Abstract
Background
Infantile neuroaxonal dystrophy is an autosomal recessive neurological disorder. Individuals with infantile neuroaxonal dystrophy experience progressive loss of vision, mental skills and muscular control, and other variable clinical signs. Pathogenic variants in the PLA2G6 gene, encoding phospholipase A2, are recognized to be the fundamental reason for infantile neuroaxonal dystrophy. This study aimed to detect pathogenic variant in a consanguine Iranian family with infantile neuroaxonal dystrophy.
Methods
The mutation screening was done by whole exome sequencing followed by direct Sanger sequencing.
Results
We identified a homozygous insertion mutation, NM_003560: c.1548_1549insCG (p.G517Rfs*29) in exon 10 of PLA2G6 in the patient. The parents were heterozygous for variant.
Conclusions
Because of the clinical heterogeneity and rarity of infantile neuroaxonal dystrophy, whole exome sequencing is critical to confirm the diagnosis and is an excellent tool for INAD management.
Keywords: gene, homozygous, infantile neuroaxonal dystrophy, mutation, PLA2G6
The objects of the study were mutational analysis from an Iranian family with infantile neuroaxonal dystrophy, whose proband revealed progressive hypotonia and motor neuron defect. The mutation screening was done by whole‐exome sequencing followed by direct Sanger sequencing. We identified a novel pathogenic insertion variation C.1386‐1387insCG(p.G463fs), in exon 10 of PLA2G6 in the patient.
1. INTRODUCTION
PLA2G6‐associated neurodegeneration (PLAN) is a heterogeneous class of autosomal recessive neurodegenerative conditions that categorized into four subtypes, based on onset age, containing infantile neuroaxonal dystrophy (INAD), autosomal recessive early‐onset parkinsonism, dystonia‐parkinsonism, and atypical neuroaxonal dystrophy (ANAD). 1 , 2 Mutation in PLA2G6 is the causative gene for PLAN. 3 Infantile neuroaxonal dystrophy (INAD) is a very rare inherited disorder with autosomal recessive pattern that affects the nervous system. 4 Its precise incidence is unknown. Subjects with INAD usually do not have any symptoms at birth and symptoms typically present between ages six months and three years. 4 , 5 Most patients with INAD show a progressive disorder with psychomotor regression or delay and mental deterioration, hypotonia, cerebellar ataxia, hyperreflexia, spastic tetraplegia, and visual impairment including strabismus and nystagmus. Hearing loss and seizures may occur in some affected children. 6 In many affected patients, death usually occurs by the age of ten years. 4
Homozygote mutations in the PLA2G6 gene have been recognized as the most common cause of INAD. 3 , 7 , 8 , 9 The PLA2G6 gene is located on of the chromosome 22q13.1 and contains of 17 exons. The protein encoded by this gene called a phospholipase A2 (Group VI) that involved the release of fatty acids from phospholipids. 3 Phospholipase A2 is expressed in several tissues such as the brain, spinal cord, kidney, lung, pancreas, and gut (www.genecards.org). Phospholipid metabolism is essential for various body processes, including helping to maintain the integrity of the cell membrane. 10
Few cases of INAD patients have been reported in the worldwide, especially in Iran. 11 The aims of the study were mutational analysis from a consanguineous family coming from Iran, whose proband showed progressive hypotonia and motor neuron defect.
2. MATERIALS AND METHODS
2.1. Family recruitment and ethical statement
One pediatric subject with progressive hypotonia and motor neuron defect, who was referred to the pediatric and genetics Clinic of Beski Hospital, was included in the current study. The parents provided their written informed consent to participate in this study, which was approved by the ethics committee of the Qom Islamic Azad University, Qom, Iran.
2.2. Whole exome sequencing
Genomic DNA from 6ml peripheral blood was extracted from all participants using the salting out method. The quality of DNA extraction is checked using 1% agarose gel electrophoresis. One μg of gDNA from patients was sheared, and exome capture was done using Sure Select Human All Exon V7r2. The enriched libraries were sequenced by NovaSeq 6000 platform with the coverage of target region about 100%. The sequencing data alignment, variant calling, annotation, variant prioritization, and prediction were performed as mentioned previously. 12
2.3. Sanger sequencing validation
Primer sequences for exon 10 of PLA2G6 were designed by Primer3plus website (https://www.bioinformatics.nl/cgi‐bin/primer3plus/primer3plus.cgi), including 5ʹCCTCTCTCCCACTGCTGTTC3′ and R‐5ʹGCAAAGCCCTGAAGACAAAC3′ with product size, 275bp.
The PCR was performed in a total volume of 50 μl containing 20 μl of PCR Master mix, 1 μl of each forward and reverse primers (10 Pmol), 26 μl of ddH2O and 2 μl DNA. Thermal cycling conditions were primary denaturation step at 95°C for 4ʹ, then 34 cycles of denaturation step at 94°C for 28ʺ, annealing step 59°C for 25ʺ, and extension step at 72°C for 26ʺ, and a final extension step at 72°C for 6ʹ. The PCR products for direct Sanger sequencing were done on an automated ABI PRISM 3130XL (Applied Biosystems,). Then, the mutation was investigated in available family members for disease segregation analyses. Lastly, the sequencing results were aligned with a reference sequence in NCBI using the Chromas software.
3. RESULTS
3.1. Clinical description
The proband (IV‐3), a 2.5‐year‐old female, originating from Turkmen ethnicity from a consanguineous marriage who has shown signs of progressive hypotonia since 17 months of age (Figure 1). At the moment, she has signs such as developmental regression, destruction in the anterior horn neurons, nystagmus, feeding difficulty, speech delay, swallowing problems, and inability to walk. Brain MRI showed brief brainstorm involvement. Also, EMG‐NCS revealed evidence of anterior horn cell involvement. Her elder sibling deceased at the age of 7 years with related symptoms.
FIGURE 1.
Family pedigree of infantile neuroaxonal dystrophy
3.2. Mutational analysis
We identified a novel pathogenic insertion variation NM_003560: c.1548_1549insCG (p.G517Rfs*29) in our patient (IV‐3) (Figure 2B). The parents (III5 & III6) and healthy brothers (IV‐2) were heterozygote carriers for the mutation (Figure 2A) and did not present any signs of INAD. This variant caused a frameshift (p.G517Rfs*29) that was found at exon 10 that probably results premature termination of translation of PLA2G6 mRNA and protein premature truncation. Additionally, we checked this variant in literature and gnomAD, dbSNP, ExAC, HGMD, and Iranome databases that has not yet been reported. Because of the in silico prediction tools and InterVar classifying system, the mutation was found to be damaging. According to the above evidence and the latest American College of Medical Genetics (ACMG) guidelines, 13 this PLA2G6 variation is categorized as a variant of pathogenic.
FIGURE 2.
(A) The mutation status of PLA2G6 (c.1548_1549insCG) was validated by the Sanger sequencing, (B) the parents (III‐5 & III‐6) were in the heterozygous state, and the patient (IV‐3) was homozygous for (c.1548_1549insCG)
4. DISCUSSION
We descript a family with two patients suffering from INAD. Investigation of the WES data and subsequent Sanger validation monitored by co‐segregation analysis showed a novel insertion mutation that segregated with the INAD phenotype. To date, various mutations particularly missense variants or deletions have been reported from the PLA2G6 gene associated with the disease. 7 , 8 , 9 , 11 , 14 , 15 , 16 , 17 So far, insertion mutations have not been described for this gene. However, this type of mutations can lead to loss of function by disrupting the reading frame, of course, is consistent with the autosomal recessive inheritance pattern. This is the second study of INAD in Iran, and mutation in exon 10 has been formerly described in association with INAD in a Sudanese family. 7
Based on previous studies, some of the signs that reported of PLA2G6 gene mutations are consistent with our patient's symptoms, indicating different types of mutations result in overlapping forms of the disorder, with different genotype–phenotype correlations. 9 , 15 , 16 Mutations that result in a whole absence of the protein are assumed to cause typical INAD profile, with early onset and rapid disease progression. 9 , 15 Compound heterozygous mutations with a probable residual enzyme activity are guessed to be associated with the less severe PLAN phenotype. 9
To date 218 PLA2G6 mutations have been described (http://www.hgmd.cf.ac.uk/ac/gene.php?gene=PLA2G6). Pathogenic mutations in the PLA2G6 gene have been reported in all exons, 14 indicating that the mutations causing the disease do not occur as hot spots in a specific exon. The clinical heterogeneity makes the diagnosis of this syndrome complicated and therefore, early diagnosis relies on genetic testing. The whole exome sequencing method is one of the most powerful methods for detecting pathogenic mutations, especially in cases where we have not achieved an accurate clinical diagnosis.
Finally, our genetic investigation based on whole exome sequencing followed by Sanger validation shown a novel insertion mutation in the PLA2G6 gene in an Iranian family with infantile neuroaxonal dystrophy. Our results extended the spectrum of PLA2G6 mutations. Although our study has a limitation regarding lack of functional studies and the frequency of this novel PLA2G6 mutation await future examinations, we believe that the recognition of genetic defects related to INAD will eventually shed light on the underlying pathological mechanisms and help improve more effective management plans for INAD subjects in the future.
CONFLICT OF INTEREST
The authors do not have any conflict of interest to disclose.
AUTHOR CONTRIBUTION
MG, DR, and MRZ designed the research study, performed the experiments, sample, data collection, analyzed data, wrote the article, and assisted in drafting the manuscript. All authors approved the final article.
ACKNOWLEDGMENT
we would like to thank the patient and family, for their participation in this research. This study has been extracted from the thesis written by Dorsa Rostampour in the Department of Microbiology, Qom Branch, Islamic Azad University, Qom, Iran.
Rostampour D, Zolfaghari MR, Gholami M. Novel insertion mutation in the PLA2G6 gene in an Iranian family with infantile neuroaxonal dystrophy. J Clin Lab Anal. 2022;36:e24253. doi: 10.1002/jcla.24253
Funding information
The authors declared that this study received no financial support.
DATA AVAILABILITY STATEMENT
The datasets produced and/or analyzed during the current study are available from the corresponding author on reasonable request.
REFERENCE
- 1. Guo YP, Tang BS, Guo JF. PLA2G6‐associated neurodegeneration (PLAN): review of clinical phenotypes and genotypes. Front Neurol. 2018;9:1100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Paisan‐Ruiz C, Bhatia KP, Li A, et al. Characterization of PLA2G6 as a locus for dystonia‐parkinsonism. Ann Neurol. 2009;65(1):19‐23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Morgan NV, Westaway SK, Morton JE, et al. PLA2G6, encoding a phospholipase A 2, is mutated in neurodegenerative disorders with high brain iron. Nat Genet. 2006;38(7):752‐754. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Khateeb S, Flusser H, Ofir R, et al. PLA2G6 mutation underlies infantile neuroaxonal dystrophy. Am J Human Genet. 2006;79(5):942‐948. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Iodice A, Spagnoli C, Salerno GG, et al. Infantile neuroaxonal dystrophy and PLA2G6‐associated neurodegeneration: an update for the diagnosis. Brain Develop. 2017;39(2):93‐100. [DOI] [PubMed] [Google Scholar]
- 6. Aicardi J, Castelein P. Infantile neuroaxonal dystrophy. Brain: J Neurol. 1979;102(4):727‐748. [DOI] [PubMed] [Google Scholar]
- 7. Elsayed LE, Mohammed IN, Hamed AA, et al. Case report of a novel homozygous splice site mutation in PLA2G6 gene causing infantile neuroaxonal dystrophy in a Sudanese family. BMC Med Genet. 2018;19(1):1‐5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Wang B, Wu D, Tang J. Infantile neuroaxonal dystrophy caused by PLA2G6 gene mutation in a Chinese patient: a case report. Exp Ther Med. 2018;16(2):1290‐1294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Gebril O, Uebe S, Reuter M, Schumacher J, Abou Jamra R, Reis A. A new missense mutation in PLA2G6 gene among a family with infantile neuroaxonal dystrophy INAD. Egypt Pediatr Assoc Gaz. 2016;64(4):171‐176. [Google Scholar]
- 10. Balsinde J, Balboa MA. Cellular regulation and proposed biological functions of group VIA calcium‐independent phospholipase A2 in activated cells. Cell Signal. 2005;17(9):1052‐1062. [DOI] [PubMed] [Google Scholar]
- 11. Esfehani RJ, Eslahi A, Toosi MB, et al. PLA2G6 gene mutation and infantile neuroaxonal degeneration; report of three cases from Iran. Iranian J Basic Med Sci. 2021;24(9):1190‐1195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Esmaeilzadeh E, Bayat S, Mirfakhraie R, Gholami M. Whole exome sequencing identified a novel homozygous ARV1 mutation in an Iranian family with developmental and epileptic encephalopathy‐38. Meta Gene. 2021;30:100953. [Google Scholar]
- 13. Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American college of medical genetics and genomics and the association for molecular pathology. Genet Med. 2015;17(5):405‐423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Yamamoto T, Shimojima K, Shibata T, et al. Novel PLA2G6 mutations associated with an exonic deletion due to non‐allelic homologous recombination in a patient with infantile neuroaxonal dystrophy. HumaGenome Var. 2015;2(1):1‐5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Carrilho I, Santos M, Guimarães A, et al. Infantile neuroaxonal dystrophy: what's most important for the diagnosis? European J Paediatr Neurol. 2008;12(6):491‐500. [DOI] [PubMed] [Google Scholar]
- 16. Li L, Fong CY, Tay CG, et al. Infantile neuroaxonal dystrophy in a pair of Malaysian siblings with progressive cerebellar atrophy: description of an expanded phenotype with novel PLA2G6 variants. J Clin Neurosci. 2020;71:289‐292. [DOI] [PubMed] [Google Scholar]
- 17. Iannello G, Graziano C, Cenacchi G, et al. A new PLA2G6 mutation in a family with infantile neuroaxonal dystrophy. J Neurol Sci. 2017;381:209‐212. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets produced and/or analyzed during the current study are available from the corresponding author on reasonable request.