin-O2 saturation (So2), partial pressure of carbon dioxide (Pco2), hematocrit, pH, and bicarbonate were measured with the ABL 800 Flex blood gas analyzer (Radiometer, Copenhagen, Denmark). Plasma glucose and lactate concentrations were measured using the Yellow Springs Instrument model 2900 Select Biochemistry Analyzer (Yellow Springs Instruments, Yellow Springs, OH). Fetal arterial plasma IGF-I concentrations were measured using ovine-specific ELISA assay (ALPCO Immunoassays 22-IGFHU-E01, Alpco Diagnostics). Umbilical vein and fetal artery data from the metabolic study on the final day of study have been reported for O2 content, So2, Pco2, hematocrit, bicarbonate, pH, glucose, lactate, and pyruvate (13, 43). Fetal arterial plasma insulin, cortisol, glucagon, and norepinephrine concentrations and fetal weight also were reported previously (43) and are used here to describe the fetal phenotype and for correlation analysis.

Immediately following the metabolic study, ewes were anesthetized with intravenous (iv) diazepam (0.2 mg/kg) and ketamine (17.5 mg/kg) to deliver the fetus via maternal laparotomy and hysterotomy. Subsequently, a lethal dose of sodium pentobarbital (390 mg/mL, Fatal Plus, Vortech Pharmaceuticals) was administered intravenously to euthanize the ewe and fetus. For each animal, fetal weight was recorded, and organs were dissected, weighed, and snap frozen in liquid nitrogen. To obtain homogeneous tissue samples for downstream analysis, the pancreas, biceps femoris (skeletal muscle), and liver tissue from left lobe were ground in liquid nitrogen. Adipose tissue from the perirenal depot was broken into smaller pieces and used.

Glucose Oxidation Rates

Fetal plasma glucose tracer enrichments [molar percent excess (MPE)] of m + 6 [U-13C] glucose were measured in the fetal artery and umbilical vein plasma samples by gas chromatography mass spectrometry (GC/MS) following derivatization with aldonitrile pentaacetate as described (43, 45). Glucose [U-13C] enrichment was monitored at m/z of 334/328 ratio. Glucose MPE was calculated as the difference in peak area ratios between unenriched (m + 0, m/z 328) and enriched (m + 6 m/z 334) samples. Isotopic enrichment of 13CO2/12CO2 was measured using isotope ratio mass spectrometry (45). Fetal glucose oxidation fractions and rates were calculated using these new 13CO2 enrichments with the previously reported [U-13C] glucose tracer MPEs, plasma glucose concentrations, and blood CO2 content, and umbilical blood flow rates as described (9, 45).

Lactate Production from Glucose

Fetal arterial plasma and umbilical venous samples from draw 4 were measured with GC/MS to determine 13C-lactate enrichment (MPE) from the [U-13C] glucose tracer infusion. Samples were derivatized using N-tert-butyldimethylsilyl-N-methyl-trifluoroacetamide with 1% tert-butyldimethylchlorosilane and the abundance of lactate ions was determined by monitoring m/z of 261 and 264, representing molecules with 0 or 3 carbon atoms from [U-13C] glucose, referred to as m + 0 to m + 3 lactate. Lactate MPE was calculated as the difference in peak area ratios between unenriched (m + 0, m/z 261) and enriched (m + 3, m/z 264) samples. Labeling in the fetal arterial (a) blood represents products of fetal metabolism, whereas labeling in the umbilical venous (g) blood represents both products of fetal and uteroplacental metabolism in the umbilical blood delivered to the fetus. To assess fetal lactate production, the a:g ratio of lactate enrichment (MPE, m + 3) was calculated. Molar quantities of labeled lactate and glucose were calculated using the arterial m + 3 MPE for lactate and arterial m + 6 MPE for glucose multiplied by arterial plasma lactate or glucose concentration (mM), respectively. Lactate produced from glucose by the fetus was calculated as the quantity of m + 3 lactate normalized to m + 6 glucose on a molar basis in fetal arterial samples.

Gene Expression

RNA was isolated from tissue samples, reverse transcribed to cDNA, and qPCR was performed as previously described and following MIQE guidelines (27, 43, 46). Primers were used as previously reported or new primers were designed to span exon regions within a gene (Table 1). To normalize qPCR results, reference genes were selected and used based on constitutive expression across samples in CON and HOX groups. In liver, ribosomal protein S15 (RPS15) was used. In other tissues, the geometric mean was calculated and used with actin (ACTB), RPS15, RPL37A, RPL41, and myeloid leukemia factor 2 (MLF2) for muscle, with hypoxanthine phosphoribosyltransferase 1 (HRPT1) and RPS15 for adipose tissue, and with RPS15, RPL32, RPL41, and MLF2 for pancreas. Data are expressed relative to the CON group by dividing the expression for each sample relative to the mean of the CON group.

Western Immunoblotting

Whole cell lysates were prepared from tissue samples and western immunoblotting was performed (27, 43). Briefly, 30-µg protein was loaded with 4× DTT (1 M) in equal volumes of buffer, separated on a 4%–12% polyacrylamide gels and transferred onto nitrocellulose membranes (Bio-Rad). The antibodies used were against phosphorylated PDH (S293, 1:500, Abcam, Cat. No. 92696; AB_10711672), PDH (1:500, Abcam, Cat. No. 110330; AB_10858459), LDH (1:1,000, Abcam, Cat. No. 47010; AB_1952042), phosphorylated AMPK (T172, 1:1,000, Cell Signaling, Cat. No. 2531S; AB_330330), AMPK α subunit (1:1,000, Cell Signaling, Cat. No. 2793S; AB_915794), actin (1:10,000, Millipore, Cat. No. 691002; AB_2335304), and insulin receptor β (1:500, Santa Cruz, Cat. No. sc-711; AB_631835). Antibody reactivity has been verified in ovine samples (25, 27, 47, 48). Antibody specificity was verified by the presence of a single band at the expected molecular weight. Bands for phosphorylated and total forms of a protein were verified to be of similar size based on migration in gels when blot images were aligned. Protein bands were visualized using IR-Dye IgG secondary antibody (LI-COR) and protein expression quantified with Image Studio (LI-COR). Samples within a tissue were run on two gels that both included the same two reference samples that were used to normalize data across gels and account for gel-to-gel differences. One gel contained 4 CON and 5 HOX samples and the second gel contained 3 CON and 6 HOX samples. Target band densities were normalized to the reference samples on each gel. Before blocking and antibody incubations, the equality of sample loading was measured using the Total Protein Stain (LI-COR). For phosphorylated proteins, data are expressed as a ratio of phosphorylation to total expression, in addition to absolute levels of phosphorylated and total protein expression. In addition to the total protein stain, equality of loading was confirmed based on actin protein abundance. Data are presented as a fold-change relative to the mean of the CON group.

Pyruvate Dehydrogenase Enzyme Activity

Activity of pyruvate dehydrogenase (PDH) was measured in tissue samples (40 mg) homogenized in 400-µL ice-cold PDH Assay Buffer (MAK183, Sigma Aldrich). Protein concentrations were determined using a Pierce BCA Protein Assay (Thermo Fisher Scientific), and 10 µg protein were loaded per reaction in duplicate. Assays were performed at 37°C and A450 was measured every 5 min for 45 min. The ΔA450 was calculated at between 0 and 30 min of the linear reaction and is proportional to the NADH concentration produced by PDH enzymatic reaction converting pyruvate into acetyl CoA.

Lactate Dehydrogenase Enzyme Activity

Tissue samples (50 mg) were homogenized in 500-µL ice-cold CelLytic MT Buffer (Sigma-Aldrich). Lactate dehydrogenase (LDH) activity was assessed using the LDH Activity Assay (Cat. No. ab102526, Abcam). Protein concentrations were determined as described above, and 1 µg protein was loaded per reaction in duplicate. Assays were performed at 37°C and A450 was measured every 5 min for 40 min. The ΔA450 was calculated for 5 min of the linear reaction between 10- and 15-min time points and is proportional to the NADH concentration produced by the LDH enzymatic reaction converting lactate into pyruvate. Results were normalized to the amount of protein loaded in the reaction.

Glycogen and Triglycerides

Tissue glycogen content was measured and expressed as milligrams per gram of wet tissue weight (27). Triglyceride content was measured (Cat. No. TR22421; Thermo Fisher Infinity Triglyceride Reagent) following lipid extraction and normalized to wet tissue weight (27). To determine total per perirenal adipose tissue triglyceride content, triglyceride content (mg/g of tissue) was multiplied by total grams of tissue weight.

Pancreatic Insulin Content

Three aliquots (12–25 mg each) of pulverized pancreas tissue from the hepatic half of the pancreas per fetus were subjected to an acid ethanol extraction with 1 mL of 1 mol/L HCl in 70% ethanol (vol/vol) at −20°C for 18 h (35). The concentration of insulin was measured by ELISA and is presented as µg of insulin per g of pancreas (32).

Histological Analysis of the Fetal Pancreas

Histological evaluation of the fetal pancreas was as previously described with minor modifications (49). Frozen sections were incubated at 37°C for 30 min and then washed in deionized water. Sections were then heated in 10 mmol/L citric acid (pH 6.0) to 90°C for 10 min in a microwave. Sections were cooled for 20 min, washed, and then incubated in 0.1% Triton for 10 min. Sections were blocked for 60 min in 1.5% normal donkey serum (Sigma Life Science; St. Louis, MO) in phosphate-buffered saline (PBS). Incubations with primary antibodies and fluorescent-labeled Griffonia Simplicifolia Lectin 1 (GSL1) isolectin B4 (15 μg/mL; Vector Laboratories, Cat. No. FL-1201, AB_2314663) were done overnight in 4°C. Incubation with secondary antibodies was done for 60 min at room temperature. Endocrine hormones were identified with the following primary antibodies: anti-porcine insulin guinea pig polyclonal IgG (1:250, Bio-Rad, Cat. No. 5330-0104 G, AB_1605150) and anti-glucagon mouse monoclonal IgG (1:500, Sigma-Aldrich, Cat. No. G2654, AB_259852). Immunocomplexes were detected with the following affinity-purified secondary antiserum: Alexa Fluor 594 goat anti-mouse IgG (1:250; Thermo Fisher Scientific, Cat. No. A-11005, AB_2534073) and Alexa Flour 680 donkey anti-guinea pig IgG (1:500; Jackson ImmunoResearch Labs, Cat. No. 706-625-148, AB_2340478). Images of the entire pancreatic section were acquired from 4–6 sections per fetus. Morphometric analysis to determine the percent area of the pancreas that was insulin-positive, glucagon-positive, and lectin-positive was performed using previously developed custom applications in Visiopharm (49). Results from all sections analyzed for a single fetus were averaged. The β-cell and α-cell mass was calculated by multiplying the pancreas weight by the percent total insulin-positive and glucagon-positive areas, respectively. For each type of analysis, all the sections were averaged per animal before statistical analysis.

Statistical Analysis

Data were analyzed by unpaired Student’s t test or Mann–Whitney U test, when variances were different between groups, and linear regression and correlation analyses were performed using GraphPad Prism 9.0 (GraphPad Software). The analysis used is indicated in the figures and tables. Data are presented as means ± SD. Statistical differences declared at P ≤ 0.05 and P < 0.20 are indicated as statistical trends on graphs. Fetal sex effects were evaluated using a two-way ANOVA with fixed effects of treatment (CON, HOX) and fetal sex. No significant effects of fetal sex were found herein or in our previous publications using the model (13, 43). Therefore, fetal sex was not included in the final analyses and data from female and male fetuses were combined.

RESULTS

Fetal Characteristics and Growth Measures

Characteristics of CON and HOX fetuses are presented in Table 2, and variables that have been previously reported in this set of animals are indicated (13, 43). HOX fetuses have 20% lower arterial Po2 and 36% lower arterial O2 content. HOX fetuses also have threefold higher lactate concentrations, twofold higher pyruvate concentrations, and no difference in glucose concentrations measured in fetal artery and umbilical vein samples compared with CON fetuses. HOX fetuses have a 50% reduction in plasma insulin concentrations and increased cortisol and norepinephrine concentrations compared with CON fetuses (43). Plasma IGF-I concentrations are 40% lower in HOX compared with CON fetuses.

Table 2.

Fetal characteristics

Variable CON HOX P Value
Gestational age, days* 133.6 ± 0.30 133.4 ± 0.39
Male:female ratio* 2:5 6:5
Fetal arterial blood oxygen
 Po2, mmHg* 18.39 ± 2.862 14.66 ± 1.781 <0.005
 Oxygen content, mM* 2.43 ± 0.39 1.55 ± 0.57 <0.005
Nutrients
 Glucose, umbilical vein plasma, mM* 1.18 ± 0.25 1.40 ± 0.29 0.16
 Glucose, fetal artery plasma, mM* 0.98 ± 0.24 1.17 ± 0.26 0.13
 Lactate, umbilical vein plasma, mM* 2.29 ± 0.41 7.83 ± 6.60 <0.005**
 Lactate, fetal artery plasma, mM* 2.11 ± 0.38 7.04 ± 6.20 <0.005**
 Pyruvate, umbilical vein blood, mM* 0.05 ± 0.04 0.09 ± 0.02 <0.05
 Pyruvate, fetal artery blood, mM* 0.12 ± 0.04 0.23 ± 0.10 <0.01
Fetal arterial plasma hormones
 Insulin, ng/mL* 0.75 ± 0.33 0.37 ± 0.19 <0.01
 Norepinephrine, pg/mL* 398 ± 254 1244 ± 988 <0.005
 Glucagon, pg/mL* 48.6 ± 23.4 92.7 ± 118.9 0.13
 Cortisol, ng/mL* 11.7 ± 8.8 29.3 ± 27.6 0.35
 IGF-I, ng/mL 105.1 ± 25.9 64.5 ± 23.4 <0.005

n = 7 CON, 11 HOX fetuses. Values are means ± SD. *Previously reported in Refs. 13 or 47. **Mann–Whitney test for nonparametric data. CON, control; HOX, hypoxemia.

Fetal weight was not different between CON and HOX fetuses (43). Correspondingly, there were no differences in fetal crown-rump length or lower limb length, measures of linear growth (Table 3). Fetal muscle mass measured by weights of biceps femoris, soleus, gastrocnemius, anterior tibialis, flexor digitorum superficialis, or extensor digitorum longus muscles also was not different between groups (Table 3). Fetal perirenal adipose tissue mass was 30% greater in HOX fetuses compared with CON (Table 3) and remained greater when expressed as a percent of fetal body weight (CON: 0.30 ± 0.02%, HOX: 0.43 ± 0.03%). There were no differences in the mass of other fetal organs between groups (Table 3).

Table 3.

Fetal growth measurements

Variable CON HOX P Value
Fetal weight,* g 3049.1 ± 142.8 2953.3 ± 181.5 0.71
Crown-rump length, cm 47.46 ± 2.37 46.74 ± 3.46 0.65
Lower limb length, cm 33.90 ± 1.89 33.21 ± 3.81 0.68
Skeletal muscles
 Biceps femoris, g 16.43 ± 3.55 15.18 ± 4.72 0.57
 Gastrocnemius, g 8.27 ± 1.67 7.51 ± 1.37 0.35
 Soleus,** g 0.28 ± 0.20 0.51 ± 0.64 0.47
 Anterior tibialis, g 3.01 ± 0.59 3.24 ± 0.89 0.58
 Flexor digitorum superficialis, g 3.04 ± 1.00 2.76 ± 0.45 0.45
 Extensor digitorum longus, g 0.90 ± 0.30 0.79 ± 0.27 0.46
Perirenal adipose, g 8.83 ± 0.76 12.39 ± 0.90 <0.05
Pancreas, g 2.90 ± 0.41 3.26 ± 0.83 0.33
Liver,* g 79.50 ± 13.81 80.92 ± 22.48 0.87
Kidneys, g 20.44 ± 4.45 17.10 ± 3.52 0.11
Spleen, g 7.42 ± 3.40 7.14 ± 3.56 0.88
Adrenal glands, g 0.37 ± 0.03 0.40 ± 0.17 0.64
Lungs, g 112.70 ± 14.41 106.39 ± 23.33 0.55
Heart, g 23.18 ± 1.74 25.07 ± 5.56 0.42
 Left ventricle, g 5.50 ± 0.97 6.09 ± 1.38 0.36
 Septum, g 2.63 ± 1.03 2.47 ± 1.12 0.77
 Right ventricle, g 3.51 ± 0.51 3.97 ± 0.79 0.22
 Atria and great vessels, g 9.90 ± 0.57 11.57 ± 3.85 0.30
Left:right ventricle, ratio 1.57 ± 0.20 1.57 ± 0.37 1.00
Brain, g 50.11 ± 3.17 47.77 ± 3.94 0.24

n = 7 CON, 11 HOX fetuses. Values are means ± SD. *Previously reported in Ref. 47. **Measured in only 5 CON, 6 HOX fetuses. CON, control; HOX, hypoxemia.

Whole Body Glucose Oxidation and Lactate Production

We next tested if increased lactate and pyruvate concentrations and pyruvate output in HOX fetuses (13, 43) were the result of decreased glucose oxidation and increased production of lactate. Fetal (whole body) glucose oxidation rates were not different between CON and HOX fetuses (Table 4). The glucose oxidation fraction, represented as the fraction of total glucose utilization that was used for oxidation also, was not different in HOX compared with CON fetuses. In both CON and HOX fetuses, the fetal arterial lactate MPE enrichment was higher than the umbilical venous MPE, with a relative MPE ratio >1.0 across all samples (one-sided Wilcoxon test, P < 0.01), supporting relative 13C-lactate production from glucose in CON and HOX fetuses. There was no difference in this arterial:venous MPE ratio between groups. The amount of fetal arterial plasma 13C-lactate (m + 3 molar quantity) normalized to 13C-glucose (m + 6 molar quantity) was twofold higher in HOX compared with CON fetuses, representing increased lactate production from glucose (Table 4).

Table 4.

Glucose oxidation and lactate production

Variable CON HOX P Value
Glucose oxidation rate, µmol/min/kg 20.1 ± 2.8 16.2 ± 6.8 0.18
Fraction of glucose oxidized 0.62 ± 0.09 0.60 ± 0.21 0.86
Lactate m + 3 MPE, plasma, fetal artery 2.10 ± 0.71 2.18 ± 1.26 0.89
Lactate m + 3 MPE, plasma, umbilical vein 2.07 ± 0.70 2.29 ± 1.31 0.69
Lactate MPE ratio, fetal artery/umbilical vein 1.016 ± 0.009 1.015 ± 0.024 0.95
Glucose m + 6 MPE, plasma, fetal artery 3.29 ± 1.25 3.77 ± 1.94 0.57
Glucose m + 6 MPE, plasma, umbilical vein 2.10 ± 0.77 3.05 ± 1.96 0.25
Fetal artery, m + 3 labeled lactate, nmol/mL 43.1 ± 12.4 139.5 ± 97.6 <0.05
Fetal artery, m + 6 labeled glucose, nmol/mL 29.7 ± 6.4 44.0 ± 25.3 0.17
Lactate from glucose, relative labeling* 1.46 ± 0.33 2.95 ± 1.19 <0.005

n = 7 CON, 11 HOX fetuses. Values are means ± SD. *Lactate produced from glucose measured as ratio of molar quantities of (m + 3 labeled lactate)/(m + 6 labeled glucose). CON, control; HOX, hypoxemia; MPE, molar percent excess.

Tissue-Specific Differences Regulating Glucose Oxidation and Lactate Production in the Fetus

Given the metabolic activity of liver and muscle and that the perirenal adipose tissue had an increase in mass, we selected these tissues to test tissue-specific responses in carbohydrate metabolism during hypoxemia.

Glucose utilization and insulin and nutrient signaling.

The relative expression of genes regulating glucose transport (GLUT1, GLUT2, GLUT4) and glycolysis (PFK1, PKLR, PKM) was measured. Tissue-specific responses were observed whereby PKLR was reduced in liver (Fig. 1A), GLUT4 and PKM were reduced in skeletal muscle (Fig. 1B), and GLUT4 was reduced in adipose tissue in HOX compared with CON fetuses (Fig. 1C). There was no difference in relative protein abundance of the insulin receptor (IR-b) in liver, muscle, or adipose tissue between CON and HOX fetuses (Fig. 1, D and E). There also was no difference in the abundance of phosphorylated AKT (P-AKT, S473), total AKT, or ratio of P-AKT to total AKT (Fig. 1, D and E). The abundance of phosphorylated AMPK (P-AMPK, T172), total AMPK, and relative ratio of P-AMPK to total AMPK were not different between groups (Fig. 1, D and E).

Figure 1.

Figure 1.

Effect of sustained hypoxemia on glucose utilization and pathways regulating insulin and nutrient signaling in fetal tissues. Relative expression of genes for glucose uptake and glycolysis were measured in CON and HOX fetal liver (A), skeletal muscle (B), and adipose tissue (C). D: protein expression was measured by Western blotting. A representative blot of each protein is shown. E: relative protein abundance of insulin receptor (IR-B) and ratio of phosphorylated to total protein for AKT (S473) and AMPK (T172). Data were analyzed by t test in CON (n = 7) and HOX (n = 11) fetal samples. *P < 0.05, **P < 0.01, #P < 0.15. CON, control; HOX, hypoxemia.

Pyruvate metabolism.

We measured the gene expression of the mitochondrial pyruvate transporters (MPC1, MPC2) and PDH kinases (PDK1, PDK2, PDK4; Fig. 2). Only expression of MPC2 was decreased in the liver (Fig. 2A). Phosphorylation and total abundance of PDH protein were increased in HOX livers (Fig. 2E). PDH activity also tended to be lower in the liver of HOX fetuses (P = 0.12; Fig. 2F). PDH protein phosphorylation and expression and PDH activity were not different in skeletal muscle and adipose tissue between HOX and CON fetuses (Fig. 2E). Of note, PDH activity was nearly 10-fold higher in adipose compared with liver or skeletal muscle tissue, irrespective of fetal treatment group (Fig. 2F).

Figure 2.

Figure 2.

Effect of sustained hypoxemia on pyruvate oxidation in fetal tissues. Relative expression of genes regulating mitochondrial pyruvate transport and phosphorylation of PDH were measured in CON and HOX fetal liver (A), skeletal muscle (B), and adipose tissue (C). D: protein expression was measured by Western blotting. A representative blot of each protein is shown. E: relative protein abundance of phosphorylated PDH (S293), total PDH, and ratio of phosphorylated to total PDH. F: PDH activity was measured. Means ± SD are shown. Data were analyzed by t test in CON (n = 7) and HOX (n = 11) fetal samples. *P < 0.05, **P < 0.01, #P < 0.15. CON, control; HOX, hypoxemia; PDH, pyruvate dehydrogenase.

Lactate metabolism.

We measured the gene expression of LDH isoforms (LDHA, LDHB) and lactate transporters (MCT1, MCT4; Fig. 3). Expression of LDHA was increased by ∼75% in liver and adipose tissue (Fig. 3, A and C) of HOX compared with CON fetuses. LDHB expression tended to be lower in HOX skeletal muscle (Fig. 3B). Expression of MCT1 was increased by ∼50% in adipose tissue (Fig. 3C). LDH-A/B protein expression was twofold higher in liver of HOX compared with CON fetuses, with no differences between groups in skeletal muscle or adipose tissue (Fig. 3E). LDH activity was highest in skeletal muscle and ∼10% lower in skeletal muscle of HOX fetuses, with no differences between CON and HOX in liver or adipose tissue (Fig. 3F).

Figure 3.

Figure 3.

Effect of sustained hypoxemia on lactate metabolism and transport in fetal tissues. Relative expression of genes for lactate metabolism and transport were measured in CON and HOX fetal liver (A), skeletal muscle (B), and adipose tissue (C). D: protein expression was measured by Western blotting. A representative blot of each protein is shown. E: relative protein abundance of LDH (detects LDH-A and LDH-B). F: LDH activity was measured. Means ± SD are shown. Data were analyzed by t test in CON (n = 7) and HOX (n = 11) fetal samples. *P < 0.05, **P < 0.01, #P < 0.15. CON, control; HOX, hypoxemia; LDH, lactate dehydrogenase.

Glycogen and triglyceride content.

Glycogen and triglycerides represent major storage forms of glucose and lipid in tissues. There was no difference in liver or skeletal muscle glycogen content, or liver triglyceride content. Adipose tissue triglyceride content also was not different (P = 0.11), yet total perirenal adipose tissue triglyceride content was nearly twofold greater (Table 5).

Table 5.

Tissue glycogen and triglyceride content

Variable CON HOX P Value
Liver glycogen, mg/g 37.8 ± 10.0 41.2 ± 10.7 0.51
Liver triglycerides, mg/g 4.41 ± 1.92 4.34 ± 0.86 0.92
Skeletal muscle glycogen, mg/g 38.2 ± 9.8 37.0 ± 7.8 0.79
Adipose triglycerides, mg/g 5.98 ± 0.95 7.98 ± 3.06 0.12
Total adipose tissue triglycerides, mg 53.5 ± 17.0 98.0 ± 34.8 <0.001

n = 7 CON, 11 HOX fetal samples. Values are means ± SD. CON, control; HOX, hypoxemia.

Effect of Hypoxemia in the Fetal Pancreas

Given the 40% reduction in plasma insulin concentrations, we measured the histology, insulin content, and expression of genes regulating β-cell development and function in fetal pancreas tissue. There were no differences in the percent area of the pancreas that stained positive for insulin, glucagon, or lectin (Fig. 4A), nor differences in β-cell or α-cell mass (Fig. 4B) between HOX and CON fetuses. Pancreatic insulin content was similar between HOX and CON fetuses (Fig. 4C). Genes regulating pancreatic insulin production and secretion (insulin, INS; pancreatic and duodenal homeobox 1, PDX1; GLUT2; glucokinase, GCK), glucagon (GCG), and vascularity (hepatocyte growth factor, HGF; vascular endothelial growth factor A, VEGA) were not different between HOX and CON fetuses.

Figure 4.

Figure 4.

Effect of sustained hypoxemia on the fetal pancreas. A: pancreatic tissue histology and relative staining positive staining area for insulin, glucagon, and lectin (endothelial, vasculature marker). B: β cell and α cell mass based on percent staining for insulin and glucagon multiplied by pancreas weight. C: insulin content in pancreatic tissue. D: relative expression of genes regulating islet development, metabolism, and insulin secretion. All measurements were performed in pancreas tissue samples from CON (n = 7) and HOX (n = 11) fetuses. Means ± SD are shown. Data were analyzed by t test. CON, control; HOX, hypoxemia.

Relationships between Hypoxemia, Hormones, Growth, and Nutrient Metabolism

Fetal arterial O2 content was positively correlated with fetal arterial plasma insulin and IGF-I concentrations, whereas glucose, glucagon, pyruvate, cortisol, lactate, and norepinephrine were inversely correlated (Fig. 5A). Fetal arterial blood oxygen content was positively associated with fetal weight (Fig. 5B). Fetal blood oxygen saturation and plasma glucagon concentrations tended to be associated with higher or lower fetal weight, respectively (P < 0.15; Fig. 5B). These relationships support an effect of hypoxemia in association with fetal weight and hormones that regulate growth.

Figure 5.

Figure 5.

Relationships between sustained hypoxemia and fetal outcomes. Correlation analysis was performed between fetal arterial blood oxygen content (A) or fetal weight with fetal outcomes (B) as indicated on the vertical axis. Pearson’s correlation coefficients (r) are shown across the horizontal axis scale and inside the bars. Significance of the correlation is indicated as follows: *P < 0.05, #P < 0.15. C: relationships between fetal whole body glucose oxidation (mmol/min/kg), lactate production (m + 3 mmol of 13C-lactate from 13C-glucose) glucose utilization (mmol/min/kg), pyruvate output (mmol/min/kg), liver PDH activity, and blood or plasma parameters, as shown, in CON (white) and HOX (blue) fetuses. CON, control; HOX, hypoxemia; PDH, pyruvate dehydrogenase.

Decreased glucose oxidation rates were positively associated with fetal arterial blood O2 content and negatively associated with cortisol concentrations (Fig. 5C). Increased fetal lactate production was associated with lower fetal arterial blood O2 content and lower glucose oxidation rates (Fig. 5C). Fetal arterial pyruvate and lactate concentrations were positively correlated. Liver PDH activity was lower in fetuses with more severe hypoxemia and correlated with increased fetal pyruvate output. This supports an effect between the severity of hypoxemia on glucose oxidation, lactate production, and pyruvate output. Lower glucose oxidation rates were observed in parallel with lower glucose utilization rates Further, there was a positive linear relationship between fetal glucose utilization rates and plasma insulin (Fig. 5C) and IGF-I (not shown) concentrations across all fetuses, supporting normal insulin stimulated glucose utilization. Plasma insulin concentrations, however, were inversely associated with plasma norepinephrine concentrations, which support an inhibitory effect on insulin secretion.

DISCUSSION

Lower fetal glucose oxidation rates correlated with both the severity of hypoxemia and lower glucose utilization rates, even though glucose oxidation rates only tended to be lower in the HOX compared with the CON group. In addition, lower glucose utilization rates (43) are likely mediated by lower plasma insulin and IGF-I concentrations, which reduce the amount of glucose available for oxidation. Our tissue-specific results provide mechanisms for how the severity of hypoxemia constrains fetal glucose oxidation and increases lactate and pyruvate production. In support of decreased glucose utilization (whole body), HOX fetuses had decreased GLUT4 expression in muscle and adipose tissue and decreased PKM in muscle, without a change in insulin receptor protein abundance, AKT activation, or AMPK nutrient sensing. To address the source of increased plasma lactate concentrations in HOX fetuses, we found an increase in lactate production derived from glucose and unique corresponding pathways involving increased LDHA expression in liver (gene and protein) and adipose tissues (gene only) and decreased LDHB in skeletal muscle. Further, we speculate that increased fetal pyruvate output is likely due to increased hepatic pyruvate production, as the fetal liver is the only organ that releases pyruvate (12) and hepatic PDH activity, though not significantly lower in HOX fetuses, was associated with fetal pyruvate output. Collectively, our results support a balance between reduced stimulation of glucose utilization by insulin and IGF-I and an increase in hypoxemia-induced factors such as cortisol and norepinephrine that inhibit glucose oxidation and increase lactate and pyruvate production during fetal hypoxemia with initiating tissue-specific responses (Fig. 6).

Figure 6.

Figure 6.

Integrative summary of the metabolic effects of fetal hypoxemia. The effects of sustained hypoxemia are summarized including key results herein and from previous publications. As shown herein, fetal hypoxemia decreases whole body glucose oxidation rates based on severity of hypoxemia and increases lactate production, with maintained insulin sensitivity. At the tissue level, key findings herein that may contribute to decreased glucose oxidation and increased lactate production are shown in blue boxes. We propose that these tissue responses (dashed arrows) in the liver contribute to increased pyruvate output, whereas the responses in muscle and adipose underlie decreased glucose utilization. As shown previously and herein, fetal hypoxemia also produces an endocrine profile with decreased insulin and IGF-I and increased cortisol and norepinephrine, which may mediate these tissue-specific responses.

Previously, we have shown that HOX fetuses have increased circulating pyruvate and lactate concentrations and increased (whole body) net pyruvate release without any difference in net lactate uptake (13, 43). Here, we traced the fetal plasma enrichment of 13C-lactate following 13C-glucose tracer infusion to confirm that increased lactate production is derived from glucose in HOX fetuses. Increased fetal lactate production with lower glucose oxidation implies lower pyruvate oxidation and is expected to drive pyruvate toward lactate production (21, 22). Understanding this flux is important because lactate is a critical fuel source for the fetus (5, 50). We speculate that the twofold increase in pyruvate release by the HOX fetus may be a mechanism to limit fetal acidosis via the conversion of lactate to pyruvate and export of pyruvate to the placenta (13). Interestingly, despite higher lactate levels, HOX fetuses maintain a normal pH (43), consistent with the development of adaptations to hypoxemia and an ascribed “lactate plateau” (16). Further, HOX fetuses had parallel increases in arterial lactate and pyruvate concentrations (see Fig. 5) and no difference in the arterial lactate:pyruvate ratio compared with CON fetuses, which is considered as a proxy for NAD/NADH levels and a measure of redox balance. Fetal plasma alanine concentrations also are increased in HOX fetuses and may contribute to increased pyruvate and lactate concentrations (13).

Lower glucose oxidation rates, in association with the severity of hypoxemia, in the HOX fetus may reflect endocrine responses that regulate glucose utilization (17, 32, 51–54). We found a linear relationship between glucose utilization rates and insulin concentrations, supporting decreased insulin stimulation of glucose utilization under basal conditions in HOX fetuses, without an effect on insulin sensitivity. Importantly, there was no association between glucose oxidation rates and fetal plasma insulin concentrations; yet lower glucose oxidation rates were correlated with higher fetal arterial cortisol concentrations. This is consistent with studies demonstrating that increased cortisol decreases fetal glucose uptake and activates genes controlling glucose metabolism in skeletal muscle, and our work demonstrates that dexamethasone treatment increases PDK4 expression in fetal hepatocytes (33, 45, 52, 55). We also observed an inverse association between fetal weight and glucagon concentrations. This is interesting given our recent data demonstrating that exogenous glucagon reduces uteroplacental blood flow, nutrient flux to the fetus, and fetal growth (54).

The molecular pathways regulating increased lactate production in HOX fetuses appear unique between liver, skeletal muscle, and adipose tissues. Skeletal muscle had highest LDH activity and LDHA expression; yet there was no change in LDHA and decreased LDHB expression in HOX muscle. Decreased LDHB expression is not unexpected since LDHB expression is oxygen dependent (56, 57). Decreased LDHB also favors an LDH enzyme tetramer with more LDH-A subunits, which would promote the conversion of pyruvate to lactate (40). In contrast, liver and adipose tissue LDHA gene expression was increased, a classic hypoxia-mediated transcriptional response (58). Despite these differential gene expression effects, there was only increased LDH-A/B protein abundance in the HOX liver and no change in LDH activity in either tissue. The antibody used for LDH protein abundance, however, detects both LDH-A and LDH-B subunits. In addition, the LDH activity assay measures NADH produced from NAD+ by LDH, the reaction direction that would oxidize lactate to pyruvate. Additional studies are needed to characterize LDH enzyme subunit composition and localization within the cell to understand the direction of LDH flux and investigate the intracellular lactate shuttle in the cytosol versus mitochondrial that can regulate lactate oxidation (42).

Under normal conditions, hepatic glucose utilization represents only 5–10% of total fetal whole body glucose utilization and the fetal liver has a net uptake of lactate and release of pyruvate. The fetal liver also is a major site of amino acid oxidation and consumes ∼20–30% of total fetal oxygen uptake (12, 35–37). Our previous work demonstrated potentiation of hepatic gluconeogenic gene activation but no glucose production in HOX fetuses (43). Here, we found that livers from HOX fetuses have increased LDHA expression, increased LDH-A/B protein expression, greater PDH phosphorylation, and decreased MPC2 expression. All of which are consistent with increased intrahepatic lactate production and decreased mitochondrial pyruvate oxidation. Lower PDH activity also correlated with increased fetal whole body pyruvate output. We speculate the increased hepatic pyruvate output is largely responsible for increased fetal pyruvate output in HOX fetuses. However, the carbon source for hepatic pyruvate output remains unclear and could be derived from glucose or lactate, with the latter being supported by greater net lactate uptake rates by the fetal liver and potential for increased intrahepatic lactate production. The factors inhibiting pyruvate oxidation in the fetal liver during sustained hypoxemia also remain unknown, especially in the absence of any increases in hepatic PDK1, PDK2, or PDK4 expression, since these kinases inhibit PDH activity.

Our results indicate that lower fetal insulin concentrations during sustained hypoxemia reflect decreased secretion because insulin content and β-cell mass were equivalent between HOX and CON pancreases. We also found no differences in expression of pancreatic genes that regulate β function, which further support that the inhibition occurs with insulin secretion and not production. High concentrations of plasma catecholamines inhibit insulin secretion and likely explain the lower insulin concentrations in HOX fetuses despite normal glucose concentrations (59). Moreover, inhibition of insulin secretion by catecholamines was maintained in fetus even during sustained hypoxemia resulting from maternal hypoxia, placental insufficiency, and anemic hypoxemia (60–62). The activation of α2-adrenergic receptors blocks insulin exocytosis and lowers oxidative metabolism in β cells, demonstrating multiple mechanisms are responsible for inhibition of insulin secretion (63–65). Therefore, we speculate that lower insulin concentrations in HOX fetuses are the result of increased norepinephrine and inhibition of pancreatic insulin secretion.

A unique finding was increased perirenal adipose mass in hypoxemic fetuses. Increased perirenal adipose mass, relative to fetal weight, has been reported in other sheep models of nutrient or growth restriction (66), in relation to glucose supply (67, 68), and in hypophysectomized fetuses (69). We also observed that fetal adipose has the greatest PDH activity compared with liver and muscle, regardless of treatment, identifying this tissue as a major site of oxidation, in line with its characteristic mitochondria-rich and brown adipocyte phenotype (70). Despite high PDH activity, there were no differences in activity between CON and HOX fetuses and only a trend for increased PDH protein phosphorylation. Interestingly, expression of LDHA and MCT1 was increased in adipose tissue of HOX fetuses, supporting increased lactate production and export, which may contribute to the hyperlactatemia observed peripherally, consistent with observations in human (71). Alternatively, increased lactate production may have paracrine and autocrine signaling effects with the tissue that increase adipogenesis or inhibit lipolysis (72, 73). In IUGR models and other models of in utero nutrient restriction, increased insulin sensitivity for fetal nutrient (glucose) utilization (19, 22, 74) may promote lipogenesis and underlie increased relative fetal adipose mass (66) and adiposity postnatally (19, 74–77). Although we did not observe changes in basal AKT activation, we did find increased total adipose triglyceride content. This may reflect activation of pathways directly in the adipose tissue that redirect carbon flow away from oxidation and toward lipid synthesis or adipocyte expansion (78). Further studies are needed to measure the regulation of adipogenesis, lipogenesis, and adipocyte hypertrophy, and mechanisms linking hypoxemia with the regulation of these pathways.

HOX fetuses have 40%–50% reductions in plasma insulin (43) and IGF-I concentrations, indicating a low-growth phenotype. Indeed, fetal weight was positively associated with oxygen content and IGF-I concentrations; however, there were no differences in fetal weight, muscle mass, and linear growth measures between CON and HOX fetuses. This could represent two possibilities. First, the HOX fetus may have developed adaptations to defend its rate of oxidative metabolism and growth. Or, second, growth is constrained in the HOX fetus, but the duration of hypoxemia was not long enough to reduce fetal weight. In support of the former, lower glucose utilization, yet maintained oxygen consumption rates, supports mechanisms that allow the fetus to defend its oxidative metabolism and growth rate, via utilization and oxidation of alternate fuels, such as lactate or amino acids rather than glucose. In support of the latter, the net sum of the fetal nutrient-oxygen metabolic quotients for glucose, lactate, pyruvate, and amino acids was not greater than 1.0 in the HOX fetus (13), in contrast to CON fetuses where such values were greater than 1.0. This suggests that substrate supply may be limiting for maximal growth in the HOX fetus. We speculate that limited glucose utilization and oxidation precedes significant reductions in fetal weight, linear growth, and muscle mass, which could not be observed in the duration of our 9-day experimental timeframe. Accordingly, this model provides an opportunity to describe early events preceding indications of fetal growth restriction in the HOX fetus (13). Additional studies are needed to understand the progressive relationship between hypoxemia, endocrine responses, glucose metabolism, and fetal growth.

We acknowledge limitations in the current study. Although our results provide new information regarding tissue-specific contributions to whole body glucose, lactate, and pyruvate metabolism, additional mechanistic studies are needed to understand the impact on insulin sensitivity and pathways beyond regulation of carbohydrate metabolism. Specifically, our previous studies have shown that PI-IUGR fetuses demonstrate increased whole body insulin sensitivity for glucose utilization under basal and insulin-stimulated conditions (18, 19, 22, 77), yet limited capacity for glucose oxidation (18, 22). However, under basal conditions, we find no differences in insulin sensitivity in HOX fetuses. Studies using hypersinsulinemic clamps are needed to directly test insulin sensitivity for glucose utilization at the whole body and tissue level in HOX fetuses. In addition, PI-IUGR fetuses are exposed to chronic reductions in both glucose and oxygen, among other insults associated with placental insufficiency. The effect of experimental reductions in both oxygen and glucose remains to be tested in the fetal sheep model. Our data demonstrate relative increases in fetal lactate production; however, our results cannot discern between the contributions from the placental and fetal production. Since the glucose tracer infused in the umbilical blood circulates and exchanges with maternal blood, and the placenta consumes large quantities of glucose, the 13C labeling in the umbilical blood can represent either source. By comparing the relative enrichment in umbilical vein and fetal artery, we detected greater enrichment in fetal artery, in support of fetal lactate production from glucose. Studies using lactate tracers with direct fetal infusions are necessary to overcome this and test relationships between lactate-pyruvate flux between the fetus and placenta (13) and to identify which fetal tissues contribute to higher systemic lactate concentrations.

Summary and Implications

We identified mechanisms for how hypoxemia constrains glucose oxidative metabolism via fetal whole body and tissue-specific responses. Our results support that when oxygen is limiting, the hormones insulin and IGF-I that stimulate glucose utilization and oxidation are also lower. Understanding the mechanisms by which hypoxemia coordinates these metabolic adaptations is essential given the adverse outcomes that result from intrauteirne hypoxemia including fetal growth resriction, increased neontatal metabolic complications, and increased postnatal risk for insulin resistance, dysregylated glucose metabolism, and decreased mitochondrial oxidation (1, 21, 74, 79, 80). It also is important to understand the mechanisms that allow some fetuses to defend their rates of oxidative metabolism and maintain normal growth rates following intrauterine hypoxemia. Overall, our results highlight the vulnerability of nutrient sensing and metabolic pathways in the fetus and demonstrate tissue-specific responses that may represent critical early events that constrain glucose oxidation and initiate growth restriction in response to sustained hypoxemia.

GRANTS

This work was supported by the following National Institutes of Health Grants: R01-DK108910 (to S.R.W.); F32-DK120070 (to A.K.J.); T32-HD007186, R01-DK088139, R01-HD093701 (to P.J.R.); R01-HD079404 (to L.D.B.); R01-DK084842 (to S.W.L.); and S10-OD023553 (to L.D.B.).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

A.K.J., L.D.B., P.J.R., S.W.L., and S.R.W. conceived and designed research; A.K.J., D.W., D.A.G., and S.R.W. performed experiments; A.K.J., D.W., D.A.G., and S.R.W. analyzed data; A.K.J., L.D.B., P.J.R., S.W.L., and S.R.W. interpreted results of experiments; D.W. and S.R.W. prepared figures; S.R.W. drafted manuscript; A.K.J., D.W., D.A.G., L.D.B., P.J.R., S.W.L., and S.R.W. edited and revised manuscript; S.R.W. approved final version of manuscript.

ACKNOWLEDGMENTS

The summary figure was produced with BioRender.

REFERENCES

  • 1.Ducsay CA, Goyal R, Pearce WJ, Wilson S, Hu XQ, Zhang L. Gestational hypoxia and developmental plasticity. Physiol Rev 98: 1241–1334, 2018. doi: 10.1152/physrev.00043.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Moore LG. HYPOXIA AND REPRODUCTIVE HEALTH: reproductive challenges at high altitude: fertility, pregnancy and neonatal well-being. Reproduction 161: F81–F90, 2021. doi: 10.1530/REP-20-0349. [DOI] [PubMed] [Google Scholar]
  • 3.Taricco E, Radaelli T, Rossi G, Nobile de Santis MS, Bulfamante GP, Avagliano L, Cetin I. Effects of gestational diabetes on fetal oxygen and glucose levels in vivo. BJOG 116: 1729–1735, 2009. doi: 10.1111/j.1471-0528.2009.02341.x. [DOI] [PubMed] [Google Scholar]
  • 4.Ananth CV. Ischemic placental disease: a unifying concept for preeclampsia, intrauterine growth restriction, and placental abruption. Semin Perinatol 38: 131–132, 2014. doi: 10.1053/j.semperi.2014.03.001. [DOI] [PubMed] [Google Scholar]
  • 5.Hay WW Jr. Energy and substrate requirements of the placenta and fetus. Proc Nutr Soc 50: 321–336, 1991. doi: 10.1079/pns19910042. [DOI] [PubMed] [Google Scholar]
  • 6.Vaughan OR, Fowden AL. Placental metabolism: substrate requirements and the response to stress. Reprod Domest Anim 51, Suppl 2: 25–35, 2016. doi: 10.1111/rda.12797. [DOI] [PubMed] [Google Scholar]
  • 7.Illsley NP, Baumann MU. Human placental glucose transport in fetoplacental growth and metabolism. Biochim Biophys Acta Mol Basis Dis 1866: 165359, 2020. doi: 10.1016/j.bbadis.2018.12.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Marconi AM, Paolini C, Buscaglia M, Zerbe G, Battaglia FC, Pardi G. The impact of gestational age and fetal growth on the maternal-fetal glucose concentration difference. Obstet Gynecol 87: 937–942, 1996. doi: 10.1016/0029-7844(96)00048-8. [DOI] [PubMed] [Google Scholar]
  • 9.Hay WW, Jr, Myers SA, Sparks JW, Wilkening RB, Meschia G, Battaglia FC. Glucose and lactate oxidation rates in the fetal lamb. Proc Soc Exp Biol Med 173: 553–563, 1983. doi: 10.3181/00379727-173-41686. [DOI] [PubMed] [Google Scholar]
  • 10.Rozance PJ, Zastoupil L, Wesolowski SR, Goldstrohm DA, Strahan B, Cree-Green M, Sheffield-Moore M, Meschia G, Hay WW Jr, Wilkening RB, Brown LD. Skeletal muscle protein accretion rates and hindlimb growth are reduced in late gestation intrauterine growth-restricted fetal sheep. J Physiol 596: 67–82, 2018. doi: 10.1113/JP275230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Sparks JW, Hay WW Jr, Bonds D, Meschia G, Battaglia FC. Simultaneous measurements of lactate turnover rate and umbilical lactate uptake in the fetal lamb. J Clin Invest 70: 179–192, 1982. doi: 10.1172/jci110591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Houin SS, Rozance PJ, Brown LD, Hay WW Jr, Wilkening RB, Thorn SR. Coordinated changes in hepatic amino acid metabolism and endocrine signals support hepatic glucose production during fetal hypoglycemia. Am J Physiol Endocrinol Metab 308: E306–E314, 2015. doi: 10.1152/ajpendo.00396.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Jones AK, Rozance PJ, Brown LD, Lorca RA, Julian CG, Moore LG, Limesand SW, Wesolowski SR. Uteroplacental nutrient flux and evidence for metabolic reprogramming during sustained hypoxemia. Physiol Rep 9: e15033, 2021. doi: 10.14814/phy2.15033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hooper SB, Walker DW, Harding R. Oxygen, glucose, and lactate uptake by fetus and placenta during prolonged hypoxemia. Am J Physiol 268: R303–R309, 1995. doi: 10.1152/ajpregu.1995.268.2.R303. [DOI] [PubMed] [Google Scholar]
  • 15.Mann LI. Effects in sheep of hypoxia on levels of lactate, pyruvate, and glucose in blood of mothers and fetus. Pediatr Res 4: 46–54, 1970. doi: 10.1203/00006450-197001000-00005. [DOI] [PubMed] [Google Scholar]
  • 16.Boyle DW, Meschia G, Wilkening RB. Metabolic adaptation of fetal hindlimb to severe, nonlethal hypoxia. Am J Physiol Regul Integr Comp Physiol 263: R1130–R1135, 1992. doi: 10.1152/ajpregu.1992.263.5.R1130. [DOI] [PubMed] [Google Scholar]
  • 17.Milley JR. Uptake of exogenous substrates during hypoxia in fetal lambs. Am J Physiol 254: E572–E578, 1988. doi: 10.1152/ajpendo.1988.254.5.E572. [DOI] [PubMed] [Google Scholar]
  • 18.Limesand SW, Rozance PJ, Smith D, Hay WW Jr.. Increased insulin sensitivity and maintenance of glucose utilization rates in fetal sheep with placental insufficiency and intrauterine growth restriction. Am J Physiol Endocrinol Metab 293: E1716–E1725, 2007. doi: 10.1152/ajpendo.00459.2007. [DOI] [PubMed] [Google Scholar]
  • 19.Thorn SR, Brown LD, Rozance PJ, Hay WW Jr, Friedman JE. Increased hepatic glucose production in fetal sheep with intrauterine growth restriction is not suppressed by insulin. Diabetes 62: 65–73, 2013. doi: 10.2337/db11-1727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Davis MA, Camacho LE, Pendleton AL, Antolic AT, Luna-Ramirez RI, Kelly AC, Steffens NR, Anderson MJ, Limesand SW. Augmented glucose production is not contingent on high catecholamines in fetal sheep with IUGR. J Endocrinol 249: 195–207, 2021. doi: 10.1530/JOE-21-0071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Pendleton AL, Wesolowski SR, Regnault TRH, Lynch RM, Limesand SW. Dimming the powerhouse: mitochondrial dysfunction in the liver and skeletal muscle of intrauterine growth restricted fetuses. Front Endocrinol (Lausanne) 12: 612888, 2021. doi: 10.3389/fendo.2021.612888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Brown LD, Rozance PJ, Bruce JL, Friedman JE, Hay WW, Jr, Wesolowski SR. Limited capacity for glucose oxidation in fetal sheep with intrauterine growth restriction. Am J Physiol Regul Integr Comp Physiol 309: R920–R928, 2015. doi: 10.1152/ajpregu.00197.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Yates DT, Green AS, Limesand SW. Catecholamines mediate multiple fetal adaptations during placental insufficiency that contribute to intrauterine growth restriction: lessons from hyperthermic sheep. J Pregnancy 2011: 740408, 2011. doi: 10.1155/2011/740408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yates DT, Macko AR, Nearing M, Chen X, Rhoads RP, Limesand SW. Developmental programming in response to intrauterine growth restriction impairs myoblast function and skeletal muscle metabolism. J Pregnancy 2012: 631038, 2012. doi: 10.1155/2012/631038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pendleton AL, Humphreys LR, Davis MA, Camacho LE, Anderson MJ, Limesand SW. Increased pyruvate dehydrogenase activity in skeletal muscle of growth-restricted ovine fetuses. Am J Physiol Regul Integr Comp Physiol 317: R513–R520, 2019. doi: 10.1152/ajpregu.00106.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hay WW Jr, Meznarich HK, DiGiacomo JE, Hirst K, Zerbe G. Effects of insulin and glucose concentrations on glucose utilization in fetal sheep. Pediatr Res 23: 381–387, 1988. doi: 10.1203/00006450-198804000-00008. [DOI] [PubMed] [Google Scholar]
  • 27.Rozance PJ, Jones AK, Bourque SL, D'Alessandro A, Hay WW Jr, Brown LD, Wesolowski SR. Effects of chronic hyperinsulinemia on metabolic pathways and insulin signaling in the fetal liver. Am J Physiol Endocrinol Metab 319: E721–E733, 2020. doi: 10.1152/ajpendo.00323.2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.DiGiacomo JE, Hay WW, Jr.. Effect of hypoinsulinemia and hyperglycemia on fetal glucose utilization. Am J Physiol 259: E506–E512, 1990. doi: 10.1152/ajpendo.1990.259.4.E506. [DOI] [PubMed] [Google Scholar]
  • 29.Hay WW, Jr, DiGiacomo JE, Meznarich HK, Hirst K, Zerbe G. Effects of glucose and insulin on fetal glucose oxidation and oxygen consumption. Am J Physiol 256: E704–E713, 1989. doi: 10.1152/ajpendo.1989.256.6.E704. [DOI] [PubMed] [Google Scholar]
  • 30.Hay WW Jr, Meznarich HK. The effect of hyperinsulinaemia on glucose utilization and oxidation and on oxygen consumption in the fetal lamb. Q J Exp Physiol 71: 689–698, 1986. doi: 10.1113/expphysiol.1986.sp003027. [DOI] [PubMed] [Google Scholar]
  • 31.Fowden AL, Forhead AJ. Insulin deficiency alters the metabolic and endocrine responses to undernutrition in fetal sheep near term. Endocrinology 153: 4008–4018, 2012. doi: 10.1210/en.2012-1063. [DOI] [PubMed] [Google Scholar]
  • 32.Davis MA, Camacho LE, Anderson MJ, Steffens NR, Pendleton AL, Kelly AC, Limesand SW. Chronically elevated norepinephrine concentrations lower glucose uptake in fetal sheep. Am J Physiol Regul Integr Comp Physiol 319: R255–R263, 2020. doi: 10.1152/ajpregu.00365.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Vaughan OR, De Blasio MJ, Fowden AL. Ovine uteroplacental and fetal metabolism during and after fetal cortisol overexposure in late gestation. Am J Physiol Regul Integr Comp Physiol 314: R791–R801, 2018. doi: 10.1152/ajpregu.00194.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Rozance PJ, Wesolowski SR, Jonker SS, Brown LD. Anemic hypoxemia reduces myoblast proliferation and muscle growth in late-gestation fetal sheep. Am J Physiol Regul Integr Comp Physiol 321: R352–R363, 2021. doi: 10.1152/ajpregu.00342.2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Timmerman M, Teng C, Wilkening RB, Chung M, Battaglia FC. Net amino acid flux across the fetal liver and placenta during spontaneous ovine parturition. Biol Neonate 79: 54–60, 2001. doi: 10.1159/000047066. [DOI] [PubMed] [Google Scholar]
  • 36.Holcomb RG, Wilkening RB. Fetal hepatic oxygen consumption under normal conditions in the fetal lamb. Biol Neonate 75: 310–318, 1999. doi: 10.1159/000014109. [DOI] [PubMed] [Google Scholar]
  • 37.Teng C, Battaglia FC, Meschia G, Narkewicz MR, Wilkening RB. Fetal hepatic and umbilical uptakes of glucogenic substrates during a glucagon-somatostatin infusion. Am J Physiol Endocrinol Metab 282: E542–E550, 2002. doi: 10.1152/ajpendo.00248.2001. [DOI] [PubMed] [Google Scholar]
  • 38.Rabinowitz JD, Enerbäck S. Lactate: the ugly duckling of energy metabolism. Nat Metab 2: 566–571, 2020. doi: 10.1038/s42255-020-0243-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.McCommis KS, Chen Z, Fu X, McDonald WG, Colca JR, Kletzien RF, Burgess SC, Finck BN. Loss of mitochondrial pyruvate carrier 2 in the liver leads to defects in gluconeogenesis and compensation via pyruvate-alanine cycling. Cell Metab 22: 682–694, 2015. doi: 10.1016/j.cmet.2015.07.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Draoui N, Feron O. Lactate shuttles at a glance: from physiological paradigms to anti-cancer treatments. Dis Model Mech 4: 727–732, 2011. doi: 10.1242/dmm.007724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Gladden LB. Lactate metabolism: a new paradigm for the third millennium. J Physiol 558: 5–30, 2004. doi: 10.1113/jphysiol.2003.058701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Brooks GA. The science and translation of lactate shuttle theory. Cell Metab 27: 757–785, 2018. doi: 10.1016/j.cmet.2018.03.008. [DOI] [PubMed] [Google Scholar]
  • 43.Jones AK, Rozance PJ, Brown LD, Goldstrohm DA, Hay WW Jr, Limesand SW, Wesolowski SR. Sustained hypoxemia in late gestation potentiates hepatic gluconeogenic gene expression but does not activate glucose production in the ovine fetus. Am J Physiol Endocrinol Metab 317: E1–E10, 2019. doi: 10.1152/ajpendo.00069.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Percie Du Sert N, Ahluwalia A, Alam S, Avey MT, Baker M, Browne WJ, Clark A, Cuthill IC, Dirnagl U, Emerson M, Garner P, Holgate ST, Howells DW, Hurst V, Karp NA, Lazic SE, Lidster K, MacCallum CJ, Macleod M, Pearl EJ, Petersen OH, Rawle F, Reynolds P, Rooney K, Sena ES, Silberberg SD, Steckler T, Würbel H. Reporting animal research: explanation and elaboration for the ARRIVE guidelines 2.0. PLoS Biol 18: e3000411, 2020. doi: 10.1371/journal.pbio.3000411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Brown LD, Kohn JR, Rozance PJ, Hay WW Jr, Wesolowski SR. Exogenous amino acids suppress glucose oxidation and potentiate hepatic glucose production in late gestation fetal sheep. Am J Physiol Regul Integr Comp Physiol 312: R654–R663, 2017. doi: 10.1152/ajpregu.00502.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55: 611–622, 2009. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed] [Google Scholar]
  • 47.Jones AK, Brown LD, Rozance PJ, Serkova NJ, Hay WW Jr, Friedman JE, Wesolowski SR. Differential effects of intrauterine growth restriction and a hypersinsulinemic-isoglycemic clamp on metabolic pathways and insulin action in the fetal liver. Am J Physiol Regul Integr Comp Physiol 316: R427–R440, 2019. doi: 10.1152/ajpregu.00359.2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Brown LD, Rozance PJ, Barry JS, Friedman JE, Hay WW Jr.. Insulin is required for amino acid stimulation of dual pathways for translational control in skeletal muscle in the late-gestation ovine fetus. Am J Physiol Endocrinol Metab 296: E56–E63, 2009. doi: 10.1152/ajpendo.90310.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Boehmer BH, Brown LD, Wesolowski SR, Hay WW, Rozance PJ. A chronic fetal leucine infusion potentiates fetal insulin secretion and increases pancreatic islet size, vascularity, and β cells in late-gestation sheep. J Nutr 150: 2061–2069, 2020. doi: 10.1093/jn/nxaa138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Burd LI, Jones MD Jr, Simmons MA, Makowski EL, Meschia G, Battaglia FC. Placental production and foetal utilisation of lactate and pyruvate. Nature 254: 710–711, 1975. doi: 10.1038/254710a0. [DOI] [PubMed] [Google Scholar]
  • 51.Illsley NP, Caniggia I, Zamudio S. Placental metabolic reprogramming: do changes in the mix of energy-generating substrates modulate fetal growth? Int J Dev Biol 54: 409–419, 2010. doi: 10.1387/ijdb.082798ni. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Vaughan OR, Davies KL, Ward JW, de Blasio MJ, Fowden AL. A physiological increase in maternal cortisol alters uteroplacental metabolism in the pregnant ewe. J Physiol 594: 6407–6418, 2016. doi: 10.1113/JP272301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Higgins JS, Vaughan OR, Fernandez de Liger E, Fowden AL, Sferruzzi-Perri AN. Placental phenotype and resource allocation to fetal growth are modified by the timing and degree of hypoxia during mouse pregnancy. J Physiol 594: 1341–1356, 2016. doi: 10.1113/JP271057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Cilvik SN, Wesolowski SR, Anthony RV, Brown LD, Rozance PJ. Late gestation fetal hyperglucagonaemia impairs placental function and results in diminished fetal protein accretion and decreased fetal growth. J Physiol 599: 3403–3427, 2021. doi: 10.1113/JP281288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Joseph S, Alava B, Antolic A, Richards EM, Wood CE, Keller-Wood M. Fetal ovine skeletal and cardiac muscle transcriptomics are differentially altered by increased maternal cortisol during gestation. Physiol Genomics 52: 178–190, 2020. doi: 10.1152/physiolgenomics.00096.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Sonveaux P, Végran F, Schroeder T, Wergin MC, Verrax J, Rabbani ZN, De Saedeleer CJ, Kennedy KM, Diepart C, Jordan BF, Kelley MJ, Gallez B, Wahl ML, Feron O, Dewhirst MW. Targeting lactate-fueled respiration selectively kills hypoxic tumor cells in mice. J Clin Invest 118: 3930–3942, 2008. doi: 10.1172/JCI36843. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Semenza GL. Tumor metabolism: cancer cells give and take lactate. J Clin Invest 118: 3835–3837, 2008. doi: 10.1172/JCI37373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Prabhakar NR, Semenza GL. Oxygen sensing and homeostasis. Physiology (Bethesda) 30: 340–348, 2015. doi: 10.1152/physiol.00022.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Yates DT, Macko AR, Chen X, Green AS, Kelly AC, Anderson MJ, Fowden AL, Limesand SW. Hypoxaemia-induced catecholamine secretion from adrenal chromaffin cells inhibits glucose-stimulated hyperinsulinaemia in fetal sheep. J Physiol 590: 5439–5447, 2012. doi: 10.1113/jphysiol.2012.237347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Limesand SW, Rozance PJ. Fetal adaptations in insulin secretion result from high catecholamines during placental insufficiency. J Physiol 595: 5103–5113, 2017. doi: 10.1113/JP273324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Boehmer BH, Limesand SW, Rozance PJ. The impact of IUGR on pancreatic islet development and β-cell function. J Endocrinol 235: R63–R76, 2017. doi: 10.1530/JOE-17-0076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Andrews SE, Brown LD, Thorn SR, Limesand SW, Davis M, Hay WW Jr, Rozance PJ. Increased adrenergic signaling is responsible for decreased glucose-stimulated insulin secretion in the chronically hyperinsulinemic ovine fetus. Endocrinology 156: 367–376, 2015. doi: 10.1210/en.2014-1393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Kelly AC, Camacho LE, Pendarvis K, Davenport HM, Steffens NR, Smith KE, Weber CS, Lynch RM, Papas KK, Limesand SW. Adrenergic receptor stimulation suppresses oxidative metabolism in isolated rat islets and Min6 cells. Mol Cell Endocrinol 473: 136–145, 2018. doi: 10.1016/j.mce.2018.01.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Macko AR, Yates DT, Chen X, Shelton LA, Kelly AC, Davis MA, Camacho LE, Anderson MJ, Limesand SW. Adrenal demedullation and oxygen supplementation independently increase glucose-stimulated insulin concentrations in fetal sheep with intrauterine growth restriction. Endocrinology 157: 2104–2115, 2016. doi: 10.1210/en.2015-1850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Straub SG, Sharp GW. Evolving insights regarding mechanisms for the inhibition of insulin release by norepinephrine and heterotrimeric G proteins. Am J Physiol Cell Physiol 302: C1687–C1698, 2012. doi: 10.1152/ajpcell.00282.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Chen X, Fahy AL, Green AS, Anderson MJ, Rhoads RP, Limesand SW. β2-Adrenergic receptor desensitization in perirenal adipose tissue in fetuses and lambs with placental insufficiency-induced intrauterine growth restriction. J Physiol 588: 3539–3549, 2010. doi: 10.1113/jphysiol.2010.192310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Mühlhäusler BS, Roberts CT, Yuen BS, Marrocco E, Budge H, Symonds ME, McFarlane JR, Kauter KG, Stagg P, Pearse JK, McMillen IC. Determinants of fetal leptin synthesis, fat mass, and circulating leptin concentrations in well-nourished ewes in late pregnancy. Endocrinology 144: 4947–4954, 2003. doi: 10.1210/en.2003-0555. [DOI] [PubMed] [Google Scholar]
  • 68.Stevens D, Alexander G, Bell AW. Effect of prolonged glucose infusion into fetal sheep on body growth, fat deposition and gestation length. J Dev Physiol 13: 277–281, 1990. [PubMed] [Google Scholar]
  • 69.Stevens D, Alexander G. Lipid deposition after hypophysectomy and growth hormone treatment in the sheep fetus. J Dev Physiol 8: 139–145, 1986. [PubMed] [Google Scholar]
  • 70.Symonds ME, Pope M, Budge H. The ontogeny of brown adipose tissue. Annu Rev Nutr 35: 295–320, 2015. doi: 10.1146/annurev-nutr-071813-105330. [DOI] [PubMed] [Google Scholar]
  • 71.DiGirolamo M, Newby FD, Lovejoy J. Lactate production in adipose tissue: a regulated function with extra-adipose implications. FASEB J 6: 2405–2412, 1992. doi: 10.1096/fasebj.6.7.1563593. [DOI] [PubMed] [Google Scholar]
  • 72.Ahmed K, Tunaru S, Tang C, Müller M, Gille A, Sassmann A, Hanson J, Offermanns S. An autocrine lactate loop mediates insulin-dependent inhibition of lipolysis through GPR81. Cell Metab 11: 311–319, 2010. doi: 10.1016/j.cmet.2010.02.012. [DOI] [PubMed] [Google Scholar]
  • 73.Cai TQ, Ren N, Jin L, Cheng K, Kash S, Chen R, Wright SD, Taggart AK, Waters MG. Role of GPR81 in lactate-mediated reduction of adipose lipolysis. Biochem Biophys Res Commun 377: 987–991, 2008. doi: 10.1016/j.bbrc.2008.10.088. [DOI] [PubMed] [Google Scholar]
  • 74.Thorn SR, Rozance PJ, Brown LD, Hay WW Jr.. The intrauterine growth restriction phenotype: fetal adaptations and potential implications for later life insulin resistance and diabetes. Semin Reprod Med 29: 225–236, 2011. doi: 10.1055/s-0031-1275516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Lie S, Morrison JL, Williams-Wyss O, Ozanne SE, Zhang S, Walker SK, Kleemann DO, MacLaughlin SM, Roberts CT, McMillen IC. Impact of embryo number and periconceptional undernutrition on factors regulating adipogenesis, lipogenesis, and metabolism in adipose tissue in the sheep fetus. Am J Physiol Endocrinol Metab 305: E931–E941, 2013. doi: 10.1152/ajpendo.00180.2013. [DOI] [PubMed] [Google Scholar]
  • 76.De Blasio MJ, Gatford KL, McMillen IC, Robinson JS, Owens JA. Placental restriction of fetal growth increases insulin action, growth, and adiposity in the young lamb. Endocrinology 148: 1350–1358, 2007. doi: 10.1210/en.2006-0653. [DOI] [PubMed] [Google Scholar]
  • 77.Wallace JM, Milne JS, Aitken RP, Hay WW Jr.. Sensitivity to metabolic signals in late-gestation growth-restricted fetuses from rapidly growing adolescent sheep. Am J Physiol Endocrinol Metab 293: E1233–E1241, 2007. doi: 10.1152/ajpendo.00294.2007. [DOI] [PubMed] [Google Scholar]
  • 78.Morigny P, Boucher J, Arner P, Langin D. Lipid and glucose metabolism in white adipocytes: pathways, dysfunction and therapeutics. Nat Rev Endocrinol 17: 276–295, 2021. doi: 10.1038/s41574-021-00471-8. [DOI] [PubMed] [Google Scholar]
  • 79.Giussani DA, Davidge ST. Developmental programming of cardiovascular disease by prenatal hypoxia. J Dev Orig Health Dis 4: 328–337, 2013. doi: 10.1017/S204017441300010X. [DOI] [PubMed] [Google Scholar]
  • 80.Wesolowski SR, Kasmi KC, Jonscher KR, Friedman JE. Developmental origins of NAFLD: a womb with a clue. Nat Rev Gastroenterol Hepatol 14: 81–96, 2017. doi: 10.1038/nrgastro.2016.160. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from American Journal of Physiology - Endocrinology and Metabolism are provided here courtesy of American Physiological Society

RESOURCES