Abstract
Accumulation of formaldehyde, a highly reactive molecule, in the cell is toxic, and requires detoxification for the organism's survival. Mycothiol‐dependent formaldehyde dehydrogenase or S‐nitrosomycothiol reductase (MscR) from Mycobacterium smegmatis and Mycobacterium tuberculosis was previously known for detoxifying formaldehyde and protecting the cell against nitrosative stress. We here show that M. smegmatis MscR exhibits a mycothiol‐independent formaldehyde dehydrogenase (FDH) activity in vitro. Presence of zinc in the reaction enhances MscR activity, thus making it a zinc‐dependent FDH. Interestingly, MscR utilizes only formaldehyde and no other primary aldehydes as its substrate in vitro, and M. smegmatis lacking mscR (ΔmscR) shows sensitivity exclusively toward formaldehyde. Bioinformatics analysis of MscRs from various bacteria reveals 10 positionally conserved cysteines, whose importance in structural stability and biological activity is not yet investigated. To explore the significance of these cysteines, we generated MscR single Cys variants by systematically replacing each cysteine with serine. All of the Cys variants except C39S and C309S are unable to show a complete rescue of ΔmscR on formaldehyde, show a significant loss of enzymatic activity in vitro, pronounced structural alterations as probed by circular dichroism, and loss of homotetramerization on size exclusion chromatography. Our data thus reveal the importance of intact cysteines in the structural stability and biological activity of MscR, which is a dedicated FDH in M. smegmatis, and shows ~84% identity with M. tuberculosis MscR. We believe that this knowledge will further help in the development of FDH as a potential drug target against M. tuberculosis infections.
Keywords: conserved cysteine, cysteine mutants, formaldehyde stress, M. smegmatis, mycothiol‐dependent formaldehyde dehydrogenase, site directed mutagenesis
1. INTRODUCTION
Formaldehyde is a cytotoxic compound that can be either generated through various metabolic processes in the bacterial cell or absorbed from the environment including when produced by the host. Formaldehyde is known to rapidly react with biological macromolecules, thus forming nonspecific cross‐links and ultimately damaging the DNA. 1 , 2 , 3 , 4 , 5 , 6 , 7 Although formaldehyde is toxic, it acts as an essential central metabolite in various methylotrophs when grown on a single carbon compound. 8 Specialized formaldehyde detoxification systems are found in all the domains of life to prevent cellular damage due to formaldehyde accumulation. 2 These systems generally involve strategies to oxidize formaldehyde into lesser toxic formate. 9 , 10 , 11 , 12
Formaldehyde dehydrogenase (FDH) is the primary enzyme that detoxifies formaldehyde inside the cell by efficiently capturing and limiting it from reaching a toxic level. FDHs found in different organisms vary in terms of cofactor dependency, metal requirement, and quaternary structure. Majority of the bacterial FDHs characterized so far utilize mycothiol, glutathione, tetrahydrofolate, or tetrahydromethanopterin as cofactor. 7 , 13 , 14 Glutathione (GSH)‐dependent FDH is present in gram‐negative bacteria such as Escherichia coli, 3 , 15 whereas gram‐positive bacteria such as Bacillus subtilis 16 and Paracoccus denitrificans 17 utilize a low molecular weight thiol, mycothiol (MSH) as a cofactor. In several other bacterial species such as Pseudomonas aeruginosa, Pseudomonas putida, and Burkholderia fungorum, formaldehyde oxidation occurs in a single step that is factor independent. 9 , 10 , 11 , 12 FDH (FadH) from Corynebacterium glutamicum shows mycothiol‐dependent formaldehyde oxidation activity and a mycothiol‐independent alcohol dehydrogenase activity. 18 Besides acting as alcohols/aldehyde dehydrogenase, 19 NAD+‐dependent FDH also plays a role in detoxifying nitrosothiols. 20 S‐nitrosothiol reductase activity is an inherent property of GSH‐dependent FDHs. 20 The nitrosoglutathione (GSNO) formed by the reaction of the thiol, glutathione (GSH), and nitric oxide (NO) is cleaved back to GSH and NO by S‐nitrosoglutathione reductase (GSNOR). Mycobacterium smegmatis is nonpathogenic soil‐dwelling mycobacteria that contains mycothiol (MSH), an analog of glutathione (GSH), and utilizes a mycothiol‐dependent FDH (MscR) for formaldehyde detoxification. MscR is also active as an S‐nitrosomycothiol reductase and can efficiently help in dissimilating the NO stress imparted on mycobacterial cells. 20 FDH found in Mycobacterium tuberculosis, the causative agent of deadly tuberculosis, also possesses dehydrogenase and reductase activities and shares similarities with that of the FDH from M. smegmatis. A deletion mutant of mscR was unable to form in vitro biofilm and survive in formaldehyde stress. 21 The sensing and regulation of such enzymes and regulators may involve the interaction between formaldehyde and conserved cysteines present in the protein. 22 , 23 FDHs and GSNORs are usually rich in highly conserved cysteines, and are found in plants, animals, and prokaryotes. 23 , 24 These evolutionarily conserved cysteines can serve as nitrosation sites and be involved in regulating protein nitrosation, thus modulating GSNOR activity. 22
In this study, we carry out a detailed biophysical and biochemical characterization of MscR from M. smegmatis. We show that MscR is a zinc‐dependent homotetrameric FDH that is exclusively involved in formaldehyde detoxification. Our studies further reveal the importance of conserved cysteines in the structure, stability, and function of MscR. To the best of our knowledge, this is the first detailed dissection of an alcohol/aldehyde dehydrogenase in mycobacteria, dictating the catalytic and structural importance of conserved cysteines. We believe that our findings provide insights into the structure and function of a mycobacterial FDH, which is important for the survival of mycobacteria under stressful conditions.
2. RESULTS
2.1. MscR is a Zn‐dependent homotetrameric FDH
Mycothiol‐dependent FDH, MscR (MSMEG_4340), from M. smegmatis is a medium‐chain dehydrogenase that is known to prevent cells from formaldehyde mediated toxicity. 21 Many prokaryotic mycothiol‐dependent FDHs show a functional correlation with zinc‐containing alcohol dehydrogenase. 19 These thiol‐dependent FDHs are usually NAD‐dependent and require zinc ions. 11 , 18 To biochemically characterize MscR from M. smegmatis, we first cloned MscR‐coding gene from M. smegmatis mc2155 in an E. coli expression vector, overexpressed the protein in E. coli BL21(DE3) cells, and purified it by following the Ni‐nitrilotriacetic acid (Ni‐NTA) column chromatography. The in vitro activity assays were performed using the NAD+ as an electron acceptor and the formation of NADH was measured by monitoring the absorbance at 340 nm. In order to examine the primary aldehyde that the MscR oxidizes, we used formaldehyde, acetaldehyde, and propionaldehyde as substrates and examined the enzyme activity. Our data show that MscR preferentially oxidizes formaldehyde (Figure 1a). Next, to understand metal dependency of MscR, we performed in vitro activity assay using formaldehyde as the substrate in the presence of zinc metal ions (Figure 1b). We observe a significantly enhanced activity of MscR in the presence Zn2+, which suggests that MscR is a zinc‐dependent FDH.
FIGURE 1.

MscR is a Zn‐dependent homotetrameric formaldehyde dehydrogenase. (a) The plot shows the specific activity (SA) of purified MscR with formaldehyde (FA), acetaldehyde (AA), and propionaldehyde (PA) as substrates. (b) The SA of purified MscR with formaldehyde as substrate in the presence (+Zn) and absence (−Zn) of Zn2+. In both panels (a) and (b), SA is plotted as μmol per min per mg of MscR protein. (c) The graph shows the size exclusion chromatography data obtained by plotting the elution volume (V e in ml) and the absorbance of protein at 280 nm (A280). The purified native MscR (wildtype [WT]) with a monomeric molecular weight of 39.3 kDa elutes with an apparent molecular weight of ~158 kDa. For column calibration, known molecular weight proteins (thyroglobulin, 669 kDa; ferritin, 440 kDa; aldolase, 158 kDa; conalbumin, 75 kDa; ovalbumin, 43 kDa) are used with their molecular weights marked in the graph. In both panels (a) and (b), the data represent an average of at least three independent experiments with error bars denoting SD. “****,” p‐value <.0001
Although most FDHs show similar metal dependency, 18 they differ in their oligomeric conformation. Medium‐chain dehydrogenase is similar to glutathione‐dependent FDH that forms a dimer, 25 whereas factor‐dependent FDH from Amycolatopsis methanolica forms a homotrimer. 26 We, therefore, examined the oligomeric state of MscR by performing size exclusion chromatography. We show that MscR (monomeric molecular weight 39.3 kDa) elutes at ~158 kDa (Figure 1c), thus suggesting that the protein in solution exists as a homotetramer.
2.2. MscR is a dedicated FDH and its overexpression leads to enhanced formaldehyde tolerance in M. smegmatis
We have previously shown that MscR is able to oxidize both formaldehyde and methanol in vitro. 27 However, M. smegmatis lacking MscR is unable to grow on the medium containing formaldehyde, 21 , 27 which suggests that MscR has specificity toward aldehydes rather than alcohols. Aldehyde dehydrogenases are known to oxidize more than one aldehyde in vitro. However, we here show that MscR is able to oxidize only formaldehyde in vitro (Figure 1a). To further examine this in vivo, we performed spot assays with M. smegmatis and monitored the growth of wildtype, mscR knockout (ΔmscR), and mscR‐complemented strain in the presence of formaldehyde, acetaldehyde, and propionaldehyde. Our data show that ∆mscR strain does not grow on formaldehyde (Figures 2a and S1), as has been reported previously. 21 , 27 We additionally show that deletion of mscR in M. smegmatis does not affect bacterial growth in presence of other aldehydes (Figures 2a and S1). This observation concurs with our in vitro data (Figure 1a), wherein we show that MscR is unable to oxidize other aldehydes. Taken together, we thus conclude that the high specificity of MscR for formaldehyde renders it as a dedicated FDH in M. smegmatis.
FIGURE 2.

MscR is a dedicated formaldehyde dehydrogenase and its overexpression leads to enhanced tolerance in Mycobacterium smegmatis. (a) Spot assay of wildtype M. smegmatis (WT), mscR knockout (ΔmscR), and the complemented strain (ΔmscR C ) in the absence (−ALD) and presence of various aldehydes such as formaldehyde (+FA), acetaldehyde (+AA), and propionaldehyde (+PA) is shown. The triangle above each image represents the serial dilution. (b) Residual formaldehyde levels present in the culture medium at different time intervals are plotted for the M. smegmatis wildtype (WT), mscR knockout (ΔmscR), and the complemented strain (ΔmscR C ) during their growth upon addition of formaldehyde. Control represents media with formaldehyde but without any cells. The data are a representation of an average of three independent experiments with error bars indicating SD. “***,” p‐value <.0002; “****,” p‐value <.0001; ns—not significant. (c) The graph shows the growth of mycobacterial strains such as M. smegmatis (WT), mscR knockout (ΔmscR), and the complemented strain (ΔmscR C ) measured in the absence (0 mM) and presence of 2 mM formaldehyde by monitoring the culture optical density at 600 nm (OD600) at different time intervals
We next asked if and to what extent does M. smegmatis consumes formaldehyde present in the growth medium. To address this, we monitored formaldehyde utilization in M. smegmatis wildtype, ΔmscR, and the mscR‐complemented strain by measuring the residual formaldehyde concentration in the medium at different time intervals. We observe that while the wildtype and the mscR‐complemented strains show near‐complete utilization of formaldehyde present in the growth medium, ΔmscR is unable to show such behavior (Figure 2b). Our data thus further confirm that MscR is indispensable for formaldehyde detoxification in M. smegmatis. We additionally monitored the growth of all the three strains of M. smegmatis, namely wildtype, ∆mscR knockout, and mscR‐complemented in the presence of higher amounts (2 mM) of formaldehyde to understand the extent of detoxification of formaldehyde by the bacterium. Interestingly, we find that the mscR‐complemented strain is capable of tolerating 2 mM formaldehyde as compared to the other two strains (Figure 2c). Taken together, we conclude that besides being essential for the bacterial growth on formaldehyde and being involved in its detoxification, MscR overexpression also leads to an enhanced tolerance to formaldehyde in M. smegmatis.
2.3. Conserved cysteines present in MscR are important for function
We noticed that MscR from M. smegmatis is a cysteine‐rich protein having 10 cysteine residues per monomer, and examined the presence of these cysteines in the FDHs from various organisms. Upon querying the UniProt database with term “FDH mycothiol dependent,” we obtained nearly 2076 sequences from bacterial origin that were used for multiple sequence alignment and weblogo generation to examine cysteine conservation. Very interestingly, nearly all the cysteines are found to be conserved when bacterial FDHs are taken into account (Figure 3). This clearly hints toward an important role of cysteines in bacterial mycothiol‐dependent FDHs. Therefore, in order to investigate the significance of Cys in MscR from M. smegmatis, we systematically replaced cysteine with serine at each position in the wildtype MscR and expressed the mutants in M. smegmatis ΔmscR to see bacterial survival in the presence of exogenously added formaldehyde. Our data show that only C39S and C309S are able to completely rescue the growth of ΔmscR on formaldehyde‐containing medium (Figure 4a). Interestingly, while the C93S and C145S show significantly lesser tolerance to formaldehyde with the latter being more tolerating than the former, C42S, C96S, C99S, C107S, C162, and C188S mutants are unable to support the growth of ΔmscR on formaldehyde (Figure 4a). While all the proteins expressed in the ΔmscR cells, we were unable to detect C188S protein in ΔmscR cell lysate (Figure S2). Hence, at this juncture, we are unable to conclude if the inability of C188S to sustain bacterial growth on formaldehyde‐containing medium is because of loss of function of the protein, as is confirmed by in vitro activity assay (see below). We next expressed all the MscR cysteine mutants in E. coli BL21(DE3), purified on Ni‐NTA chromatography (Figure S3), and performed in vitro formaldehyde oxidation assay (Figure 4b). The activity assay data concur with the in vivo complementation experiment with the mutant proteins. In other words, the mutants that are able to rescue the growth of ΔmscR on formaldehyde show in vitro enzyme activity, whereas the other mutants fail to show any formaldehyde oxidation, including C188S. Our data thus clearly show the importance of various cysteines in MscR activity.
FIGURE 3.

Comparison of protein sequences of mycothiol‐dependent formaldehyde dehydrogenases from various bacteria. The figure represents a weblogo, generated for all the cysteine‐containing regions present in the bacterial mycothiol dependent formaldehyde dehydrogenases. The y‐axis shows the relative frequency of the occurrence of amino acid at that position; a value of four bits represents 100% conservation. The x‐axis shows the position of the amino acid with respect to Mycobacterium smegmatis MscR. The position of cysteine in each case is marked with an asterisk (*)
FIGURE 4.

Importance of conserved cysteine residues in the phenotypic rescue of mscR knock‐out and the catalytic activity of the enzyme. (a) Panel shows the spot assay performed for the wildtype Mycobacterium smegmatis (WT), mscR knockout (ΔmscR), and the knockout complemented with either WT MscR (ΔmscR C ) or cysteine‐substituted proteins such as C39S, C42S, C93S, C96S, C99S, C107S, C145S, C162S, C188S, and C309S, as indicated, on MB7H9‐agar plates in the absence (−FA) and presence (+FA) of exogenously‐added 1 mM formaldehyde. The triangle above each image represents the serial dilution. (b) The plot represents the specific activity (SA) of MscR and its Cys‐substituted versions in the presence of formaldehyde. The data represent an average of at least three independent experiments with error bars denoting SD. “****,” p‐value <.0001; ns—not significant
2.4. Loss of cysteine leads to a collapse of secondary structure and negatively affects oligomerization
We next asked if cysteines are also important structurally in MscR, and probed the wildtype and the cysteine mutants using Far‐UV circular dichroism (far‐UV CD) spectroscopy. Our data show that the substitution of Cys to Ser leads to a significant loss of secondary structure in almost all the mutants except C39S and C309S, which are largely similar to wildtype, with C309S being more identical to the wildtype as compared to C39S mutant (Figure 5a,b). These observations are further confirmed by the analysis of the secondary structure content using BeStSel tool (https://bestsel.elte.hu/) (Table 1), which shows a significant loss of secondary structure in most of the Cys mutants except C39S and C309S. Our data thus suggest that the conserved cysteines are essential for MscR structural integrity.
FIGURE 5.

Effect of mutation of cysteines on the secondary structure of MscR. Both panels (a) and (b) show the far‐UV circular dichroism spectra of purified MscR protein and its Cys mutants. The plots show the molar ellipticity (ME) with respect to wavelength. The experiment was repeated multiple times; only one representative graph is shown here. The profiles are distributed between two graphs for clarity purpose, with WT present in both panels for comparison
TABLE 1.
Secondary structure content of WT and Cys mutants of MscR, calculated from their CD profiles. The values are given in percent. “Others” include random coil and turns.
| Secondary structure content (%) | |||
|---|---|---|---|
| Helix | Beta | Others | |
| WT | 36.9 | 17.6 | 45.4 |
| C39S | 22.9 | 23.7 | 53.4 |
| C42S | 17.1 | 22.1 | 60.8 |
| C93S | 16.7 | 26 | 57.3 |
| C96S | 13.3 | 28.4 | 58.3 |
| C99S | 17.4 | 27 | 55.5 |
| C107S | 16.1 | 30 | 53.9 |
| C145S | 16.9 | 25 | 58.1 |
| C162S | 17.5 | 22.5 | 60 |
| C188S | 15.4 | 28.6 | 56.1 |
| C309S | 29.9 | 22.7 | 47.4 |
Abbreviations: CD, circular dichroism; WT, wildtype.
Since Cys substitution in MscR leads to a significant loss of secondary structure, we next subjected the purified Cys‐substituted MscR to size exclusion chromatography to examine the effect of cysteine substitution on the tetrameric state of the protein. We observe that except C39S and C309S mutants, all the other Cys‐substituted proteins do not form tetramer (Figure 6a,b). Interestingly, the C145S protein elutes as a dimer (Figure 6b); C145S protein, to certain degree, is also able to rescue the phenotype in ∆mscR cells (Figure 4a) and the protein indeed shows some activity in vitro (Figure 4b). This immediately suggests that a dimeric MscR can also function as a FDH in M. smegmatis. Indeed, dimeric FDHs have also been found in various organisms. 25 Furthermore, while the C309S mutant eluted essentially identical to the wildtype protein, the C39S mutant demonstrated some amount of aggregation, which eluted in the void volume of the column (Figure 6). Thus, although being active in vivo and in vitro (Figure 4), C39S does have some altered structural profile as is also judged from the CD data (Figure 5), which likely leads to its aggregation in vitro. Taken together, we conclude that substitution of Cys with Ser at conserved positions leads to loss of both secondary and quaternary structures.
FIGURE 6.

Importance of cysteine residues in the oligomerization of MscR. Both panels (a) and (b) show the elution volume (Ve) of the wildtype (WT) MscR and its Cys variants; the profiles are distributed between two graphs for clarity purpose, with WT present in both panels for comparison. For calibration (calibrants), known molecular weight proteins (thyroglobulin, 669 kDa; ferritin, 440 kDa; aldolase, 158 kDa; conalbumin, 75 kDa; ovalbumin, 43 kDa) are used with their molecular weights marked in the graph. The experiment was repeated at least twice; only one representative image is shown here
3. DISCUSSION
Formaldehyde detoxification system is found in an array of organisms to detoxify the formaldehyde that an organism either generates by means of cellular activities or acquires from its environment. This system involves FDH, which is responsible for oxidizing formaldehyde into formate. 12 , 28 FDH is widely conserved and found amongst pathogenic and nonpathogenic mycobacteria, including M. tuberculosis and M. smegmatis. FDH is also a safeguard for the survival and growth of the bacteria under formaldehyde and NO stress. 20 , 21 Formaldehyde is a central metabolic intermediate in methylotrophic bacteria 29 and is paramount for tolerating tremendous levels of formaldehyde. 8 While overexpression of FDH not only helps the bacterium to survive formaldehyde stress, it also aids tolerance of formaldehyde in plants. 30
Here, we attempted to biophysically and biochemically characterize MscR from M. smegmatis. We show that MscR can only utilize formaldehyde as its substrate. Apart from having mycothiol‐independent alcohol dehydrogenase activity as shown previously, 27 it possesses mycothiol‐independent FDH activity in vitro. Mycothiol‐dependent FDHs such as those from C. glutamicum, Rhodococcus erythropolis, and A. methanolica are known to depend upon zinc for their activity, and contain structural and catalytic zinc binding sites. 18 , 26 , 31 We here show that MscR from M. smegmatis has enhanced catalytic activity in vitro upon addition of zinc, suggesting that dependency on zinc is a conserved feature among mycothiol‐dependent FDHs. When assessed for the quaternary structure, native MscR is found to exist as a homotetramer in solution, which is in contrast to its previously speculated trimeric form. 20 We additionally show that under in vivo condition, MscR provides protection to M. smegmatis specifically against formaldehyde‐mediated toxicity and is irresponsive to any other primary aldehydes. This concurs very well with our in vitro activity data. We, therefore, conclude that MscR is a dedicated FDH in M. smegmatis that is capable of detoxifying exogenously added formaldehyde.
Cysteines, due to their side‐chain thiol group, are involved in various molecular functions. They can entail dimerization, redox regulation, structural stability, catalytic activity, and transcriptional regulation. 12 , 22 , 23 , 24 , 32 Although the exact mechanism for cysteine‐responsive transcriptional regulation is so far unknown, conserved cysteines may play an important role in posttranslational modifications. 33 Formaldehyde‐responsive transcriptional factors such as formaldehyde activating enzyme (Fae) are found in P. denitrificans and Rhodobacter sphaeroides. 29 However, we were unable to find any such transcriptional factor in M. smegmatis. It is thus likely that cysteines may play a role in the regulation of formaldehyde detoxification pathway.
Importantly, cysteine residues in a mycothiol‐dependent enzyme are known to bind to ligand such as zinc atoms at conserved positions. 19 , 34 , 35 We observe that while substitution of significantly conserved cysteines such as C42, C93, C96, C99, and C107 show a complete loss of the enzymatic activity in vitro and in vivo, other mutants were either partially impaired or able to retain their enzymatic activity. Furthermore, we show that substituting cysteines leads to a collapse of its secondary structure in several cases, along with loss of quaternary structure (tetramerization). Interestingly, C145S mutant forms a dimer and retains some amount of activity. Indeed, glutathione‐dependent FDH from E. coli is known to form a dimer, although many others such as those from P. aeruginosa and P. putida exist as tetramer in solution. 11 , 25 , 35 Interestingly, the mycothiol‐dependent enzymes also exist in different multimeric forms similar to M. smegmatis as shown here for the WT (homotetramer) and C145S mutant (homodimer). For example, mycothiol‐dependent FDH from A. methanolica and R. erythropolis forms trimer, whereas that from C. glutamicum forms a homotetramer. 18 , 31
Our study thus provides an in‐depth biochemical and biophysical characterization of a dual function enzyme, MscR from M. smegmatis, which bears ~84% identity with the S‐nitrosomycothiol reductase from pathogenic M. tuberculosis (Figure S4). Additionally, this enzyme protects M. tuberculosis from the host mediated nitrosative stress, 21 which, therefore, makes the examination of its role during mycobacterial infections both important and interesting. We believe that our study provides insights into the structural and functional aspects of MscR, which can be developed further as a potential target for mycobacterial therapeutics.
4. MATERIALS AND METHODS
4.1. Bacterial strain, media, and growth conditions
Cloning of all the genes was carried out in E. coli strain XL1‐Blue, whereas E. coli BL21(DE3) strain was used for the recombinant protein production. Both the strains were grown in LB broth medium (Difco) at 37°C with constant shaking at 200 rpm. Wildtype M. smegmatis mc2155, mscR knockout, and mscR‐complemented (ΔmscR C ) strains 27 were grown in MB7H9 broth (Difco) supplemented with 2% glucose with 0.05% Tween 80, and with or without 1 mM formaldehyde as specified, at 37°C with constant shaking at 200 rpm. The growth was monitored by measuring the optical density of the culture at 600 nm (OD600) at specific time intervals. For the spot assay with M. smegmatis, 1.5% Bacto Agar (Difco) was added in the MB7H9 medium supplemented with 2% glucose with or without formaldehyde, acetaldehyde, or propionaldehyde to a final concentration of 1 mM as required, and incubated at 37°C. Ampicillin and kanamycin to a final concentration of 100 and 25 μg/ml, respectively, were added in the culture medium as required.
4.2. Site‐directed mutagenesis of MscR
We used the constructs pSWt7MscR and pSWhpmscR 27 for all site‐directed mutagenesis (SDM) to replace cysteine with serine in the expressed protein. While the pSWt7MscR expresses MscR protein from T7 promoter in E. coli BL21(DE3), the pSWhpmscR vector expresses MscR from hsp60 promoter in M. smegmatis. 27 The cysteine mutants were constructed by performing SDM as described previously, 36 , 37 using the templates pSWt7MscR and pSWhpmscR for their expression in E. coli and M. smegmatis, respectively, using the primers listed in Table 2. All the expressed proteins carry a C‐terminal hexa‐histidine tag. The mutation was confirmed by DNA sequencing.
TABLE 2.
List of oligonucleotides used in this study. Sequence of each oligonucleotide from 5′ to 3′ is given. The purpose of each oligonucleotide in the present study is also mentioned for easy reference.
| Oligonucleotide | Sequence (5′ to 3′) | Purpose |
|---|---|---|
| mscR_C39S | CGCGTCCGGGGTATGCCACACGGACC | Cys to Ser mutant, C39S |
| mscR_C42S | GGTATCCCACACGGACCTGACCTACC | Cys to Ser mutant, C42S |
| mscR_C93S | CGGTGTCTGGACAGTGCCGCGCCTGTAAGC | Cys to Ser mutant, C93S |
| mscR_C96S | GGACAGTCCCGCGCCTGTAAGCG | Cys to Ser mutant, C96S |
| mscR_C99S | GCCTCTAAGCGGGGGCGTCCCACC | Cys to Ser mutant, C99S |
| mscR_C107S | CCACCTATCCTTCGACACGTTCAACGC | Cys to Ser mutant, C107S |
| mscR_C145S | GGGTTCCGGCGTCATGGCCGGCATCG | Cys to Ser mutant, C145S |
| mscR_C162S | GCCAGTCCACCAAGGTCGACGCCGACG | Cys to Ser mutant, C162S |
| mscR_C188S | CGGCTCCGGCGGTGTCGGTGACGC | Cys to Ser mutant, C188S |
| mscR_C309S | CGATTCTCTGCCCGAACGCGACTTCC | Cys to Ser mutant, C309S |
| mscR_pMS_rev | TCGGTCCAACACCACCACGGAGCGCAGC | Reverse primer |
4.3. Protein expression and purification
E. coli BL21(DE3) cells were transformed with pSWt7MscR plasmid 27 and its cysteine mutants for the expression and purification of the proteins. For protein expression, cells were induced by the addition of 0.5 mM isopropyl‐d‐thiogalactopyranoside at an OD600 ~ 0.6, and the protein induction was allowed at 22°C for 12 hr. The proteins were purified as described previously 38 on Ni‐NTA column chromatography. Purified proteins were dialyzed against dialysis buffer (40 mM Tris‐Cl pH 8.0, 150 mM NaCl, and 1 mM dithiothreitol) and quantified by recording their absorbance at 280 nm. Molar extinction coefficient for MscR (28,585 M−1 cm−1) was estimated from its protein sequence using the protparam tool available at ExPASy (http://web.expasy.org/protparam/). All the proteins were assessed on a 12% SDS‐PAGE for their purity.
4.4. In vitro enzyme assay
The purified MscR was used for the activity assay. The reaction mixture comprised of 1x reaction buffer (10 mM Tris‐Cl pH 8.0 and 40 mM NaCl), 0.2 mM NAD+ and 10 mM substrate (formaldehyde, acetaldehyde, or propionaldehyde). 1 mM ZnSO4 was added in the reaction mixture when required. The reaction was initiated by adding 10 μM of purified MscR protein into the reaction mixture. The reduction of NAD+ was monitored at 340 nm using a Shimadzu UV‐1800 spectrophotometer attached with a temperature controller system to maintain the reaction temperature at 37°C. The kinetics data were plotted to obtain the slope, and specific activity of the enzyme was calculated as the amount of reduced NADH (ɛ 340 = 6,220 M−1 cm−1) in micromoles (μmol) per milligram (mg) of protein per minute (min). The activity of all the Cys mutants was recorded and plotted in a similar manner.
4.5. Estimation of formaldehyde in culture medium
The amount of formaldehyde was measured using a colorimetric method based on Hantzsch reaction by NASH reagent. 18 , 39 The assay was started by adding formaldehyde (1 mM final concentration) to M. smegmatis cultures (as given in Figure 2b) at OD600 ~ 0.1, which represented 0 hr time point. The cultures were incubated at 37°C with constant shaking. Then, 500 μl of samples at each time point were collected and centrifuged to collect the cell‐free supernatant. To this, 500 μl of NASH reagent (50 mM acetic acid, 20 mM acetylacetone, and 2 M ammonium acetate) was added and the samples were kept at 60°C for 5 min. Following incubation, 200 μl aliquot from each tube was transferred to a 96 well clear‐bottom plate (Genaxy) and the absorbance was measured at 412 nm on Spectramax multimode plate reader (Molecular Devices), and plotted.
4.6. Expression analysis by Western blotting
To assess wildtype MscR and Cys mutant protein production in M. smegmatis, bacterial cells were harvested in the log phase (OD600 of 0.8–1.0) and resuspended in buffer containing 6 M urea in 1x phosphate‐buffered saline and lysed by sonication. The lysate was centrifuged at 13,000 rpm for 10 min at room temperature. The supernatant was mixed with SDS loading dye, boiled for 5 min, and loaded on a 12% SDS polyacrylamide gel. The proteins were then transferred onto a polyvinylidene difluoride membrane (Millipore), and immunoblotting was carried out using anti‐MscR antibody raised in rabbit (Deshpande Laboratories, Bhopal, India), followed by anti‐rabbit IgG DyLight 800‐conjugated secondary antibody (Invitrogen). The blot was scanned on an Odyssey infrared imaging system (LI‐COR Biosciences, Lincoln, NE).
4.7. Secondary structure analysis by CD
Secondary structure analysis of purified MscR and its mutants was performed by subjecting it to CD spectroscopy on JASCO J‐815 spectropolarimeter. Purified proteins were dialyzed against 40 mM sodium phosphate buffer (pH 8.0), 10 mM NaCl, and 1 mM DTT. The CD spectra were recorded from 200 to 260 nm in a 1 mm pathlength quartz cuvette at 25°C. An average of three scans was taken; the data were blank‐subtracted and plotted using GraphPad Prism 6.
4.8. Size exclusion chromatography for the analysis of oligomer formation
Size exclusion chromatography of purified MscR and its Cys mutants was performed on a Superdex 200 10/300 GL column (GE Healthcare) on AKTA FPLC system (GE Healthcare). The high molecular weight calibration kit (GE Healthcare) that contained the following proteins was used: Ovalbumin (43 kDa), conalbumin (75 kDa), aldolase (158 kDa), ferritin (440 kDa), and thyroglobulin (669 kDa). These proteins were used following manufacturer’s instructions. The elution profile was monitored by running the protein mixture through the column at a flow rate of 0.5 ml/min and measuring the absorbance at 280 nm. Then, 250 μg of wildtype MscR and the mutant proteins were also subjected to the column chromatography under identical conditions.
CONFLICT OF INTEREST
The authors declare no potential conflict of interest.
AUTHOR CONTRIBUTIONS
Saloni Rajesh Wani: Conceptualization (equal); data curation (equal); formal analysis (equal); investigation (lead); methodology (lead); validation (lead); visualization (lead); writing – original draft (lead). Vikas Jain: Conceptualization (supporting); data curation (equal); funding acquisition (lead); investigation (supporting); methodology (supporting); resources (lead); supervision (lead); writing – review and editing (lead).
Supporting information
Figure S1 Growth of M. smegmatis in the presence of various aldehydes. The graphs show the growth profile of wildtype M. smegmatis, mscR knockout (ΔmscR), and the mscR‐complemented strain (ΔmscR C ) in the absence (−ALD) and presence of 1 mM each of formaldehyde (+FA), acetaldehyde (+AA), and propionaldehyde (+PA). The experiments were carried out at least three times; only one representative graph is shown.
Figure S2: Expression of proteins in ΔmscR strain. Western blotting was performed to demonstrate the expression of wildtype MscR and Cys mutants in M. smegmatis ΔmscR lysate using anti‐MscR antibody. Expression of all the Cys mutants was confirmed except for C188S, marked by an asterisk. The arrow head represent the position of the protein bands on the western blot at the desired molecular weight. Lane ‘L' represents the molecular weight marker with two bands marked (in kDa).
Figure S3: Purification of wildtype and Cys variants of MscR. SDS‐PAGE gel image shows the purification of the wildtype (WT) and Cys variants of MscR, as specified above each lane. The proteins were purified from E. coli BL21(DE3) cells using Ni‐NTA column chromatography. Lane ‘L' represents the molecular weight ladder with few bands marked (in kDa). The purified protein is marked with an arrowhead.
Figure S4: Pairwise sequence alignment of MscR from M. smegmatis and M. tuberculosis. The figure shows the pairwise sequence alignment obtained by Clustal Omega for the protein sequence of MscR from M. smegmatis (Msm) encoded by MSMEG_4340 and M. tuberculosis (Mtb) encoded by Rv2259, acquired from Mycobrowser (https://mycobrowser.epfl.ch/). “*” represents identical amino acid, whereas “:” represents conserved substitution.
ACKNOWLEDGMENTS
S. R. W. acknowledges the receipt of an INSPIRE senior research fellowship from the Department of Science and Technology (DST), Government of India. This work is supported by intramural funds from IISER Bhopal to V. J. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Wani SR, Jain V. Molecular dissection of a dedicated formaldehyde dehydrogenase from Mycobacterium smegmatis . Protein Science. 2022;31:628–638. 10.1002/pro.4258
Funding information IISER Bhopal
REFERENCES
- 1. Bolt HM. Experimental toxicology of formaldehyde. J Cancer Res Clin Oncol. 1987;113(4):305–309. 10.1007/BF00397713. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Chen NH, Couñago RM, Djoko KY, et al. A glutathione‐dependent detoxification system is required for formaldehyde resistance and optimal survival of neisseria meningitidis in biofilms. Antioxid Redox Sign. 2013;18(7):743–755. 10.1089/ars.2012.4749. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Gonzalez CF, Proudfoot M, Brown G, et al. Molecular basis of formaldehyde detoxification: Characterization of two S‐formylglutathione hydrolases from Escherichia coli, FrmB and YeiG. J Biol Chem. 2006;281(20):14514–14522. 10.1074/jbc.M600996200. [DOI] [PubMed] [Google Scholar]
- 4. Chaw YF, Crane LE, Lange P, Shapiro R. Isolation and identification of cross‐links from formaldehyde‐treated nucleic acids. Biochemistry. 1980;19(24):5525–5531. 10.1021/bi00565a010. [DOI] [PubMed] [Google Scholar]
- 5. Nosova T, Jousimies‐Somer H, Jokelainen K, Heine R, Salaspuro M. Acetaldehyde production and metabolism by human indigenous and probiotic Lactobacillus and Bifidobacterium strains. Alcohol Alcohol. 2000;35(6):561–568. 10.1093/alcalc/35.6.561. [DOI] [PubMed] [Google Scholar]
- 6. Heck HD, Casanova M, Starr TB. Formaldehyde toxicity—New understanding. Crit Rev Toxicol. 1990;20(6):397–426. 10.3109/10408449009029329. [DOI] [PubMed] [Google Scholar]
- 7. Vorholt JA. Cofactor‐dependent pathways of formaldehyde oxidation in methylotrophic bacteria. Arch Microbiol. 2002;178(4):239–249. 10.1007/s00203-002-0450-2. [DOI] [PubMed] [Google Scholar]
- 8. Chongcharoen R, Smith TJ, Flint KP, Dalton H. Adaptation and acclimatization to formaldehyde in methylotrophs capable of high‐concentration formaldehyde detoxification. Microbiology. 2005;151(8):2615–2622. 10.1099/mic.0.27912-0. [DOI] [PubMed] [Google Scholar]
- 9. Ando M, Yoshtmoto T, Ogushl S, Rikitake K, Shibata S, Tsuru D. Formaldehyde dehydrogenase from Pseudomonas putida: Purification and some properties. J Biochem. 1979;85(5):1165–1172. 10.1093/oxfordjournals.jbchem.a132440. [DOI] [PubMed] [Google Scholar]
- 10. Marx CJ, Miller JA, Chistoserdova L, Lidstrom ME. Multiple formaldehyde oxidation/detoxification pathways in Burkholderia fungorum LB400. J Bacteriol. 2004;186(7):2173–2178. 10.1128/JB.186.7.2173-2178.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Zhang W, Chen S, Liao Y, et al. Expression, purification, and characterization of formaldehyde dehydrogenase from Pseudomonas aeruginosa . Protein Expr Purif. 2013;92(2):208–213. 10.1016/j.pep.2013.09.017. [DOI] [PubMed] [Google Scholar]
- 12. Chen NH, Djoko KY, Veyrier FJ, McEwan AG. Formaldehyde stress responses in bacterial pathogens. Front Microbiol. 2016;7(MAR):1–17. 10.3389/fmicb.2016.00257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Witthoff S, Mühlroth A, Marienhagen J, Bott M. C1 metabolism in Corynebacterium glutamicum: An endogenous pathway for oxidation of methanol to carbon dioxide. Appl Environ Microbiol. 2013;79(22):6974–6983. 10.1128/AEM.02705-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Yurimoto H, Kato N, Sakai Y. Assimilation, dissimilation, and detoxification of formaldehyde, a central metabolic intermediate of methylotrophic metabolism. Chem Rec. 2005;5(6):367–375. 10.1002/tcr.20056. [DOI] [PubMed] [Google Scholar]
- 15. Herring CD, Blattner FR. Global transcriptional effects of a suppressor tRNA and the inactivation of the regulator frmR. J Bacteriol. 2004;186(20):6714–6720. 10.1128/JB.186.20.6714-6720.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Huyen NTT, Eiamphungporn W, Mäder U, et al. Genome‐wide responses to carbonyl electrophiles in Bacillus subtilis: Control of the thiol‐dependent formaldehyde dehydrogenase AdhA and cysteine proteinase YraA by the MerR‐family regulator YraB (AdhR). Mol Microbiol. 2009;71(4):876–894. 10.1111/j.1365-2958.2008.06568.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Harms N, Ras J, Reijnders WNM, Van Spanning RJM, Stouthamer AH. S‐formylglutathione hydrolase of Paracoccus denitrificans is homologous to human esterase D: A universal pathway for formaldehyde detoxification? J Bacteriol. 1996;178(21):6296–6299. 10.1128/jb.178.21.6296-6299.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Lessmeier L, Hoefener M, Wendisch VF. Formaldehyde degradation in Corynebacterium glutamicum involves acetaldehyde dehydrogenase and mycothiol‐dependent formaldehyde dehydrogenase. Microbiology (United Kingdom). 2013;159(pt 12):2651–2662. 10.1099/mic.0.072413-0. [DOI] [PubMed] [Google Scholar]
- 19. Norin A, Van Ophem PW, Piersma SR, Persson B, Duine JA, Jörnvall H. Mycothiol‐dependent formaldehyde dehydrogenase, a prokaryotic medium‐chain dehydrogenase/reductase, phylogenetically links different eukaroytic alcohol dehydrogenases—Primary structure, conformational modelling and functional correlations. Eur J Biochem. 1997;248(2):282–289. 10.1111/j.1432-1033.1997.00282.x. [DOI] [PubMed] [Google Scholar]
- 20. Vogt RN, Steenkamp DJ, Zheng R, Blanchard JS. The metabolism of nitrosothiols in the mycobacteria: Identification and characterization of S‐nitrosomycothiol reductase. Biochem J. 2003;374(3):657–665. 10.1042/BJ20030642. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Vargas D, Hageman S, Gulati M, Nobile CJ, Rawat M. S‐nitrosomycothiol reductase and mycothiol are required for survival under aldehyde stress and biofilm formation in Mycobacterium smegmatis . IUBMB Life. 2016;68(8):621–628. 10.1002/iub.1524. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Guerra D, Ballard K, Truebridge I, Vierling E. S‐nitrosation of conserved cysteines modulates activity and stability of S‐nitrosoglutathione reductase (GSNOR). Biochemistry. 2016;55(17):2452–2464. 10.1021/acs.biochem.5b01373. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Tichá T, Lochman J, Činčalová L, Luhová L, Petřivalský M. Redox regulation of plant S‐nitrosoglutathione reductase activity through post‐translational modifications of cysteine residues. Biochem Biophys Res Commun. 2017;494(1–2):27–33. 10.1016/j.bbrc.2017.10.090. [DOI] [PubMed] [Google Scholar]
- 24. Xu S, Guerra D, Lee U, Vierling E. S‐nitrosoglutathione reductases are low‐copy number, cysteine‐rich proteins in plants that control multiple developmental and defense responses in Arabidopsis. Front Plant Sci. 2013;4(NOV):1–13. 10.3389/fpls.2013.00430. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Gutheil WG, Holmquist B, Vallee BL. Purification, characterization, and partial sequence of the glutathione‐dependent formaldehyde dehydrogenase from Escherichia coli: A class III alcohol dehydrogenase. Biochemistry. 1992;31(2):475–481. 10.1021/bi00117a025. [DOI] [PubMed] [Google Scholar]
- 26. van Ophem PW, Van Beeumen J, Duine JA. NAD‐linked, factor‐dependent formaldehyde dehydrogenase or trimeric, zinc‐containing, long‐chain alcohol dehydrogenase from Amycolatopsis methanolica . Eur J Biochem. 1992;206(2):511–518. 10.1111/j.1432-1033.1992.tb16954.x. [DOI] [PubMed] [Google Scholar]
- 27. Dubey AA, Wani SR, Jain V. Methylotrophy in mycobacteria: Dissection of the methanol metabolism pathway in Mycobacterium smegmatis . J Bacteriol. 2018;200(17):1–12. 10.1128/JB.00288-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Rawat M, Av‐Gay Y. Mycothiol‐dependent proteins in actinomycetes. FEMS Microbiol Rev. 2007;31(3):278–292. 10.1111/j.1574-6976.2006.00062.x. [DOI] [PubMed] [Google Scholar]
- 29. Vorholt JA, Marx CJ, Lidstrom ME, Thauer RK. Novel formaldehyde‐activating enzyme in Methylobacterium extorquens AM1 required for growth on methanol. J Bacteriol. 2000;182(23):6645–6650. 10.1128/JB.182.23.6645-6650.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Nian H, Meng Q, Zhang W, Chen L. Overexpression of the formaldehyde dehydrogenase gene from Brevibacillus brevis to enhance formaldehyde tolerance and detoxification of tobacco. Appl Biochem Biotechnol. 2013;169(1):170–180. 10.1007/s12010-012-9957-4. [DOI] [PubMed] [Google Scholar]
- 31. Eggeling L, Sahm H. The formaldehyde dehydrogenase of Rhodococcus erythropolis, a trimeric enzyme requiring a cofactor and active with alcohols. Eur J Biochem. 1985;150(1):129–134. 10.1111/j.1432-1033.1985.tb08997.x. [DOI] [PubMed] [Google Scholar]
- 32. Qiu H, Honey DM, Kingsbury JS, et al. Impact of cysteine variants on the structure, activity, and stability of recombinant human α‐galactosidase A. Protein Sci. 2015;24(9):1401–1411. 10.1002/pro.2719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Patra SK, Bag PK, Ghosh S. Nitrosative stress response in Vibrio cholerae: Role of S‐nitrosoglutathione reductase. Appl Biochem Biotechnol. 2017;182(3):871–884. 10.1007/s12010-016-2367-2. [DOI] [PubMed] [Google Scholar]
- 34. Alterio V, Aurilia V, Romanelli A, et al. Crystal structure of an S‐formylglutathione hydrolase from Pseudoalteromonas haloplanktis TAC125. Biopolymers. 2010;93(8):669–677. 10.1002/bip.21420. [DOI] [PubMed] [Google Scholar]
- 35. Liao Y, Chen S, Wang D, et al. Structure of formaldehyde dehydrogenase from Pseudomonas aeruginosa: The binary complex with the cofactor NAD+. Acta Crystallogr Sect F Struct Biol Cryst Commun. 2013;69(Pt 9):967–972. 10.1107/S174430911302160X. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Erijman A, Dantes A, Bernheim R, Shifman JM, Peleg Y. Transfer‐PCR (TPCR): A highway for DNA cloning and protein engineering. J Struct Biol. 2011;175(2):171–177. 10.1016/j.jsb.2011.04.005. [DOI] [PubMed] [Google Scholar]
- 37. Dubey AA, Jain V. Biochemical and biophysical research communications mycofactocin is essential for the establishment of methylotrophy in Mycobacterium smegmatis . Biochem Biophys Res Commun. 2019;516(4):1073–1077. 10.1016/j.bbrc.2019.07.008. [DOI] [PubMed] [Google Scholar]
- 38. Pohane AA, Joshi H, Jain V. Molecular dissection of phage endolysin: An interdomain interaction confers host specificity in lysin a of Mycobacterium phage D29. J Biol Chem. 2014;289(17):12085–12095. 10.1074/jbc.M113.529594. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. NASH T. The colorimetric estimation of formaldehyde by means of the Hantzsch reaction. Biochem J. 1953;55(3):416–421. 10.1042/bj0550416. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1 Growth of M. smegmatis in the presence of various aldehydes. The graphs show the growth profile of wildtype M. smegmatis, mscR knockout (ΔmscR), and the mscR‐complemented strain (ΔmscR C ) in the absence (−ALD) and presence of 1 mM each of formaldehyde (+FA), acetaldehyde (+AA), and propionaldehyde (+PA). The experiments were carried out at least three times; only one representative graph is shown.
Figure S2: Expression of proteins in ΔmscR strain. Western blotting was performed to demonstrate the expression of wildtype MscR and Cys mutants in M. smegmatis ΔmscR lysate using anti‐MscR antibody. Expression of all the Cys mutants was confirmed except for C188S, marked by an asterisk. The arrow head represent the position of the protein bands on the western blot at the desired molecular weight. Lane ‘L' represents the molecular weight marker with two bands marked (in kDa).
Figure S3: Purification of wildtype and Cys variants of MscR. SDS‐PAGE gel image shows the purification of the wildtype (WT) and Cys variants of MscR, as specified above each lane. The proteins were purified from E. coli BL21(DE3) cells using Ni‐NTA column chromatography. Lane ‘L' represents the molecular weight ladder with few bands marked (in kDa). The purified protein is marked with an arrowhead.
Figure S4: Pairwise sequence alignment of MscR from M. smegmatis and M. tuberculosis. The figure shows the pairwise sequence alignment obtained by Clustal Omega for the protein sequence of MscR from M. smegmatis (Msm) encoded by MSMEG_4340 and M. tuberculosis (Mtb) encoded by Rv2259, acquired from Mycobrowser (https://mycobrowser.epfl.ch/). “*” represents identical amino acid, whereas “:” represents conserved substitution.
