| Strain, strain background Mice (Females) |
9–11 Weeks |
Jackson Laboratories |
C57BL6/J, RRID:IMSR_JAX:000664
|
5–8 per study |
| Biological sample (Humans) |
Plasma samples from 285 patients |
Cleveland Clinic Foundation; University of Louisville; University of Massachusetts Medical School; University of Texas Southwestern Medical Center |
Not provided |
|
| Biological sample (Humans) |
Liver samples from five healthy donors |
Clinical Resource for Alcoholic Hepatitis Investigations at Johns Hopkins University |
Not provided |
|
| Biological sample (Humans) |
Liver samples from five patients with severe AH |
Clinical Resource for Alcoholic Hepatitis Investigations at Johns Hopkins University |
Not provided |
|
| Antibody |
Anti-FMO3 (Rabbit monoclonal) |
Abcam |
Cat# ab126790, RRID: AB_11128907
|
1:1000 (WB) |
| Antibody |
Anti-HSC70 (Mouse monoclonal) |
Santa Cruz Biotechnology |
Cat# sc-7298, RRID: AB_627761
|
1:1000 (WB) |
| Antibody |
Anti-rabbit IgG HRP |
GE-Healthcare |
Cat#: NA934-100UL, RRID: AB_772206
|
1:5000 (WB) |
| Antibody |
Anti-mouse IgG HRP |
GE-Healthcare |
NA931V, RRID: AB_772210
|
1:5000 (WB) |
| Sequence-based reagent |
Mouse Tnfα |
Sigma |
PCR primers |
F:CCACCACGCTCTTCTGTCTACR:AGGGTCTGGGCCATAGAACT |
| Sequence-based reagent |
Mouse Il1β |
Sigma |
PCR primers |
F:AGTTGACGGACCCCAAAAGR:AGCTGGATGCTCTCATCAGG |
| Sequence-based reagent |
Mouse Fmo3 |
Sigma |
PCR primers |
F:CCCACATGCTTTGAGAGGAGR:GGAAGAGTTGGTGAAGACCG |
| Sequence-based reagent |
Mouse Taar5 |
Sigma |
PCR primers |
F:AAAGAAAAGCTGCCAAGAR:AAGGGAAGCCAACACACA |
| Sequence-based reagent |
Mouse CyclophilinA |
Sigma |
PCR primers |
F:GCGGCAGGTCCATCTACGR:GCCATCCAGCCATTCAGTC |
| Sequence-based reagent |
Mouse Cxcl1 |
IDT |
PCR primers |
F:TGCACCCAAACCGAAGTCR:GTCAGAAGCCAGCGTTCACC |
| Sequence-based reagent |
Mouse Grp78 |
IDT |
PCR primers |
F:ACTTGGGGACCACCTATTCCTR:ATCGCCAATCAGACGCTCC |
| Commercial assay or kit |
AST Commercial Kit |
Sekisui Diagnostics |
319–30 |
|
| Commercial assay or kit |
ALT Commercial Kit |
Sekisui Diagnostics |
318–30 |
|
| Commercial assay or kit |
Triglyceride Commercial Kit |
Wako |
994–02891 |
|
| Commercial assay or kit |
Total Cholesterol Commercial Kit |
Fisher Scientific |
TR134321 |
|
| Commercial assay or kit |
Free Cholesterol Commercial Kit |
Wako |
993–02501 |
|
| Commercial assay or kit |
RNAeasy Lipid Tissue Mini Kit |
Qiagen |
74804 |
|
| Commercial assay or kit |
Thermo Scientific Pierce TiO2 Phosphopeptide Enrichment and Clean-up Kit |
Fisher Scientific |
PI88301 |
|
| Commercial assay or kit |
RNAeasy Purification Kit |
Qiagen |
74004 |
|
| Chemical compound, drug |
Iodomethylcholine (IMC) |
Synthesized at the Cleveland Clinic |
Not provided |
|
| Chemical compound, drug |
Fluoromethylcholine (FMC) |
Synthesized at the Cleveland Clinic |
Not provided |
|
| Chemical compound, drug |
Trimethylamine Hydrochloride |
Sigma |
T72761 |
|
| Chemical compound, drug |
Lipopolysaccharide |
Sigma |
L4391 |
|
| Software, algorithm |
GraphPad Prism |
GraphPad Software, Inc |
8.4 |
|
| Software, algorithm |
DADA2 |
https://benjjneb.github.io/dada2/dada-installation.html; Callahan et al., 2016
|
1.16 |
|
| Software, algorithm |
Phyloseq |
https://www.bioconductor.org/packages/release/bioc/html/phyloseq.html
|
4.1, RRID:SCR_013080
|
|
| Software, algorithm |
microbiomeSeq |
https://github.com/umerijaz/microbiomeSeq
|
1: RRID:SCR_002630
|
|
| Software, algorithm |
Ggplot2 |
https://cran.r-project.org/web/packages/ggplot2/index.html
|
3.3.5, RRID:SCR_014601
|
|
| Software, algorithm |
vegan |
https://cran.r-project.org/web/packages/vegan/index.html
|
2.5–7 |
|
| Other |
Supersignal West Pico Plus Substrate |
Thermo Fisher |
34577 |
|
| Other |
Diet |
Dyets |
710260 |
|
