Skip to main content
Ecology and Evolution logoLink to Ecology and Evolution
. 2022 Mar 7;12(3):e8638. doi: 10.1002/ece3.8638

Trust your guts? The effect of gut section on diet composition and impact of Mus musculus on islands using metabarcoding

Catarina J Pinho 1,2,3, Evandro P Lopes 1,2,3,4, Joana Paupério 1,3, Isildo Gomes 5, Maria M Romeiras 6, Raquel Vasconcelos 1,3,4,
PMCID: PMC8901889  PMID: 35309743

Abstract

  1. DNA metabarcoding is widely used to characterize the diet of species, and it becomes very relevant for biodiversity conservation, allowing the understanding of trophic chains and the impact of invasive species. The need for cost‐effective biodiversity monitoring methods fostered advances in this technique. One question that arises is which sample type provides a better diet representation.

  2. Therefore, with this study, we intended to evaluate if there were differences in diet estimates according to the section of the gastrointestinal tract analysed and which section(s) provided the best diet representation. Additionally, we intended to infer the ecological/economic impacts of an invader as a model of the potential effects in an originally mammal‐free ecosystem.

  3. We examined the gut contents of the house mouse Mus musculus introduced to Cabo Verde, considering three sections: stomach, small intestine, and large intestine. We applied a DNA‐metabarcoding approach using two genetic markers, one specific for plants and another for invertebrates.

  4. We showed that this invader consumed 131 taxa (73 plants and 58 invertebrates). We obtained significant differences in the composition of two of the three sections, with a higher incidence of invertebrates in the stomach and plants in the intestines. This may be due to stomach inhibitors acting on plants and/or to faster absorption of soft‐body invertebrates compared to the plant fibers in the intestines. We verified that the impact of this invader in the ecosystem is predominantly negative, as at least 50% of the ingested items were native, endemic, or economically important taxa, and only 19% of the diet items were exotics.

  5. Overall, results showed the need to analyse only two gastrointestinal tract sections to obtain robust diet data, increasing the cost‐effectiveness of the method. Furthermore, by uncovering the native taxa most frequently preyed on by mice, this DNA‐metabarcoding approach allowed us to evaluate efficiently which are at the highest risk.

Keywords: Cabo Verde Islands, diet, gastrointestinal tract, house mouse, invasive species, invertebrates, next‐generation sequencing, plants


In this article, we assessed the differences in diet estimates and potential ecological and economic impact measurements according to the section of the gastrointestinal tract (stomach, small and large intestine) analysed. We aimed to test which section(s) provided a better diet representation and putative impact of a common inland invader. For that, we examined the gut contents of house mice Mus musculus introduced to Cabo Verde Islands, applying a DNA‐metabarcoding approach. Our results demonstrated that with only two or the three gut sections it is possible to obtain robust diet and impact representations, and that there is a higher incidence of invertebrates in the stomach and of plants in the intestines. In addition, we were able to demonstrate efficiently and with much higher taxonomic resolution than using traditional methods that the impact of this invader is predominantly negative.

graphic file with name ECE3-12-e8638-g001.jpg

1. INTRODUCTION

Dietary studies can reveal valuable information on how species exploit the available food resources and intervene in ecological processes (Siegenthaler et al., 2019). Several methods can be implemented to characterize diet, such as direct observation, morphological identification, and stable isotopes analysis (Margalida et al., 2005; Martín et al., 2017; Symondson, 2002). However, with the recent generalization of high‐throughput sequencing methodologies, the identification of prey items was further improved (Pompanon et al., 2012). DNA‐metabarcoding, combined with the power of next‐generation sequencing (NGS) technologies (Shendure & Ji, 2008), became widely used to characterize species diets (Taberlet et al., 2012). DNA‐based methodologies allow the identification of prey material even when hard parts cannot be recovered after digestion, contrary to other methods. These provide comprehensive taxonomic identification of diet items within highly diverse diets, relying less on taxonomic expertise, and can be applied to noninvasive or degraded samples (Pompanon et al., 2012). The need for cost‐effective biodiversity monitoring methods fostered the advances of this technique, becoming highly relevant for biodiversity conservation, by allowing the understanding of trophic chains, and ultimately the ecological impact of invasive species (Westfall et al., 2020). Assessment of predation by invaders using DNA‐based approaches is rapidly growing, permitting wildlife managers to identify the most threatened taxa (Harms‐Tuohy et al., 2016; Robeson et al., 2018).

Samples used to characterize diets using DNA‐metabarcoding are generally fecal, or gut contents (Jakubavičiūtė et al., 2017; Thuo et al., 2019). Fecal samples are advantageous if applied to threatened species since they can be obtained with minimum or no impact on individual fitness (Ferreira et al., 2018). However, in comparison with faeces, DNA from gut contents is usually of superior quality and thus commonly used in diet assessments of invaders (Robeson et al., 2018; Siegenthaler et al., 2019). Yet, most studies disregard the contents of the intestines. The detectability of prey DNA in mammalian stomachs versus faeces was already explored, indicating that sample type influenced its duration but not its quality (Egeter et al., 2015). However, to our knowledge, no study explored how analyzing different gastrointestinal tract sections (stomach, large and small intestines), through DNA‐metabarcoding, influences the detectability of diet items. This is particularly important to omnivorous species that consume items with different tissue cell density, digestion rate, and DNA quality decay after digestion (Pompanon et al., 2012).

Invasive species are one of the main causes of biodiversity loss (Butchart et al., 2010), particularly on islands. On geologically young oceanic islands, typically no native terrestrial mammals occur and, in most cases, non‐volant land mammals have been anthropogenically introduced (Whittaker et al., 2017). These introductions already led to the loss of several island endemics worldwide (Doherty et al., 2016). The most widely introduced mammal species to islands are cats Felis catus L. and commensal rodents (Doherty et al., 2016). Norway rats Rattus norvegicus (Berkenhout 1769), black rats Rattus rattus L., Pacific rats Rattus exulans (Peale 1848), and house mouse Mus musculus L. were unintentional transported on boats to most islands (Jones et al., 2013), causing devastating impacts on fauna and flora. These invaders compromise the stability of native populations by competition for resources, predation, and transmission of diseases (Courchamp et al., 2003; Gaiotto et al., 2020). Furthermore, rodents are the ones causing more damage to the natural patrimony of islands (Russell et al., 2018), leading to great economic losses (Doherty et al., 2017). These omnivorous invaders can have broad impacts on health, culture, and agriculture (Russell et al., 2017). For instance, in Asia, the damage rodents cause to rice crops prevented the feeding of 200 million people (Stenseth et al., 2003). In particular, the house mouse is among the 15 species most prevalent on islands worldwide (Russell et al., 2017). In Australia, mice cause losses of up to 4% of the national agricultural production, equivalent to 40 million dollars in the worst seasons (Singleton, 1997). However, the impacts of these rodents on native and domestic species are rarely quantified, due to the lack of taxonomic knowledge of predated items and slowness in obtaining data using traditional methods of morphological identification.

In Cabo Verde, as in several other geologically young oceanic islands, no indigenous terrestrial mammals occur except for bats (Borloti et al., 2020; Hazevoet & Masseti, 2011). Therefore, all non‐volant terrestrial mammals were introduced during the past 550 years, when the first Europeans arrived in the archipelago. These invaders already caused a great impact contributing to the extinction of endemics, such as the Cabo Verde giant skink Chioninia coctei (Duméril & Bibron, 1839), and the extirpation of the giant wall gecko Tarentola gigas (Bocage, 1875) on Santa Luzia Island (Mateo et al., 2005; Medina et al., 2021). From the rodent invaders, mice are the most widely distributed occurring across all inhabited and even some uninhabited islands of the archipelago (Hazevoet & Masseti, 2011). Similar to other island ecosystems (Bunce et al., 2009), it is likely that mice have highly negative impacts on Cabo Verdean native flora and agricultural crops. This impact is expected to be higher on more vegetated islands, with higher coverage of both endemic plants and agricultural production, which is the case of Santiago and Santo Antão islands (Brilhante et al., 2021; MAA, 2021). Nevertheless, the damage caused by these invaders in Cabo Verde has never been quantified. With this study, we intend to evaluate if there are differences in diet estimates according to the section of the gastrointestinal tract analysed and which section(s) provide a better representation of the diet and the impacts of an invader using a DNA‐metabarcoding approach. For that, we examined the gut contents of the house mouse introduced to Cabo Verde, considering three sections: stomach, small intestine, and large intestine. Additionally, we aimed to provide a framework to infer the ecological/economic impact of invaders on an island ecosystem, especially in agricultural areas.

2. MATERIALS AND METHODS

2.1. Study area

The Cabo Verde Islands are located in the Atlantic Ocean, approximately 500 km off the African coast. This volcanic archipelago belongs to the biogeographical region of Macaronesia and is composed of ten main islands and several islets (Figure 1). It is politically divided into Windward and Leeward Islands. We sampled two islands of the Windward group (Santo Antão and São Vicente) and one of the Leeward group (Santiago; Figure 1) to have a wider representation of the available diversity of diet items (Arechavaleta et al., 2005).

FIGURE 1.

FIGURE 1

Map of Cabo Verde showing the geographic location of the islands and the sampled sites (yellow circles). (a) Two islands were sampled in the Windward group, Santo Antão (Paúl) and São Vicente (Mindelo). (b) One island was sampled in the Leeward group, Santiago (São Lourenço dos Órgãos). N stands for the number of sequenced samples per island

Santo Antão is the northernmost and second‐largest island of Cabo Verde (Figure 1). With a total area of 779 km², and the second‐largest agricultural area of the archipelago, corresponding to 16% of the national total (Monteiro et al., 2020), mice are expected to be abundant (Hazevoet & Masseti, 2011). The southwestern region of this mountainous island is almost completely arid, while the northeast, where we sampled, receives relatively regular rainfall and thus has more vascular plants and invertebrate endemic richness (Romeiras et al., 2015). São Vicente's total area is 227 km2 (Figure 1), and its agricultural areas correspond to only 0.3% of the whole archipelago (Monteiro et al., 2020). Its landscape is composed of stony plains, sandy dunes, and barren hills, as it is very dry with scarce vegetation (Duarte et al., 2008). However, as it harbours one of the largest human settlements of the country (Romeiras et al., 2020), mice are expected to be abundant (Groh, 1982). It is also one of the most important islands considering terrestrial endemic arthropod richness (Lobo & Borges, 2010). Santiago, with 991 km2 of total area, is the largest island (Figure 1) and the most important agricultural center of the archipelago (Monteiro et al., 2020). Mice were previously reported on this island in the mountains around São Jorge dos Órgãos and São Domingos (Rabaça & Mendes, 1997). The landscape of Santiago is mostly characterized by steep, tall mountains, although the southeast area is flatter (Neto et al., 2020). Encompassing a wide range of habitats, this island presents the highest number of species and endemism of the archipelago (Duarte et al., 2008; Lobo & Borges, 2010).

2.2. Sampling

Sampling took place between the 11th and 27th of November 2019 in the municipalities of Paúl, on Santo Antão, Mindelo, on São Vicente, and São Lourenço dos Órgãos, on Santiago (Figure 1). We placed 40–70 Sherman traps per site in cultivation fields, depending on its size and crop diversity, in groups of 10, distanced by approximately 5 m. We baited each trap with oats, tuna and peanut butter to attract Mus musculus individuals. We euthanized the captured mice by cervical dislocation and dissected them for the collection of the gastrointestinal tracts with digestive contents for further genetic analysis. We deposited all animals in the collections of the Technical University of the Atlantic, São Vicente, the future Natural History Museum of Cabo Verde.

2.3. DNA extraction and sequencing

We divided the digestive tracts into three sections (stomach—S, small intestine—SI, and large intestine—LI). We performed the DNA extraction of the digestive contents of 30 individuals per island, in a total of 90 specimens, for each section separately, including blanks, using the Stool DNA Isolation Kit (Norgen Biotek Corp., Canada), following the manufacturer's instructions.

We amplified the DNA of the three sections with two genetic markers already validated in previous studies (Pinho et al., 2018). For invertebrates we used a modified version of the IN16STK‐1F/IN16STK‐1R primers, targeting the mitochondrial 16S rRNA (Kartzinel & Pringle, 2015; Pinho et al., 2018), and for plants, we used the g/h primers targeting the short P6‐loop of chloroplast trnL (UAA) (Taberlet et al., 2007). We performed all PCRs, including blanks, as described in Pinho et al. (2018). Then, we prepared libraries following the Illumina MiSeq protocol “16S Metagenomic Sequencing Library Preparation” (https://support.illumina.com). Finally, we sequenced the samples in the MiSeq sequencer (Illumina) using the MiSeq Reagent Kit V2 (Illumina, San Diego, CA, USA) for an expected average of 17,000 paired‐end reads per sample.

We processed the obtained DNA sequences at the bioinformatics level using tools incorporated in the software package OBITtools (http://metabarcoding.org/obitools), which include the alignment of the sequences obtained and the filtering of sequencing errors, to obtain the molecular operational taxonomic units, MOTUs (Pinho et al., 2018). In the final dataset, we removed all the samples with less than 500 reads and within kept samples, we also excluded haplotypes representing less than 1% of the total number of reads of that sample (Mata et al., 2016). Finally, to taxonomically identify the MOTUs present in the mice diet, we compared the obtained haplotypes with our reference database and with those available in the GenBank database (https://www.ncbi.nlm.nih.gov/genbank/). We classified sequences that had less than 90% of similarity with known species only to the class level, the ones with values between 90% to 95% to the family level, and the remaining sequences with similarity values above 95% to the genus or species level. We considered only species or genera known to occur on our sampled sites, or the surrounding islands of the archipelago. When a haplotype matched more than one species or genus, then a higher ranking would be attributed (e.g., family). If more than one haplotype corresponds to the same taxon, we attributed a number to each. We removed the haplotypes identified as contaminations (e.g., mice, bait, or human DNA).

2.4. Data analysis

We estimated the frequencies of occurrence (FO) of plants and invertebrates in samples for the three sections. Using R software version 4.0.2, we performed a permutational multivariate analysis of variance (PERMANOVA) using the vegan package (ADONIS function) to compare the composition of the contents of all sections (https://CRAN.R‐project.org/package=vegan). For the same purpose, we performed a pairwise multilevel comparison (parwise.adonis function). We also carried out a homogeneity of dispersion test (PERMDISP) to ensure the importance of the PERMANOVA test, as it presumes an equal dispersion of values among groups. Additionally, we performed a similarity percentage analysis, using the vegan package (simper function), to infer the contribution of each prey to the differentiation among sections.

Lastly, we classified the impact of mice on the taxonomically identified diet items into three categories: negative, positive, or non‐identified. We consider it as negative if the items were native or endemic plants/invertebrates, plants of economic importance (e.g., for human or domestic animals' consumption), or invertebrates with essential ecological functions, such as pollinators. We considered it as a putative positive if the items were exotic plants/invertebrates and as non‐identified if the items were identified with a low taxonomic resolution or if the impact could not be classified. We compared the FO differences of each category between prey groups (plants vs. invertebrates), gastrointestinal sections (stomach vs. intestines) and islands using chi‐square tests.

3. RESULTS

After data filtering, we obtained 20,000 reads per sample on average. We were able to identify 131 diet items of eight taxonomic classes in the 90 mice from the three islands, 73 of which corresponded to plants and 58 to invertebrates (Table A1). Plants were distributed among three classes, 20 orders, and 30 families, with Poaceae and Fabaceae as most frequent overall. We identified invertebrates from five classes, 15 orders, and 31 families, with Apidae and Aphididae as the most frequent families. Both plant and invertebrate items were present in similar frequencies in the overall diet (63% and 72%, respectively). Several taxa were present exclusively in one section, in total 54% of plants items were only in the intestines (e.g., Arecales and Apiales orders), and 65% of invertebrate items were only in the stomach (e.g., Araneae and Mesostigmata orders). Fifty MOTUs had FOs below 1% and were only present in one sample.

Regarding the gastrointestinal track sections analysed, we obtained significant differences in the diet composition of the stomach in comparison to the two intestinal sections (S vs. SI: F = 3.46, p = .003; S vs. LI: F = 7.68, p = .003; SI vs. LI: F = 1.65, p = .120) and no effect of data dispersion on the results. Frequencies of plants and invertebrates were similar in the small and large intestines (Figure 2), yet both sections' estimates were significantly different from the stomach ones (plants – S vs. SI: p = .001; S vs. LI: p = .001; SI vs. LI: p = 1.000; invertebrates – S vs. SI: p = .008; S vs. LI: p = .001; SI vs. LI: p = .062). These differences were observed at the MOTU, family, and order levels. Additionally, we observed a higher frequency and diversity of invertebrates in the stomach and of plants in the intestines (Figure 2).

FIGURE 2.

FIGURE 2

Metabarcoding results per gastrointestinal section. Frequencies of occurrence of plants (in green) and invertebrates (in yellow) in the Mus musculus stomach and intestines (small and large) samples

The similarity percentage analysis revealed that six MOTUs, five families, and seven orders contributed significantly to differences between sections (Figure 3; Table A1). The MOTUs that contributed significantly to the differences between sections were all invertebrates. In particular, Apis mellifera Linnaeus, 1758 and Aphis gossypii Glover, 1877 had a high contribution and were also the most frequent preys overall. The bee and aphid species were present in 66% and 26% of the stomachs, respectively, whereas in the intestines the FOs were only 31% and 8%, respectively. Other three introduced plant species, Mentzelia aspera L., Desmanthus virgatus (L.) Wild., and Carica papaya L. had differences in the FO between sections greater than 10%, all presenting higher frequency in the intestines (Figure 3).

FIGURE 3.

FIGURE 3

Results of the similarity percentage analysis. Frequency of occurrence of 30 Molecular Operational Taxonomic Units (MOTUs) with the highest contribution to differences between the stomach and intestine of Mus musculus. Plant MOTUs are represented in green and invertebrates in yellow. Magnitude of significance levels shown with asterisks: ***p < .001; **p < .01; *p < .05

Regarding the impact of this rodent, we identified with a high taxonomic resolution 79 items (27 invertebrates and 52 plants), although the reference collection of DNA sequences for Cabo Verde, mostly for invertebrates, is still incomplete. Therefore, we verified that the impact of this invader in the ecosystem is predominantly negative, as at least 49/50% (unbalanced/balanced per FO, respectively) of the ingested items were native, endemic, or economically important taxa, and only 12/19% (unbalanced/balanced per FO, respectively) of the items were exotics (Table A1). The impact pattern was similar across the three sampled islands (χ 2 = 1.87, p = .761; Figure A1) and gut sections (χ 2 = 0.66, p = .719). Impact patterns were significantly different between invertebrates and plants (χ 2 = 8.95, p = .011), with a higher negative impact on plants. The economically important plants included corn Zea mays L., banana Musa sp., cabbage Brassica oleracea L., radish Raphanus raphanistrum subsp. sativus (L.) Domin., breadfruit Artocarpus altilis (Parkinson ex F.A. Zorn) Fosberg, mango Mangifera indica L., papaya Carica papaya L., and plants of the genus Solanum that includes potatoes, tomatoes, and eggplant, among other vegetables (Table A1). Mice also consumed native and endemic invertebrate species including spiders (e.g., Pardosa aquatilis Schmidt & Krause 1995), ants (e.g., Monomorium subopacum (Smith 1858)) and European honeybees Apis mellifera. The data show that they also consumed invasive plants, such as Lantana camara L. and Mexican fireplant Euphorbia heterophylla L., along with invertebrate pests, such as cockroaches (e.g., Blattella germanica (Linnaeus 1767) and Periplaneta americana (Linnaeus 1758)) and the cotton aphid Aphis gossypii Glover 1877.

4. DISCUSSION

To our knowledge, this is the first study to explore diet estimate differences along the gastrointestinal tract using DNA‐metabarcoding techniques. In this work, we present the first DNA‐based data on the diet and impact of Mus musculus, using Cabo Verde as a model. Our results show that the house mouse consumed a wide range of prey items in the sampled islands, as the FOs of most items were low. This confirms the generalist diet and opportunistic feeding behavior of this species as observed in other islands (Angel et al., 2009; Le Roux et al., 2002). We were able to observe that the frequency of plants and invertebrates were similar overall; however, plants had a slightly higher incidence. This was expected since we actively sampled individuals in crop areas. Nevertheless, studies that investigated the seasonal variation of the diet of M. musculus in other islands showed a similar pattern (Copson, 1986; Le Roux et al., 2002).

The analyses of different sections of the gastrointestinal tract provided different views of the house mouse diet. Although no significant differences were detected between the two sections of the intestines, disparities between the stomach and the intestines were evident. We observed a higher frequency and diversity of invertebrates in the stomach and plants in the intestines. This may be primarily due to differences in the cellular structures between plants and animals, particularly in the cell walls and fibrous tissues. Plant items have very thick cell walls arranged in complex networks predominantly composed of cellulose, hemicellulose, and pectic polysaccharides (Jarvis, 2011; McDougall et al., 1996). This composition makes plant items harder to break down and consequently more resistant to enzymes of the gastrointestinal tract (Holland et al., 2020). This leads to harder digestion of plants, in comparison with animal items, and subsequently slower absorption along the gastrointestinal tract (Tomé, 2013). Since mice consume raw plants, the DNA is protected by the cell wall and remains poorly detected in the stomach. The subsequent gastrointestinal compartments take a much important part in their digestion (Rizzi et al., 2012; Tomé, 2013; Wilcks et al., 2004). Previous studies showed that plant tissues were most effectively digested in the small intestine of rodents, due to the action of pancreatic enzymes (Wilcks et al., 2004). As shown in our results, one is more likely to detect DNA from plants in the intestines rather than the stomach. Moreover, depending on the type, section, and maturation of the plant, the fiber concentration will vary, leading to distinct digestibility rates (Albrecht et al., 1987; Buxton et al., 1995). For instance, grasses usually present more fiber than legumes, especially in the leaves, making them harder to digest and to be absorbed in the gut (Buxton & Redfearn, 1997). In our study, Poaceae was the most frequent plant family and one of the families that contributed to the differences between stomach and intestines. This is probably due to its higher fiber concentration which presumably allowed Poaceae plants to persist longer time in the gastrointestinal tract, therefore having a higher incidence in the intestines. Moreover, when we extracted plant DNA of the intestines, we were also extracting DNA of the faeces within it. Since the DNA detectability half‐life is twice as high in faeces compared to stomachs (Egeter et al., 2015), the faeces content in the intestines will also contribute to a higher DNA detectability of plants in that section.

Comparatively, animal DNA will be already further degraded when it reaches the lower sections of the gastrointestinal tract (Tomé, 2013), compromising its detectability. This was probably the reason why we were able to detect higher frequencies of invertebrates in the stomach than in the intestines. Additionally, the most frequent invertebrates consumed by mice, and the ones that contributed the most to differences between sections, seem to be soft‐bodied (e.g., Apis mellifera and Aphis gossypii). These items are probably more easily digested and are already mostly absorbed when they reach the intestines, leading to a lower detection of its DNA in the lower parts of the gastrointestinal tract. Even though metabarcoding has the extraordinary capacity to detect small, soft, and invisible items (Pompanon et al., 2012), based on our results, the detection of these preys will probably be more efficient in stomach contents rather than in the intestines. Therefore, we advise studies targeting the detection of soft‐bodied invertebrate preys to use preferentially stomach samples and those targeting plant or harder invertebrate items to use preferentially intestine samples. On the other hand, extraction methods can be adjusted to account for lower digestion of prey. For instance, if only the stomach is available, we advise using specific extraction and amplification methods targeting plants.

In this work, we verified that the general environmental impact of mice in Cabo Verde is predominantly negative similarly to other island ecosystems (Angel et al., 2009). Studies using traditional methods of stomach content analysis on Southern Ocean islands, as the Guillou and Macquarie Islands, similarly showed that mice consume a wide range of native taxa (Copson, 1986; Le Roux et al., 2002). We showed that this invader consumes several plants with human and economic importance. Corn production is one of the most important crops in Cabo Verde, with around 6,000 tons per year (MAA, 2021). We observed that 10% of the individuals ingested corn, which coupled with high population densities could imply significant losses in production, considering that 1 ton of corn is equivalent to 108.100 Cabo Verdean escudos, or 1.190 dollars (I. Gomes pers. comm.). Also summing the losses in other crops, this invader poses a major threat to the national economy of this archipelago. Similarly, in Tanzania and Australia, mice can cause losses of up to 15% of the national agricultural production, equivalent to 40–45 million dollars of losses in the worst seasons (Singleton, 1997). In our results, we were also able to detect that this invader feeds on at least nine native plant species, as Eleusine indica (L.) Gaertn and Sida acuta Burm. fil. (Table A1). Metabarcoding does not allow us to identify the section of the plant that is consumed; however, this invader can be a great threat for the native flora if it is consuming seeds. In Marion Island, in the sub‐Antarctic Indian Ocean, mice almost extirpated the native sedge Uncinia compacta R. Br. due to seed predation (Smith & Steenkamp, 1990). The impact on invertebrates is also considerable since these rodents consume several native and endemic species, most of them with vital ecological functions. This is the case of the European bee, a species in decline worldwide, that plays an active role in the pollination of several plants, including crops such as cabbage and beans (Themudo et al., 2020). In Antipodes Island, located south of New Zealand, mice were considered accountable for the local extirpation of several invertebrate species (Marris, 2000). Likewise, on Marion Island, they are responsible for the absence of the flightless moth Pringleophaga kerguelensis Enderlein 1905 (Vári, 1971).

Mice can also present a putative positive impact by consuming some introduced and invasive herbaceous, as is the case in Cabo Verde, for example, Lantana camara and Euphorbia heterophylla, two of the main invasive plants in several natural and agricultural tropical regions (Romeiras et al., 2016). The latter is resistant to some herbicides, thus it needs to be manually removed before farming (Wilson, 1981). Mice can also play a role in domestic pest control, such as cockroaches (e.g., Blattella germanica and Periplaneta americana) and the cotton aphid Aphis gossypii, even though some may be resultant of secondary consumption of host plants (Mata et al., 2016). The latter is an important agricultural pest since it can have several hosts and transmit several viruses important to crops ( Dedryver et al., 2010). Several crops grown in Cabo Verde can be hosts for this aphid, such as papaya, cashew, breadfruit, and banana, among others (Dedryver et al., 2010).

Optimized measures are needed to control, monitor and eradicate invasive rodents (Stenseth et al., 2003). These measures imply great expenses with equipment and human resources; therefore they must be carried out accurately to avoid resource waste (Mwebaze et al., 2010). The results of Stenseth et al. (2003) suggest that government‐level funding for rodent pest control should be devoted to research instead, especially in developing countries. These authors go even further, stating that not doing so can cost dearly in terms of lost income and food supplies for people. Consequently, additional research is crucial to infer the relative importance of the impacts of this rodent in the Cabo Verdean agriculture and economy, and if eradication is the best solution. If so, there is a need to deliberate on potential surrogates for the positive role of mice. For instance, in this study, we did not consider the impact that this rodent can have on vertebrates. However, we know that in Cabo Verde, mammal invaders already contributed to the extinction of endemic species (Mateo et al., 2005; Medina et al., 2021), therefore, it is important in the future to access the impact that M. musculus has on seabirds and terrestrial and marine reptiles. Further studies on other islands, particularly in Seychelles, show that the prevention, eradication, and control of rodents would very positively affect government revenues even after discounting the costs of such actions (Mwebaze et al., 2010). An eradication plan of invasive mammals is already taking place in Cabo Verde on Santa Luzia Island (Alho et al., 2022). This is a particularly promising plan due to the reduced area of the island since in another small island of the Macaronesian region mice were already successfully eradicated (Olivera et al., 2010). On populated islands with a strong agriculture presence, as is the case of this study, the likelihood of eradication failure can be high (Holmes et al., 2015); however, these islands could highly benefit from a rodent control program to reduce the impact of mice on agriculture.

In conclusion, our results showed the need to analyse only two gastrointestinal tract sections (stomach and large intestine) to obtain robust diet representations, increasing the cost‐effectiveness of DNA‐metabarcoding approaches. In general, the use of this DNA‐based approach enabled the identification of a wide variety of mice diet items in a much faster and simplified way compared to other traditional approaches, as shown in previous studies (Gil et al., 2020). Additionally, by uncovering which native prey species are most frequently predated by this invader, this approach allowed to evaluate efficiently which ones are at the highest risk. Thus, our framework can be an asset for studies on the impact of invasive species on other islands or threatened areas.

CONFLICT OF INTEREST

The authors declare that they have no competing interests.

AUTHOR CONTRIBUTIONS

Catarina J. Pinho: Formal analysis (lead); Investigation (equal); Visualization (lead); Writing – original draft (lead); Writing – review & editing (equal). Evandro P. Lopes: Funding acquisition (supporting); Investigation (supporting); Resources (supporting); Writing – review & editing (equal). Joana Paupério: Conceptualization (supporting); Formal analysis (supporting); Funding acquisition (supporting); Methodology (equal); Resources (supporting); Validation (equal); Writing – review & editing (equal). Isildo Gomes: Funding acquisition (supporting); Investigation (supporting); Resources (supporting); Writing – review & editing (equal). Maria M. Romeiras: Data curation (supporting); Funding acquisition (supporting); Methodology (supporting); Resources (supporting); Writing – review & editing (equal). Raquel Vasconcelos: Conceptualization (lead); Data curation (lead); Formal analysis (supporting); Funding acquisition (lead); Investigation (equal); Methodology (equal); Project administration (lead); Supervision (lead); Writing – original draft (equal); Writing – review & editing (equal).

ACKNOWLEDGMENTS

This research was funded by “Gabinete de Ensino Superior, Ciência e Tecnologia do Ministério da Educação, Governo de Cabo Verde” (to RV) and partially by the project NORTE‐01‐0145‐FEDER‐000046, supported by Norte Portugal Regional Operational Programme (NORTE2020), under the Portugal 2020 Partnership Agreement, through the European Regional Development Fund (ERDF). The Open Access was funded by the “Fundação para a Ciência e a Tecnologia, I.P” (FCT) and Aga Khan Development Network (AKDN) under the project CVAgrobiodiversity/333111699 (to MMR), by the project LEAF: Linking Landscape, Environment, Agriculture and Food Research Centre (UIDB/04129/2020). CJP (SFRH/BD/145851/2019) was supported by a PhD grant funded by FCT, financed by the European Social Fund and the Human Potential Operational Programme, POPH/FSE. RV was also funded by Portuguese funds through FCT, under the “Norma Transitória” (DL57/2016/CP1440/CT0002) and JP was supported by the European Union’s Horizon 2020 Research and Innovation program under grant agreement Nº 668981. EPL was supported by ICETA 2016‐31 research grant. We give thanks to the “Escola Superior de Ciências Agrárias” of the University of Cabo Verde (UniCV) and the farm owners Sr. Mundinho, Nadi Delgado, and Jorge Duarte, to Melanie de Pina, Humberto Elísio, Albertino Santos (aka General), Nilton Fortes (aka Nando), Armiliano Lima, and especially to Jorge Tavares and Lara Almeida for their help in fieldwork. We give thanks to Mariana Araújo for the proofreading of the manuscript. This is an output of the Portuguese‐Cabo Verde TwinLab, established between CIBIO/InBIO and UniCV.

APPENDIX A.

TABLE A1.

Taxonomic identifications, haplotype sequences, and frequency of occurrence (FO) of the MOTUs present in the diet of Mus musculus

Phyllum Class Order Family Final_ID DNA sequences ST SI LI Total Impact
Tracheophyta Liliopsida Arecales Arecaceae Arecaceae_1 atctttattttgagaaaacaagggtttataaaactagaataaaaaaag 0.000 0.004 0.004 0.009
Commelinales Commelinaceae Commelina benghalensis atccttaagatttttaaaactagaaaaaagg 0.000 0.000 0.004 0.004 +
Poales Poaceae Aristida adscensionis atctcttttttgaaaaacatgtggttctaaaactagaacccaaaggaaaag 0.000 0.000 0.004 0.004
Brachypodium sylvaticum atccgtgttttgagaaaacaaggaggttctcgaactaaaatacaaaggaaaag 0.000 0.000 0.004 0.004 +
Cenchrus ciliaris atcccttttttgaaaaacaagtggttctaaaactagaacccaaaggaaaag 0.000 0.004 0.000 0.004
Chloris_1 atccctgttttgaaaaacaagtggttctcaaactagaacccaaaggaaaag 0.000 0.000 0.009 0.009
Cynodon dactylon atcccttttttgaaaaacaagtggttctcaaaccagaacccaaaggaaaag 0.004 0.000 0.004 0.009 +
Dactylis smithii atccgtgttttgagaaaacaaagaaaggggttctcgaactagaatacaaaggaaaag 0.000 0.004 0.004 0.009
Eleusine indica atccctttttttcattttaaaaacaagtggttctcaaactagaacccaaaggaaaag 0.004 0.000 0.009 0.013
Hordeum vulgare atccgtgttttgagagggggattctcgaactagaatacaaaggaaaag 0.009 0.000 0.000 0.009
Oryza sativa atccatgttttgagaaaacaagcggttctcgaactagaacccaaaggaaaag 0.004 0.000 0.000 0.004
Poaceae_3 atccctttttttaaaaacaagtggttctcaaactggaacccaaaggaaaag 0.000 0.004 0.000 0.004 ?
Poaceae_6 atccgtgttttgagaggggggttctcaaactagaatacaaaggaaaag 0.000 0.000 0.004 0.004 ?
Poaceae_7 atccgtgttttgagaaaacaaggggttctcgaactagaatacaaaggaaaag 0.031 0.022 0.000 0.054 ?
Saccharum_1 atccccttttttgaaaaaacaagtggttctcaaactagaacccaaaggaaaag 0.000 0.000 0.009 0.009
Setaria_1 atcccttttttgaaaaaacaagtggttctcaaactagaacccaaaggaaaag 0.054 0.045 0.045 0.143 ?
Urochloa_1 atccctcttttgaaaaaacaagtggttctcaaactagaacccaaaggaaaag 0.036 0.022 0.045 0.103
Zea mays atcccttttttgaaaaacaagtggttctcaaactagaacccaaaggaaaag 0.009 0.022 0.004 0.036
Zingiberales Musaceae Musa sp. atccttattttgagaaaacaaaggtttataaaactagaatttaaaag 0.009 0.018 0.049 0.076
Magnoliopsida Apiales Apiaceae Apiaceae_1 atcctattttccaaaaacaaacaaaggcccagaaggtgaaaaaag 0.000 0.009 0.000 0.009
Araliaceae Araliaceae_1 atcctgttttccgaaaacaaacaaaggttcagaaggcgaaaaaagg 0.000 0.000 0.004 0.004 ?
Asterales Asteraceae Asteraceae_1 atcacgttttccgaaaacaaacaaaggttcagaaagcgaaaataaaaaaag 0.004 0.000 0.009 0.013
Asteraceae_2 atcacgttttccgaaaacaaataaaggttcagaaagcgaaaataaaaaag 0.000 0.000 0.013 0.013 ?
Asteraceae_3 atcacgttttccgaaaacaaacaacggttcagaaagcgaaaatcaaaaag 0.000 0.004 0.004 0.009 ?
Boraginales Heliotropiaceae Heliotropium_1 atcctgttttccgaaaacaaagaaaggttcagaaagcaaaaaaag 0.000 0.009 0.000 0.009
Brassicales Brassicaceae Brassica oleracea atcctgggttacgcgaacaaaacagagtttagaaagcga 0.004 0.000 0.000 0.004
Raphanus raphanistrum subsp. sativus atcctgagttacgcgaacaaaccagagtttagaaagcgg 0.000 0.004 0.000 0.004
Caricaceae Carica papaya atcctgttttacgagaacaaacaaaacaagagttcagaaagcgaaaaaagggg 0.000 0.004 0.000 0.004
Cleomaceae Cleomaceae_1 atcctggtttccgcgaacaaacaagagtttagaaagcgagaaaaaagg 0.004 0.000 0.000 0.004 ?
Cleome_1 atcctggtttacgcgaacaaacaagagtttagaaagcgagaaaaaagg 0.031 0.027 0.031 0.089 +
Caryophyllales NI Caryophyllales_1 ctcctttttcaaatcaaaagaaaaaaaaaataaagattcataaagcaagaaaaaag 0.009 0.000 0.004 0.013 ?
Aizoaceae Trianthema portulacastrum ctcctttttttttcaaaagcaaaaaacaaaaaataaggattcagaaagcaagaaaaag 0.004 0.004 0.004 0.013 +
Zaleya pentandra ctcctttttttcaaaagcaaaaaaataaggattcagaaagcaagaaaaaag 0.004 0.004 0.004 0.013
Amaranthaceae Amaranthus_1 ctcctttttcaaaagtaaaaaaaaaaaatacggattcagaaagcaagaataaaaaaaag 0.004 0.000 0.000 0.004
Chenopodium murale ctccttttgtcaaaagcaaaaaatactcaaaagaaaaaaataataaaaaagcaagaaaaaaaaag 0.000 0.004 0.009 0.013 +
Cornales Loasaceae Mentzelia aspera atcctgttttccgaaaacaaacaaaggttcagaaagcgaaaataaaaaaag 0.009 0.040 0.045 0.094 +
Fabales Fabaceae Clitoria ternatea atcctcttttccaaaattttccaaaaacaaaaaacttaagaaagtgaaaaaagag 0.009 0.022 0.009 0.040
Desmanthus virgatus atcctgttttccgaaaaccaagaagagttcagaaagggagaatcaaaataaaaaaa 0.000 0.000 0.004 0.004
Desmodium_1 atccttttttccgtaaacgaagaaaagttcagaaaagaaaggtataatcaaaaaaaag 0.000 0.000 0.004 0.004
Fabaceae_1 atcctgttttccgaaaacaaagaacaaagaaaaagaagagtttagaaagcgagaataaaaaatcaaag 0.000 0.000 0.004 0.004 ?
Lens culinaris atccttctttccgaaaacaaatcaaagttcagaaagtgaaaatcaaaaaag 0.004 0.000 0.000 0.004
Leucaena leucocephala atcctgttttccgaaaagcaagaagagttcagaaagggagaatcaaaataaaaaaag 0.004 0.004 0.009 0.018
Lotus_1 atcctgctttacgaaaacaagggaaagttcagttaagaaagcgacgagaaaaaagg 0.000 0.000 0.004 0.004
Prosopis juliflora atcctgttttcggaaaaccaagaagagttcagaaagggagaataaaaaaag 0.000 0.000 0.004 0.004 ?
Vigna_1 atcctgttttctgaaaacaaagaaaaattcagaaagttataataaaaaagg 0.000 0.000 0.009 0.009
Gentianales Apocynaceae Catharanthus roseus atccagttttccacaaacacaaacaaaggttcagaaaacgaaaaagg 0.004 0.000 0.000 0.004
Lamiales Acanthaceae Acanthaceae_1 atcctcttttcgcaagacaaaggttcagaaaacgaaaaagg 0.000 0.000 0.009 0.009 ?
Lamiaceae Lamiaceae_1 atcctgttttctcaaaacaaaggttcaaaaaacgaaaaaagg 0.000 0.009 0.004 0.013 ?
Lamiaceae_2 atcctgttttctcaaaacaaaggtttaaaaaacgaaaaaaaaaaag 0.000 0.000 0.004 0.004 ?
Verbenaceae Lantana camara atcccgttttctcaaaacaaaggttcagaaaacgccaaaggcg 0.000 0.009 0.000 0.009 +
Malpighiales Euphorbiaceae Acalypha_1 atcctgttttccgaaaacaaaaaaaggttcataaagacagaataaaaaagg 0.000 0.004 0.000 0.004 +
Euphorbia heterophylla atcctgttttccgaaaacaaaaaaagtttcataaagacagaaaaaaaaaaaaaaaaagaag 0.013 0.000 0.013 0.027 +
Euphorbia_3 atcctgttttccgaaaacagaaaaagaaaagtttcataaaaacagaaaaaaacaaggaag 0.000 0.004 0.000 0.004 ?
Passifloraceae Passiflora_1 atcctgtttttcgaaaacaaaaaaacaacaaaggttcataaagacagaatcagaataaataaag 0.000 0.000 0.004 0.004 ?
Malvales Malvaceae Abutilon_1 atcctattattttacgaaaataaacataaacaaaggttcagcaagcgaaaataataaaaaaggaaag 0.000 0.000 0.004 0.004 ?
Grewia villosa atcctattattttacgaaaataaacataaacaaaggttcagcaagcgagaataaaataaaataataaaaaaag 0.004 0.000 0.000 0.004
Malvaceae_1 atcctattattttacgaaaataaacataaacaaaggttcagcaagcgagaataataaaaaaggaaag 0.013 0.022 0.063 0.098 ?
Sida acuta atcctattattttacgaaaataaacagaaacaaaggtttagcaagcgagaataataataaaaaaggaaag 0.000 0.000 0.004 0.004
Myrtales Myrtaceae Psidium guajava atcctgttttacgaaaaccaacaaaacaataagggttcataaagcgagaataaaaaaaggatag 0.000 0.000 0.004 0.004
Rosales Moraceae Artocarpus altilis atccggttttctgaacccttgtttgttttcagaaagcgataataaaaaag 0.004 0.004 0.009 0.018
Ficus_1 atccggttttctgaaaacaaacaagggttcagaaggcgataataaaaaag 0.000 0.000 0.004 0.004
Morus_1 atccggttttctgaaaacaaacaagggttcagaaagcgataatacaaaag 0.000 0.000 0.004 0.004 ?
Rosaceae Eriobotrya japonica atcctgttttatgaaaataaacaagggtttcataaaccgaaaataaaaaag 0.000 0.000 0.004 0.004
Sapindales Anacardiaceae Anacardium occidentale atcctattttacgagaacaaaaacaaacagggggtcagaacgggagaaaaaaaag 0.004 0.009 0.018 0.031
Mangifera indica atcctattttacgagaacaaaaacaaacaaggggtcagaacgggaaaaaaaaag 0.000 0.004 0.000 0.004
Rutaceae Citrus_1 atcctcttctcttttccaagaacaaacaggggttcagaaagcgaaaaagggg 0.000 0.004 0.000 0.004
Solanales Convolvulaceae Ipomoea_1 atcctgttttccgaaaacaaacaaaagttcagaaaaaaag 0.004 0.004 0.013 0.022
Ipomoea_2 atcctgttttccgaaaacaaacaaaggttcagaaaaaaag 0.000 0.000 0.004 0.004
Solanaceae Physalis_1 atcctgttttctgaaaacaaacaaaggttcagaaaaaaag 0.000 0.013 0.022 0.036
Sclerophylax spinescens atcctgttttctgaaaacaaacaaaggttcagcaaaaaag 0.004 0.004 0.013 0.022 +
Solanum_1 atcctgttttctcaaaacaaacaaaggttcagaaaaaaag 0.000 0.000 0.009 0.009
Pinopsida Pinales Cupressaceae Cupressus sempervirens atccgatttctagaaacaataggttcctttccgagaacgg 0.000 0.000 0.004 0.004 ?
Arthropoda Arachnida Araneae* Araneidae Neoscona_1 tgatttaaaggtcgaacagacctacttttaaaattgttgcatctataaagttacattaattcaacatcgaggtcgcaatcatttttttaaataagaactttagaaaaata 0.004 0.000 0.000 0.004
Gnaphosidae Gnaphosidae_1 atttttataagtcgaacagactttatatattcaatcttgcttgaataggataattaattcaacatcgaggtcgtaaacatttatttttattaggactttaaattaata 0.004 0.000 0.000 0.004
Lycosidae Pardosa aquatilis ttttttaaaagtcgaacagacttcctttattaactattgcgtaaattaggaaaaattaaatcaacatcgaggtcgcaatctttattttaaataagatcttataaattata 0.004 0.000 0.000 0.004
Theridiidae Theridion_1 tatattaaaggtcgaacagacctacttatataactactgcgttattatagaataataattcaacatcgaggtcataaacattatttttaataagagctttaaaataata 0.004 0.000 0.000 0.004
Mesostigmata* Macronyssidae Ornithonyssus bacoti tgatttaaaagatgaacaatctttcttatatagtctctccaccatatagacacattaattcaacatcgaggtcgcaaactactatatcaatatgaactctccatagtaa 0.004 0.000 0.000 0.004 ?
Phytoseiidae Euseius ovalis caatttaaaagatgaacaatctcccttagtaattctctacaacaactaggtgtgtcaaattcaacatcgaagtcgcaaactactataccaatatgaactctccatagtaa 0.004 0.000 0.000 0.004 ?
Phytoseiidae_1 aaatttaaaagatgaacaatctttctattttaatattcttctattaatagatatcttaattcaacatcgaggtcgtaaactattataccaatatgttctatccataataa 0.004 0.000 0.000 0.004 ?
Opiliones NI Opiliones_1 aaaattaatagtcgaacagactaactcatatctatatttctagaaacaatgtttttaattcaacatcgaggtcgcaatcttactcactaataagaactctaaaagtaaa 0.004 0.000 0.000 0.004 ?
Sarcoptiformes Pyroglyphidae Dermatophagoides farinae aaaatcatcagacgaacagtctgactaactctagccccttcgccaagtagtggttttaatccaacatcgaggtcccaaacccccttaaagataagaactcataaagggta 0.004 0.004 0.009 0.018 ?
Diplopoda NI NI Diplopoda_1 gaatttaaaggtcgaacagaccttctttaacaactactgcaccaataagacttcttattccaacatcgaggtcgcaaacattttcgtcaatatgaactctcaaaaaata 0.009 0.000 0.000 0.009 ?
Entognatha Collembola Entomobryidae Entomobryidae_1 aaatttaatagtcgaacagactttcttataaaaatactgctcttttaagaaattttaattcaacatcgaggtcgcaaaaaattttgtcgataagaactctaaaaaatca 0.000 0.000 0.004 0.004
Entomobryidae_2 aaatttaatggtcgaacagaccatttaatattaactactgcactaaaaaaactttttaattcaacatcgaggtcgcaaacacatctattaataagaactctcaagatata 0.004 0.000 0.000 0.004
Entomobryidae_3 atattttatagacgaacagtctagcttttaaaatttctgcactttaaagcgtatttaattcaacatcgaggtcgcaaactaaaatgtcgataagaactctcaattttaa 0.000 0.004 0.000 0.004
Insecta NI* NI Insecta_1 gaatttaatagtcgaacagactaactcaaaagaaaaactaccccccaaaattatcttaattcaacatcgaggtcgcaaacttaactataaataagaactctccagtaaaa 0.009 0.000 0.000 0.009 ?
Blattodea* Blattidae* Blattella germanica gattttaaaggtcgaacagacctaacatacttaaacttctacacctaatgtttatcttaatccaacatcgaggtcgcaaccctttttgtcgataagaactcttaaaaaaga 0.009 0.000 0.000 0.009 +
Periplaneta americana gattttaaaggtcgaacagacctaaacaaattgaaattctacacccaaattaaatcttaatccaacatcgaggtcgcaaccccatttatcaataagaactctcaaaaaaga 0.004 0.000 0.000 0.004 +
Symploce_1 gattttaaaggtcgaacagacctaacattattaaacttctacacctaatgtttatcttaatccaacatcgaggtcgcaaccctttttgtcgatattaactctcaaaaagga 0.004 0.000 0.000 0.004
Coleoptera NI Coleoptera_1 aaaattaaaagacgaacagtcctacttctccagccccttcgccaaagagtaattttaatccaacatcgaggtcccaaacccccctaaagataagaactcacaagaagga 0.000 0.000 0.013 0.013 ?
Curculionidae Hypothenemus_1 aatttcaaaagtcgaacagactcaatttcccagcttctacaccaagaatttattttaatccaacatcgaggtcgcaatctcttctttcgataagaactctcaagaaaaa 0.000 0.004 0.000 0.004
Dermaptera Anisolabididae Euborellia annulipes aattttaatagtcgaacagactaaaattataaactcctgcatttatattttattttaatccaacatcgaggtcgcaatctctcttgttaataagttctctctaagagaa 0.013 0.009 0.000 0.022 +
Diptera* NI Diptera_1 gattttaatagtcgaacagactaaattttcaagcttctgcacctaaaatttatcttaatccaacatcgaggtcgcaatcctctataataataagaactcaaaaaagaga 0.004 0.000 0.000 0.004 ?
Chironomidae Cricotopus_1 gaaaatataagtcgaacagactttgaatttaaacttctacacctaaattaattcttagtccaacatcgaggtcgcaatcttttttatcgatttgaactctccaaaaaaa 0.004 0.000 0.000 0.004 ?
Diopsidae Diopsidae_1 gatttaaaaagtcgaacagacttaatatttaaaactcttcttttaaatttaaccttaattcaacatcgaggtcataaatatttttttatatacgatctacaaaaaaatt 0.004 0.000 0.000 0.004 ?
Phoridae* Megaselia_1* gaattcaaaggtcgaacagacctaaactttaaacttctacacctaaaaataactcttaatccaacatcgaggtcgcaatcttttttgtcgatatgaactctaaaaaaaaa 0.004 0.000 0.000 0.004
Psychodidae Psychodidae_1 gaatttaaaagtcgaacagactttatttttaaactgctgcacctaaaataaatcttaattcaacatcgaggtcgcaatcatttttatcgatatgaactctctaaaaaga 0.000 0.004 0.000 0.004
Hemiptera* Aphididae* Aphididae_1 gaatttaaaggtcgaacagacctaacacttaaaattttgcacctaagattaatcttaattcaacatcgaggtcgcaaactaatttttaaatttgaacttaaaaaattaa 0.004 0.000 0.000 0.004 ?
Aphis gossypii* gaatttaaaggccgaacagacctaatacttaaaattttgcacctaagattaatcttaattcaacatcgaggtcgcaaactaatttttaaatttgaacttaaaaaatgaa 0.004 0.000 0.000 0.004 +
Cicadellidae Cicadellidae_1 gaaattaaaagtcgaacagacttaaattataaagaatctaccccctaattttatcttaattcaacatcgaggtcgcaaactttaatatagatatgaactctccattaaaa 0.004 0.000 0.000 0.004 ?
Nesophrosyne_1 gattttaaaagtcgaacagacttaatataaagaattctgcttctaatataaatcttaattcaacatcgaggtcgtaaactttaatatagatatgaactccccattaaaa 0.004 0.000 0.000 0.004
Hymenoptera* NI Hymenoptera_2 gattttaatagtcgaacagactaaataaattattatctccaataattattaatcttaattcaacatcgaggtcgcaaacttaaatatcaatatgatctctccatttaaa 0.004 0.000 0.000 0.004 ?
Aphelinidae Eretmocerus mundus aattttaatagtcgaacagactaaaatttttaatatcttcattaaaattaaattttaattcaacatcgaggtcgcaaacttttttatcaatatgaactatttaaaaaaa 0.004 0.000 0.000 0.004 ?
Apidae* Apidae_1* gattttaaaagtcgaacagacttaaatattaaactccttcatttaatttttatcttaattcaacatcgaggtcgcaaccacctttattaataggatctctctaaagata 0.022 0.000 0.000 0.022 ?
Apis mellifera* gactttaaaagtcgaacagacttaaatattaaactccttcatttaatttttatcttaattcaacatcgaggtcgcaatcacctttattaataagatctctctaaagata 0.009 0.000 0.000 0.009
Braconidae Diaeretiella rapae gattttaaaagtcgaacagacttaaaatataaaaatttttcattttaattttatcttaattcaacatcgaggtcataaaatttattttaaatttgatcttagaaataaaa 0.009 0.009 0.000 0.018 +
Formicidae* Formicidae_2 gattttaatagtcgaacagactaaacttttaaacttcttcatttaaattaaatcttaattcaacatcgaggtcgcaaacatttttattaataagatctctccaaaaata 0.004 0.000 0.000 0.004 ?
Formicidae_3 gattttaaaagtcgaacagacttaaatattaaatatctccatttaatttttatcttaattcaacatcgaggtcgcaaacatttttatcaatatgatctttctaaaaata 0.004 0.000 0.000 0.004 ?
Camponotus_1 aattttaatagtcgaacagactaaaatattaaactcctacgcctaatttttattttaattcaacatcgaggtcgcaatcacttttatcaataagatctttctaaaaaga 0.000 0.000 0.004 0.004
Cardiocondyla emeryi gattttaaaagtcgaacagacttaaatattaaatttctccatctaatttttatcttaattcaacatcgaggtcgcaaacatttttatcaatatgatctctccaaaaata 0.004 0.000 0.000 0.004 ?
Monomorium subopacum* gattataaaagtcgaacagacttaaatattaaatatctccatttaatttttatcttaattcaacatcgaggtcgcaatcacttttatcaatatgaactctctaaaaata 0.013 0.000 0.000 0.013
Thynninae Neozeleboria_1 gattttaaaagtcgaacagacttaaatattaaacttctccatctaatttttatcttaattcaacatcgaggtcgcaaccatttttatcaatatgaactctccaaaaata 0.004 0.004 0.000 0.009 ?
Lepidoptera* NI Lepidoptera_1 gattttaatgatcgaacagatcaaaaattttaaacttttgcatttaaattttatcttagtccaacatcgaggtcgcaaacttttttttttatttgaactaaaaaaaaaaa 0.013 0.009 0.000 0.022 ?
Lepidoptera_2* gattttaatgatcgaacagatcaaaaacttaaacttttgcattataaattttatcttaatccaacatcgaggtcgcaaactctttttcttataagaactaaaaaaaaaa 0.004 0.000 0.000 0.004 ?
Lepidoptera_3 gattttaatgatcgaacagatcaaaaattttaaacttttgcatttaaattttatcttagtccaacatcgaggtcgcaaacttttttttttatttgaactaaaaaaaaa 0.004 0.004 0.000 0.009 ?
Lepidoptera_6 gattttaatgatcgaacagatcaaaaattttaaacttttgcatttaaattttatcttagtccaacatcgaggtcgcaaacttttttttttatttgaactaaaaaaaaaga 0.000 0.004 0.000 0.004 ?
Lepidoptera_8 gattttaatgatcgaacagatcaaaattttaaacttctacatttaaattttatcttaatccaacatcgaggtcgcaaacttttcttcttatttgaactaaaaaaaaaa 0.004 0.000 0.000 0.004 ?
Bombycidae Bombyx_1 gattttaatgatcgaacagatcaaaattttaaacttctacatttaaattttatcttaatccaacatcgaggtcgcaaacttttcttcttatttgaactaaaaaaaaaaa 0.004 0.000 0.000 0.004 ?
Noctuidae Noctuidae_1 gattttaatgatcgaacagatcaaaattttaaacttctgcatttaaattttatcttaatccaacatcgaggtcgcaaactcttttttttatttgaactaaaaaaaaaa 0.004 0.000 0.000 0.004
Papilionidae Papilionidae_1 gattttaatgatcgaacagatcaaaaattttaaacttttgcatttaaattttatcttagtccaacatcgaggtcgcaaactttttttttatttgaactaaaaaaaaaaa 0.013 0.004 0.000 0.018 ?
Papilionidae_2 gattttaatgatcgaacagatcaaaaattttaaacttttgcatttaaattttatcttagtccaacatcgaggtcgcaaactttttttttatttgaactaaaaaaaaaa 0.009 0.004 0.000 0.013 ?
Pieridae Colotis_1 gattttaatgatcgaacagatcaaaattttaaacttttgcatttaaattttatcttaatccaacatcgaggtcgcaaacttttatttttatttgaactaaaaaaaaaaa 0.004 0.000 0.000 0.004
Pterophoridae Pterophoridae_1 gattttaatgatcgaacagatcaaaattttaaatttttgcatttaaattttatcttaatccaacatcgaggtcgcaaacttttatttttatatgaactaaaaataaaaa 0.004 0.000 0.000 0.004 ?
Orthoptera Acrididae Acrididae_1 gaatttaaaggtcgaacagacctaatcattgggctactgcacccaaaatttttcttaatccaacatcgaggtcgcaatctgctttgtcgatatgagctctcaaaaacga 0.004 0.000 0.000 0.004
Acrididae_2 gaatttaaaggtcgaacagacctaatcattgggctactgcacccaaaatttttcttaatccaacatcgaggtcgcaatctgctttgtcgatatgagctctcaaaaacaa 0.004 0.000 0.000 0.004
Gryllidae Gryllus_1 gaatttaatggtcgaacagaccaattaattaagcttctgcacctaataattttcttaatccaacatcgaggtcgcaatctttattatcaatatgaactctccaataaca 0.000 0.000 0.004 0.004
Pyrgomorphidae Pyrgomorpha conica gattttaaaggtcgaacagacctagtttctaaactgatgcacctagaacttatcttaatccaacatcgaggtcgcaatctaatttgttgatatgaactctcaaaattaa 0.004 0.000 0.000 0.004
Thysanoptera Phlaeothripidae Phlaeothripidae_1 gattttaaaagtcgaacagacttaatttattaaaatttttcttaaaaaatttatcttaattcaacatcgaggtcataaaaaatatattaaaataaggactttttatataatt 0.004 0.000 0.000 0.004
Malacostraca Decapoda NI Decapoda_1 aaatttaatggttgaacaaaccaacttactaggatcctgctcctaatagtaattttaattcaacatcgaggtcgcaacccactctattgatacggactcttcagagtga 0.004 0.000 0.004 0.009 ?
Decapoda_2 atatttattagtcgaacagactgtcttttataaactgctgcttctaaaagaaaatttaattcaacatcgaggtcgcaaaaacttttatcgatttgaactctccaaaagaa 0.004 0.000 0.000 0.004 ?

The final ID of MOTUs corresponds to the highest taxonomical classification possible. Information about the putative impact (positive, +, negative, −, or unknown, ?) of predation on each MOTU is also given. The (*) indicates taxa that contributed significantly to differences between sections.

FIGURE A1.

FIGURE A1

Heatmap representing the distribution of the different diet items in the Mus musculus samples of the three islands (Santo Antão, Santiago and São Vicente). Occurrences of plant items are represented in green and of invertebrate items in yellow

Pinho, C. J. , Lopes, E. P. , Paupério, J. , Gomes, I. , Romeiras, M. M. , & Vasconcelos, R. (2022). Trust your guts? The effect of gut section on diet composition and impact of Mus musculus on islands using metabarcoding. Ecology and Evolution, 12, e8638. 10.1002/ece3.8638

DATA AVAILABILITY STATEMENT

The datasets supporting this article have been uploaded as part of Appendix A and in the GenBank database (PRJNA801221 accession code; https://www.ncbi.nlm.nih.gov/sra/PRJNA801221).

REFERENCES

  1. Albrecht, K. A. , Wedin, W. F. , & Buxton, D. R. (1987). Cell‐wall composition and digestibility of alfalfa stems and leaves1 . Crop Science, 27, 735–741. 10.2135/cropsci1987.0011183X002700040027x [DOI] [Google Scholar]
  2. Alho, M. , Granadeiro, J. P. , Rando, J. C. , Geraldes, P. , & Catry, P. (2022). Characterization of an extinct seabird colony on the island of Santa Luzia (Cabo Verde) and its potential for future recolonizations. Journal of Ornithology, 163, 301–313. 10.1007/s10336-021-01923-8 [DOI] [Google Scholar]
  3. Angel, A. , Wanless, R. M. , & Cooper, J. (2009). Review of impacts of the introduced house mouse on islands in the Southern Ocean: Are mice equivalent to rats? Biological Invasions, 11, 1743–1754. 10.1007/s10530-008-9401-4 [DOI] [Google Scholar]
  4. Borloti, I. , Dinis, H. , & Vasconcelos, R. (2020). Bats out of Africa: Disentangling the systematic position and biogeography of bats in Cabo Verde. Genes, 11, 877. 10.3390/genes11080877 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brilhante, M. , Varela, E. , P. Essoh, A. , Fortes, A. , Duarte, M. C. , Monteiro, F. , Ferreira, V. , Correia, A. M. , Duarte, M. P. , & Romeiras, M. M. (2021). Tackling food insecurity in Cabo Verde Islands: The nutritional, agricultural and environmental values of the legume species. Foods, 10, 206. 10.3390/foods10020206 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bunce, M. , Mee, L. , Rodwell, L. D. , & Gibb, R. (2009). Collapse and recovery in a remote small island—A tale of adaptive cycles or downward spirals? Global Environmental Change, 19, 213–226. 10.1016/j.gloenvcha.2008.11.005 [DOI] [Google Scholar]
  7. Butchart, S. H. M. , Walpole, M. , Collen, B. , van Strien, A. , Scharlemann, J. P. W. , Almond, R. E. A. , Baillie, J. E. M. , Bomhard, B. , Brown, C. , Bruno, J. , Carpenter, K. E. , Carr, G. M. , Chanson, J. , Chenery, A. M. , Csirke, J. , Davidson, N. C. , Dentener, F. , Foster, M. , Galli, A. , … Watson, R. (2010). Global biodiversity: Indicators of recent declines. Science, 328, 1164–1168. 10.1126/science.1187512 [DOI] [PubMed] [Google Scholar]
  8. Buxton, D. R. , Mertens, D. R. , & Moore, K. J. (1995). Forage quality for ruminants: Plant and animal considerations1 . The Professional Animal Scientist, 11, 121–131. 10.15232/S1080-7446(15)32575-4 [DOI] [Google Scholar]
  9. Buxton, D. R. , & Redfearn, D. D. (1997). Plant limitations to fiber digestion and utilization. The Journal of Nutrition, 127, 814S–818S. 10.1093/jn/127.5.814S [DOI] [PubMed] [Google Scholar]
  10. Copson, G. (1986). The diet of the introduced rodents Mus Musculus L and Rattus Rattus L on subantarctic Macquarie Island. Australian Wildlife Research, 13, 441–445. 10.1071/WR9860441 [DOI] [Google Scholar]
  11. Courchamp, F. , Chapuis, J.‐L. , & Pascal, M. (2003). Mammal invaders on islands: Impact, control and control impact. Biological Reviews, 78, 347–383. 10.1017/S1464793102006061 [DOI] [PubMed] [Google Scholar]
  12. Dedryver, C.‐A. , Le Ralec, A. , & Fabre, F. (2010). The conflicting relationships between aphids and men: A review of aphid damage and control strategies. Comptes Rendus Biologies, 333, 539–553. 10.1016/j.crvi.2010.03.009 [DOI] [PubMed] [Google Scholar]
  13. Doherty, T. S. , Dickman, C. R. , Johnson, C. N. , Legge, S. M. , Ritchie, E. G. , & Woinarski, J. C. Z. (2017). Impacts and management of feral cats Felis catus in Australia. Mammal Review, 47, 83–97. 10.1111/mam.12080 [DOI] [Google Scholar]
  14. Doherty, T. S. , Glen, A. S. , Nimmo, D. G. , Ritchie, E. G. , & Dickman, C. R. (2016). Invasive predators and global biodiversity loss. Proceedings of the National Academy of Sciences, 113, 11261–11265. 10.1073/pnas.1602480113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Duarte, M. C. , Rego, F. , Romeiras, M. M. , & Moreira, I. (2008). Plant species richness in the Cape Verde Islands—eco‐geographical determinants. Biodiversity and Conservation, 17, 453–466. 10.1007/s10531-007-9226-y [DOI] [Google Scholar]
  16. Egeter, B. , Bishop, P. J. , & Robertson, B. C. (2015). Detecting frogs as prey in the diets of introduced mammals: A comparison between morphological and DNA‐based diet analyses. Molecular Ecology Resources, 15, 306–316. 10.1111/1755-0998.12309 [DOI] [PubMed] [Google Scholar]
  17. Ferreira, C. M. , Sabino‐Marques, H. , Barbosa, S. , Costa, P. , Encarnação, C. , Alpizar‐Jara, R. , Pita, R. , Beja, P. , Mira, A. , Searle, J. B. , Paupério, J. , & Alves, P. C. (2018). Genetic non‐invasive sampling (gNIS) as a cost‐effective tool for monitoring elusive small mammals. European Journal of Wildlife Research, 64. 10.1007/s10344-018-1188-8 [DOI] [Google Scholar]
  18. Gaiotto, J. V. , Abrahão, C. R. , Dias, R. A. , & Bugoni, L. (2020). Diet of invasive cats, rats and tegu lizards reveals impact over threatened species in a tropical island. Perspectives in Ecology and Conservation, 18, 294–303. 10.1016/j.pecon.2020.09.005 [DOI] [Google Scholar]
  19. Gil, V. , Pinho, C. J. , Aguiar, C. A. S. , Jardim, C. , Rebelo, R. , & Vasconcelos, R. (2020). Questioning the proverb ‘more haste, less speed’: Classic versus metabarcoding approaches for the diet study of a remote island endemic gecko. PeerJ, 8, e8084. 10.7717/peerj.8084 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Groh, K. (1982). Zum Auftreten einiger, bisher von den Kapverdischen Inseln nicht oder wenig bekannter Tiergruppen (Articulata und Vertebrata). Courier Forschungsinstitut Senckenberg, 52, 249–264. [Google Scholar]
  21. Harms‐Tuohy, C. A. , Schizas, N. V. , & Appeldoorn, R. S. (2016). Use of DNA metabarcoding for stomach content analysis in the invasive lionfish Pterois volitans in Puerto Rico. Marine Ecology Progress Series, 558, 181–191. 10.3354/meps11738 [DOI] [Google Scholar]
  22. Hazevoet, C. J. , & Masseti, M. (2011). On the history of the green monkey Chlorocebus sabaeus (L., 1766) in the Cape Verde Islands, with notes on other introduced mammals. Zoologia Caboverdiana, 2, 12–24. [Google Scholar]
  23. Holland, C. , Ryden, P. , Edwards, C. H. , & Grundy, M.‐M.‐L. (2020). Plant cell walls: Impact on nutrient bioaccessibility and digestibility. Foods, 9, 201. 10.3390/foods9020201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Holmes, N. D. , Griffiths, R. , Pott, M. , Alifano, A. , Will, D. , Wegmann, A. S. , & Russell, J. C. (2015). Factors associated with rodent eradication failure. Biological Conservation, 185, 8–16. 10.1016/j.biocon.2014.12.018 [DOI] [Google Scholar]
  25. In Arechavaleta M., Zurita N., Marrero M. & Martín J. (Eds.), (2005). Lista preliminar de especies silvestres de Cabo Verde (hongos, plantas y animales terrestres) Consejería de Medio Ambiente y Ordenación, Gobierno de Canarias. [Google Scholar]
  26. Jakubavičiūtė, E. , Bergström, U. , Eklöf, J. S. , Haenel, Q. , & Bourlat, S. J. (2017). DNA metabarcoding reveals diverse diet of the three‐spined stickleback in a coastal ecosystem. PLoS One, 12, e0186929. 10.1371/journal.pone.0186929 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Jarvis, M. C. (2011). Plant cell walls: Supramolecular assemblies. Food Hydrocolloids, 25, 257–262. 10.1016/j.foodhyd.2009.09.010 [DOI] [Google Scholar]
  28. Jones, E. P. , Eager, H. M. , Gabriel, S. I. , Jóhannesdóttir, F. , & Searle, J. B. (2013). Genetic tracking of mice and other bioproxies to infer human history. Trends in Genetics, 29, 298–308. 10.1016/j.tig.2012.11.011 [DOI] [PubMed] [Google Scholar]
  29. Kartzinel, T. R. , & Pringle, R. M. (2015). Molecular detection of invertebrate prey in vertebrate diets: trophic ecology of Caribbean island lizards. Molecular Ecology Resources, 15, 903–914. 10.1111/1755-0998.12366 [DOI] [PubMed] [Google Scholar]
  30. Le Roux, V. , Chapuis, J.‐L. , Frenot, Y. , & Vernon, P. (2002). Diet of the house mouse (Mus musculus) on Guillou Island, Kerguelen archipelago, Subantarctic. Polar Biology, 25, 49–57. 10.1007/s003000100310 [DOI] [Google Scholar]
  31. Lobo, J. M. , & Borges, P. A. V. (2010). The provisional status of terrestrial arthropod inventories in the Macaronesian islands. In Serrano A. R. M., Borges P. A. V., Boieiro M. & Oromí P. (Eds.), Terrestrial arthropods of Macaronesia – Biodiversity, ecology and evolution (pp. 33–47). Sociedade Portuguesa de Entomologia. https://repositorio.uac.pt/bitstream/10400.3/1982/3/56_Cap2_Lobo_Borges.pdf [Google Scholar]
  32. Miranda, C. , Costa, C. , Gonçalves, I. , Brites, J. , & Fortes, J. M. M. d. A. e. A. (2021). In Borges J. C. (Ed.), Anuário Estatístico 2019 (p. 300). Instituto Nacional de Estatística. https://ine.cv/publicacoes/anuario‐estatistico‐2019/ [Google Scholar]
  33. Margalida, A. , Bertran, J. , & Boudet, J. (2005). Assessing the diet of nestling Bearded Vultures: A comparison between direct observation methods. Journal of Field Ornithology, 76, 40–45. 10.1648/0273-8570-76.1.40 [DOI] [Google Scholar]
  34. Marris, J. W. M. (2000). The beetle (Coleoptera) fauna of the Antipodes Islands, with comments on the impact of mice; and an annotated checklist of the insect and arachnid fauna. Journal of the Royal Society of New Zealand, 30, 169–195. 10.1080/03014223.2000.9517616 [DOI] [Google Scholar]
  35. Martín, N. , Martínez, S. , Pujol‐Buxó, E. , Viñolas, A. , Llorente, G. A. , Sanpera, C. , Vasconcelos, R. , Carranza, S. , & Santos, X. (2017). Stable isotopes and diet uncover trophic‐niche divergence and ecological diversification processes of endemic reptiles on Socotra Island. Zoologischer Anzeiger, 267, 69–81. 10.1016/j.jcz.2017.01.005 [DOI] [Google Scholar]
  36. Mata, V. A. , Amorim, F. , Corley, M. F. , McCracken, G. F. , Rebelo, H. , & Beja, P. (2016). Female dietary bias towards large migratory moths in the European free‐tailed bat (Tadarida teniotis). Biology Letters, 12, 10.1098/rsbl.2015.0988 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Mateo, J. A. , García‐Márquez, M. , & López‐Jurado, L. F. (2005). Primeras evidencias de la supervivencia del escinco gigante de Cabo Verde, Macroscincus coctei (Duméril & Bibron, 1839). Boletín De La Asociación Herpetológica Española, 15, 73–75. [Google Scholar]
  38. McDougall, G. J. , Morrison, I. M. , Stewart, D. , & Hillman, J. R. (1996). Plant cell walls as dietary fibre: Range, structure, processing and function. Journal of the Science of Food and Agriculture, 70, 133–150. 10.1002/(SICI)1097-0010(199602)70:2<133:AID-JSFA495>3.0.CO;2-4 [DOI] [Google Scholar]
  39. Medina, F. M. , Melo, T. , Oliveira, P. , Nogales, M. , & Geraldes, P. (2021). Trophic ecology of an introduced top predator (Felis catus) on a small African oceanic islet (Santa Luzia, Cabo Verde Islands). African Journal of Ecology, 59, 88–98. 10.1111/aje.12800 [DOI] [Google Scholar]
  40. Monteiro, F. , Fortes, A. , Ferreira, V. , Pereira Essoh, A. , Gomes, I. , Correia, A. M. , & Romeiras, M. M. (2020). Current status and trends in Cabo Verde agriculture. Agronomy, 10, 74. 10.3390/agronomy10010074 [DOI] [Google Scholar]
  41. Mwebaze, P. , MacLeod, A. , Tomlinson, D. , Barois, H. , & Rijpma, J. (2010). Economic valuation of the influence of invasive alien species on the economy of the Seychelles islands. Ecological Economics, 69, 2614–2623. 10.1016/j.ecolecon.2010.08.006 [DOI] [Google Scholar]
  42. Neto, C. , Costa, J. C. , Figueiredo, A. , Capelo, J. , Gomes, I. , Vitória, S. , Semedo, J. M. , Lopes, A. , Dinis, H. , Correia, E. , Duarte, M. C. , & Romeiras, M. M. (2020). The role of climate and topography in shaping the diversity of plant communities in Cabo Verde Islands. Diversity, 12, 80. 10.3390/d12020080 [DOI] [Google Scholar]
  43. Olivera, P. , Menezes, D. , Trout, R. , Buckle, A. , Geraldes, P. , & Jesus, J. (2010). Successful eradication of the European rabbit (Oryctolagus cuniculus) and house mouse (Mus musculus) from the island of Selvagem Grande (Macaronesian archipelago), in the Eastern Atlantic. Integrative Zoology, 1, 70–83. 10.1111/j.1749-4877.2010.00186.x [DOI] [PubMed] [Google Scholar]
  44. Pinho, C. J. , Santos, B. , Mata, V. A. , Seguro, M. , Romeiras, M. M. , Lopes, R. J. , & Vasconcelos, R. (2018). What is the giant wall gecko having for dinner? Conservation genetics for guiding reserve management in Cabo Verde. Genes, 9, 599. 10.3390/genes9120599 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Pompanon, F. , Deagle, B. E. , Symondson, W. O. C. , Brown, D. S. , Jarman, S. N. , & Taberlet, P. (2012). Who is eating what: Diet assessment using next generation sequencing. Molecular Ecology, 21, 1931–1950. 10.1111/j.1365-294X.2011.05403.x [DOI] [PubMed] [Google Scholar]
  46. Rabaça, J. , & Mendes, D. (1997). The diet of the Barn owl, Tyto alba detorta Hartert, at São Domingos valley in Santiago, Cape Verde Islands. Boletim Museu Municipal Funchal, 49, 137–141. [Google Scholar]
  47. Rizzi, A. , Raddadi, N. , Sorlini, C. , Nordgrd, L. , Nielsen, K. M. , & Daffonchio, D. (2012). The stability and degradation of dietary DNA in the gastrointestinal tract of mammals: Implications for horizontal gene transfer and the biosafety of GMOs. Critical Reviews in Food Science and Nutrition, 52, 142–161. 10.1080/10408398.2010.499480 [DOI] [PubMed] [Google Scholar]
  48. Robeson, M. S. II , Khanipov, K. , Golovko, G. , Wisely, S. M. , White, M. D. , Bodenchuck, M. , Smyser, T. J. , Fofanov, Y. , Fierer, N. , & Piaggio, A. J. (2018). Assessing the utility of metabarcoding for diet analyses of the omnivorous wild pig (Sus scrofa). Ecology and Evolution, 8, 185–196. 10.1002/ece3.3638 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Romeiras, M. M. , Carine, M. , Duarte, M. C. , Catarino, S. , Dias, F. S. , & Borda‐de‐Água, L. (2020). Bayesian methods to analyze historical collections in time and space: A case study using Cabo Verde endemic flora. Frontiers in Plant Science, 11, 10.3389/fpls.2020.00278 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Romeiras, M. M. , Catarino, S. , Gomes, I. , Fernandes, C. , Costa, J. C. , Caujapé‐Castells, J. , & Duarte, M. C. (2016). IUCN Red List assessment of the Cape Verde endemic flora: towards a global strategy for plant conservation in Macaronesia. Botanical Journal of the Linnean Society, 180, 413–425. 10.1111/boj.12370 [DOI] [Google Scholar]
  51. Romeiras, M. M. , Monteiro, F. , Duarte, M. C. , Schaefer, H. , & Carine, M. (2015). Patterns of genetic diversity in three plant lineages endemic to the Cape Verde Islands. AoB PLANTS, 7, plv051. 10.1093/aobpla/plv051 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Russell, J. C. , Abrahão, C. R. , Silva, J. C. R. , & Dias, R. A. (2018). Management of cats and rodents on inhabited islands: An overview and case study of Fernando de Noronha, Brazil. Perspectives in Ecology and Conservation, 16, 193–200. 10.1016/j.pecon.2018.10.005 [DOI] [Google Scholar]
  53. Russell, J. C. , Meyer, J.‐Y. , Holmes, N. D. , & Pagad, S. (2017). Invasive alien species on islands: Impacts, distribution, interactions and management. Environmental Conservation, 44, 359–370. 10.1017/S0376892917000297 [DOI] [Google Scholar]
  54. Shendure, J. , & Ji, H. (2008). Next‐generation DNA sequencing. Nature Biotechnology, 26, 1135–1145. 10.1038/nbt1486 [DOI] [PubMed] [Google Scholar]
  55. Siegenthaler, A. , Wangensteen, O. S. , Benvenuto, C. , Campos, J. , & Mariani, S. (2019). DNA metabarcoding unveils multiscale trophic variation in a widespread coastal opportunist. Molecular Ecology, 28, 232–249. 10.1111/mec.14886 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Singleton, G. R. (1997). Integrated management of rodents: A Southeast Asian and Australian perspective. Belgian Journal of Zoology, 127, 157–169. https://biblio.naturalsciences.be/associated_publications/bjz/127‐1‐supplement/bjz‐127‐sup‐1997‐p157‐169.pdf [Google Scholar]
  57. Smith, V. , & Steenkamp, M. (1990). Climatic change and its ecological implications at a subantarctic island. Oecologia, 85, 14–24. [DOI] [PubMed] [Google Scholar]
  58. Stenseth, N. C. , Leirs, H. , Skonhoft, A. , Davis, S. A. , Pech, R. P. , Andreassen, H. P. , Singleton, G. R. , Lima, M. , Machang'u, R. S. , Makundi, R. H. , Zhang, Z. , Brown, P. R. , Shi, D. , & Wan, X. (2003). Mice, rats, and people: The bio‐economics of agricultural rodent pests. Frontiers in Ecology and the Environment, 1, 367–375. 10.1890/1540-9295(2003)001[0367:MRAPTB]2.0.CO;2 [DOI] [Google Scholar]
  59. Symondson, W. (2002). Molecular identification of prey in predator diets. Molecular Ecology, 11, 627–641. 10.1046/j.1365-294x.2002.01471.x [DOI] [PubMed] [Google Scholar]
  60. Taberlet, P. , Coissac, E. , Pompanon, F. , Brochmann, C. , & Willerslev, E. (2012). Towards next‐generation biodiversity assessment using DNA metabarcoding. Molecular Ecology, 21, 2045–2050. 10.1111/j.1365-294X.2012.05470.x [DOI] [PubMed] [Google Scholar]
  61. Taberlet, P. , Coissac, E. , Pompanon, F. , Gielly, L. , Miquel, C. , Valentini, A. , Vermat, T. , Corthier, G. , Brochmann, C. , & Willerslev, E. (2007). Power and limitations of the chloroplast trn L (UAA) intron for plant DNA barcoding. Nucleic Acids Research, 35, 14. 10.1093/nar/gkl938 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Themudo, G. E. , Rey‐Iglesia, A. , Robles Tascón, L. , Bruun Jensen, A. , da Fonseca, R. R. , & Campos, P. F. (2020). Declining genetic diversity of European honeybees along the twentieth century. Scientific Reports, 10, 10520. 10.1038/s41598-020-67370-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Thuo, D. , Furlan, E. , Broekhuis, F. , Kamau, J. , Macdonald, K. , & Gleeson, D. M. (2019). Food from faeces: Evaluating the efficacy of scat DNA metabarcoding in dietary analyses. PLoS One, 14, e0225805. 10.1371/journal.pone.0225805 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Tomé, D. (2013). Digestibility issues of vegetable versus animal proteins: Protein and amino acid requirements—Functional aspects. Food and Nutrition Bulletin, 34, 272–274. 10.1177/156482651303400225 [DOI] [PubMed] [Google Scholar]
  65. Vári, L. (1971). Lepidoptera (Heterocera: Tineidae, Hyponomeutidae). In Balkema A. A., & Town C. (Eds.), Marion and Prince Edward Islands. Report on the South African biological and geological expedition/1965–1966 (pp. 349–354). [Google Scholar]
  66. Westfall, K. M. , Therriault, T. W. , & Abbott, C. L. (2020). A new approach to molecular biosurveillance of invasive species using DNA metabarcoding. Global Change Biology, 26, 1012–1022. 10.1111/gcb.14886 [DOI] [PubMed] [Google Scholar]
  67. Whittaker, R. J. , Fernández‐Palacios, J. M. , Matthews, T. J. , Borregaard, M. K. , & Triantis, K. A. (2017). Island biogeography: Taking the long view of nature’s laboratories. Science, 357, eaam8326. 10.1126/science.aam8326 [DOI] [PubMed] [Google Scholar]
  68. Wilcks, A. , van Hoek, A. H. A. M. , Joosten, R. G. , Jacobsen, B. B. L. , & Aarts, H. J. M. (2004). Persistence of DNA studied in different ex vivo and in vivo rat models simulating the human gut situation. Food and Chemical Toxicology, 42, 493–502. 10.1016/j.fct.2003.10.013 [DOI] [PubMed] [Google Scholar]
  69. Wilson, A. K. (1981). Euphorbia heterophylla: A review of distribution, importance and control. Tropical Pest Management, 27, 32–38. 10.1080/09670878109414169 [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets supporting this article have been uploaded as part of Appendix A and in the GenBank database (PRJNA801221 accession code; https://www.ncbi.nlm.nih.gov/sra/PRJNA801221).


Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES