Abstract
Actinobacillus pleuropneumoniae is the etiological agent of porcine pleuropneumonia, a respiratory infectious disease responsible for global economic losses in the pig industry. From a monitoring perspective as well as due to the different courses of disease associated with the various serovars, it is essential to distinguish them in different herds or countries. In this study, we developed a novel high resolution melting (HRM) assay based on reference strains for each of the 19 known serovars and additional 15 clinical A. pleuropneumoniae isolates. The novel HRM comprises the species‐specific APP‐HRM1 and two serovar‐specific HRM assays (APP‐HRM2 and APP‐HRM3). APP‐HRM1 allowed polymerase chain reaction (PCR) amplification of apxIV resulting in an A. pleuropneumoniae specific melting curve, while nadV specific primers differentiated biovar 2 from biovar 1 isolates. Using APP‐HRM2 and APP‐HRM3, 13 A. pleuropneumoniae serovars can be determined by inspecting the assigned melting temperature. In contrast, serovar 3 and 14, serovar 9 and 11, and serovar 5 and 15 have partly overlapping melting temperatures and thus represent a challenge to accurately distinguish them. Consequently, to unambiguously ensure the correct assignment of the serovar, it is recommended to perform the serotyping HRM assay using a positive control for each serovar. This rapid and user‐friendly assay showed high sensitivity with 1.25 fg–125 pg of input DNA and a specificity of 100% to identify A. pleuropneumoniae. Characteristic melting patterns of amplicons might allow detecting new serovars. The novel HRM assay has the potential to be implemented in diagnostic laboratories for better surveillance of this pathogen.
Keywords: Actinobacillus pleuropneumoniae, capsule typing, high resolution melting, serovar
Actinobacillus pleuropneumoniae infection is a worldwide problem in the pig industry. It is important to differentiate between the 19 serovars using an efficient molecular tool, thereby improving presently available diagnostic methods. Knowing the prevalent serovar, the right vaccines could be administered and pigs potentially carrying virulent strains could be prevented from being introduced into farms.
1. INTRODUCTION
Actinobacillus pleuropneumoniae is the etiological agent of porcine pleuropneumonia, a respiratory infectious disease responsible for global economic losses due to high mortality rates and high treatment costs (Gottschalk & Broes, 2019). A. pleuropneumoniae isolates can be divided into biovar I and biovar II, requiring exogenous nicotinamide adenine dinucleotide (NAD) for growth in the case of biovar I, whereas biovar II strains comprise nadV responsible for NAD‐independent growth (Pohl et al., 1983). Various serovars associated with different courses of disease are described, which can be differentiated by the expression of several capsular antigens (Sassu et al., 2018). Currently, there are 19 recognized serovars of A. pleuropneumoniae based on the composition of the capsular polysaccharide (CPS) (Bossé et al., 2018; Stringer et al., 2021).
The pore‐forming exotoxins ApxI, ApxII, and ApxIII are important virulence factors of A. pleuropneumoniae. All virulent strains express one or two of these toxins. ApxIV toxin is essential for full virulence of A. pleuropneumoniae. It is expressed by all isolates of this species making apxIV a useful species‐specific marker (Chiers et al., 2010; Frey, 1995; Schaller et al., 1999).
Serotyping of A. pleuropneumoniae has formerly been performed serologically. However, due to highly similar capsular and lipopolysaccharide O‐antigen epitopes between certain serovars, cross‐reactions have been observed leading to incorrect serotyping results (Gottschalk, 2015; Mittal, 1990; Mittal & Bourdon, 1991; Mittal et al., 1988). Presently, many laboratories use multiplex polymerase chain reaction (PCR) assays for serotyping purposes (Bossé et al., 2018; Stringer et al., 2021). However, using conventional PCR assays is more time‐consuming and it remains a challenge to assign the correct amplicon size.
High resolution melting (HRM) is a rapid and low‐cost PCR‐based method characterizing PCR amplicons according to their dissociation behavior. Once a PCR reaction has been completed, a stepwise increase of temperature results in dissociation of the double‐stranded DNA into single strands leading to a decrease in fluorescence intensity. The dissociation of the double‐stranded DNA is dependent on the sequence of the amplicon, GC content, and length, therefore, contributing to a specific melting temperature for each amplicon (Vossen et al., 2009).
Serovar classification of A. pleuropneumoniae isolates helps trace certain serovars that cause severe diseases on a farm allowing epidemiological surveillance and is useful to provide information for vaccine development (Gottschalk, 2012). In this study, we propose a novel HRM assay to simultaneously identify A. pleuropneumoniae and its biovar based on apxIV and nadV on one hand and differentiate all known 19 serovars using CPS cluster as a target region on the other hand.
2. MATERIALS AND METHODS
2.1. Bacterial strains and clinical isolates
For the development of the novel HRM assay, the following A. pleuropneumoniae reference strains of serovars 1–18 were used: ATCC 27088, P1875, ORG1224, M62, K17, L20, femø, WF83, 405, CVJ 13261, D13039, 56153, 8329, N 273, 3906, HS143, A‐85/14, 16287‐1, and 7311555 (Table 1). A. pleuropneumoniae G1 9626 (serovar 19) was isolated and sequenced at the Section of Veterinary Bacteriology, University of Zurich (Peterhans et al., 2021) and was included as a serovar 19 reference strain (Table 1). Fifteen clinical isolates (Table 2), obtained from routine diagnostic submissions to the Section of Veterinary Bacteriology, the University of Zurich between 2012 and 2021, were tested in the HRM assay. Clinical samples were cultured on blood and chocolate agar plates (Thermo Fisher Diagnostics AG) for 24–48 h at 37°C in 5% CO2 to get clinical isolates. Biovar I or biovar II was confirmed phenotypically depending on whether growth on blood agar plates was observed (biovar II) or not (biovar I).
Table 1.
Actinobacillus pleuropneumoniae reference strains used for the development of the high resolution melting (HRM) assays
| Strain | Serovar | Biovar | Source/reference |
|---|---|---|---|
| A. pleuropneumoniae ATCC 27088 | 1 | 1 | ATCC |
| A. pleuropneumoniae P1875 | 2 | 1 | Veterinary Bacteriology, Vetsuisse Faculty, Bern, Switzerland |
| A. pleuropneumoniae ORG1224 | 3 | 1 | Veterinary Bacteriology, Vetsuisse Faculty, Bern, Switzerland |
| A. pleuropneumoniae M62 | 4 | 1 | Department of Microbiology, Royal Dental College, Aarhus, Denmark |
| A. pleuropneumoniae K17 | 5a | 1 | Department of Microbiology, Royal Dental College, Aarhus, Denmark |
| A. pleuropneumoniae L20 | 5b | 1 | Department of Microbiology, Royal Dental College, Aarhus, Denmark |
| A. pleuropneumoniae femø | 6 | 1 | Department of Microbiology, Royal Dental College, Aarhus, Denmark |
| A. pleuropneumoniae WF83 | 7 | 1 | Department of Veterinary Microbiology and Immunology, University of Guelph, Ontario, Canada |
| A. pleuropneumoniae 405 | 8 | 1 | Danish Veterinary Laboratory, Copenhagen, Denmark |
| A. pleuropneumoniae CVI 13261 | 9 | 1 | Danish Veterinary Laboratory, Copenhagen, Denmark |
| A. pleuropneumoniae D13039 | 10 | 1 | Danish Veterinary Laboratory, Copenhagen, Denmark |
| A. pleuropneumoniae 56153 | 11 | 1 | Department of Bacteriology, Central Veterinary Institute, Lelystad, The Netherlands |
| A. pleuropneumoniae 8329 | 12 | 1 | Danish Veterinary Laboratory, Copenhagen, Denmark |
| A. pleuropneumoniae N 273 | 13 | 2 | Department of Epizootiology, University of Veterinary Science, Budapest, Hungary |
| A. pleuropneumoniae 3906 | 14 | 2 | Danish Veterinary Laboratory, Copenhagen, Denmark |
| A. pleuropneumoniae HS143 | 15 | 1 | Department of Primary Industries Queensland, Animal Research Institute, Yeerongpilly, Australia |
| A. pleuropneumoniae A‐85/14 | 16 | 1 | Department of Infectious Disease, Imperial College, London, United Kingdom |
| A. pleuropneumoniae 16287‐1 | 17 | 1 | Department of Infectious Disease, Imperial College, London, United Kingdom |
| A. pleuropneumoniae 7311555 | 18 | 1 | Department of Infectious Disease, Imperial College, London, United Kingdom |
| A. pleuropneumoniae G1 9626 | 19 | 1 | Veterinary Bacteriology, Vetsuisse Faculty, Zurich, Switzerland |
Table 2.
Clinical isolates of Actinobacillus pleuropneumoniae used in the study
| A. pleuropneumoniae isolates | Year | Multiplex PCRa | Biovar | Origin | Anamnesis/clinical symptoms |
|---|---|---|---|---|---|
| MB 893 | 2014 | A. pleuropneumoniae serovar 13 | Biovar 1 | Joint | Lameness, diarrhea, decreased growth rate |
| MB 976 | 2014 | A. pleuropneumoniae serovar 13 | Biovar 1 | Wound | Neurological symptoms |
| MB 1465 | 2016 | A. pleuropneumoniae serovar 18 | Biovar 1 | Lung | Sudden death |
| SS 3906 | 2017 | A. pleuropneumoniae serovar 7 | Biovar 1 | Lung | Pneumonia |
| SS 3948 | 2017 | A. pleuropneumoniae serovar 7 | Biovar 1 | Lung | Diarrhea, decreased growth rate, sneezing |
| PP766 | 2018 | A. pleuropneumoniae serovar 19 | Biovar 1 | Lung | Lung lesions |
| SS 4384 | 2018 | A. pleuropneumoniae serovar 18 | Biovar 1 | Lung | Diarrhea, pneumonia |
| SS 4388 | 2019 | A. pleuropneumoniae serovar 18 | Biovar 1 | Lung | Pneumonia |
| SS 4935 | 2020 | A. pleuropneumoniae serovar 2, nadV | Biovar 2 | Lung | Lung lesions |
| SS 4936 | 2020 | A. pleuropneumoniae serovar 2, nadV | Biovar 2 | Lung | Lung lesions |
| SS 4983 | 2020 | A. pleuropneumoniae serovar 19 | Biovar 1 | Lung | Pneumonia, sudden death, lung lesions |
| 21‐71 | 2021 | A. pleuropneumoniae serovar 3 | Biovar 1 | Joint | Swollen joints |
| G1 9669 | 2021 | A. pleuropneumoniae serovar 19 | Biovar 1 | Lung | Pneumonia, sudden death |
| XS‐03 | 2021 | A. pleuropneumoniae serovar 7 | Biovar 1 | Lung | Unknown |
| RS‐01 | 2021 | A. pleuropneumoniae serovar 3 | Biovar 1 | Lung | Pneumonia |
In addition, 27 nontarget isolates comprising 18 different bacterial strains were tested as negative controls. These included A. minor (n = 1), A. suis (n = 1), Pasteurella multocida (n = 3), Glaesserella parasuis (n = 1), Bordetella bronchiseptica (n = 2), Streptococcus suis (n = 5), Staphylococcus aureus (n = 1), Staphylococcus hyicus (n = 2), Staphylococcus chromogenes (n = 1), Erysipelothrix rhusiopathiae (n = 1), Trueperella pyogenes (n = 1), A. rossi (n = 1), A. seminis (n = 1), Yersinia enterocolitica (n = 1), Pseudomonas aeruginosa (n = 1), Escherichia coli (n = 2), Enteroccoccus faecalis (n = 1), and Rhodococcus hoagii (n = 1).
2.2. Identification of clinical isolates
Serovars of clinical isolates were first identified using multiplex PCR of published protocols (Bossé et al., 2018; Stringer et al., 2021). Briefly, as proposed, two PCR reactions were performed using Qiagen HotStart Taq DNA Polymerase (Qiagen) in a minimal total reaction volume of 10 µl including primers at a final concentration of 0.3 μM each and 1 µl of DNA template. PCR cycling was performed with initial activation of Taq Polymerase for 15 min, followed by 35 cycles at 30 s for 94°C for denaturation, 90 s at 60°C, for annealing and 150 s at 72°C for elongation followed by a final extension step of 10 min at 72°C. Size analysis of PCR products was performed on a capillary electrophoresis QIAxcel Advanced device (Qiagen) using a screening cartridge, QX 15 bp–3 kb alignment marker, and QX 100 bp–2.5 kb size marker (Qiagen) according to the manufacturer's instructions. The resulting electropherograms were inspected with the QIAxcel ScreenGel 1.2.0 software (Qiagen).
2.3. HRM development and optimization
Primers were designed using CLC Main Workbench software 7.5.1 (Qiagen) with CPS sequences of A. pleuropneumoniae retrieved from the NCBI databank targeting the same CPS loci as described previously (Stringer et al., 2021). The specificity of primer sequences was confirmed by BLAST searches. Oligonucleotide primers were synthesized by Microsynth (Balgach, Switzerland). All HRM experiments were performed on a Rotor‐Gene Q (Qiagen) using Type‐it HRM PCR Kit (Qiagen) with a total reaction volume of 15 µl. One microliter of sample DNA was added to a reaction mixture containing Type‐it HRM PCR Master Mix (2x) (Qiagen), primers at a concentration indicated (Tables 3, 4, 5) targeting capsular gene regions of different serovars of A. pleuropneumoniae and ultrapure water. The PCR thermocycling conditions were as follows: initial denaturation at 95°C for 5 min, 40 cycles with denaturation at 95°C for 10 s, and annealing/extension at 55°C (APP‐HRM1) and 62°C (APP‐HRM 2 and APP‐HRM3), respectively, for 30 s followed by a final cycling step for 10 s at 95°C and 2 min at 40°C. Finally, an HRM ramping from 62–95°C with fluorescence data acquisition at 0.1°C increments every 2 s was performed to generate A. pleuropneumoniae serovar‐specific melting curves. DNA originating from reference strains was used as positive controls in each PCR run. To exclude contaminations in the reaction mixture, ultrapure water was added as a negative control in each experiment.
Table 3.
APP‐HRM 1 primers for detection of Actinobacillus pleuropneumoniae and biovar 2
| Primer name | Sequence 5ʹ–3ʹ | Target gene | Reference | Amplicon size (bp) | Final concentration PCR (nM) | Amplicon melting temperature (T m) HRM |
|---|---|---|---|---|---|---|
| apxIVHRM_for | CCGAGAAAATAACGATTTG | apxIV | This study | 77 | 1066 | 71.8 ± 0.2 |
| apxIVHRM_rev | GGTGTGAATACCAATTTTG | axpIV | This study | 1066 | ||
| nadVHRM_for | CAATGCGAGGAATGAGTTCTT | nadV | This study | 155 | 150 | 79.8 ± 0.2 |
| nadVHRM_rev | TTCGGAGGCAGGAATAGAC | nadV | This study | 150 |
Abbreviations: APP‐HRM, Actinobacillus pleuropneumoniae‐high resolution melting; PCR, polymerase chain reaction.
Table 4.
APP‐HRM2 primers for detection of Actinobacillus pleuropneumoniae serovars 1, 2, 4, 5, 7, 8, 10, 13, and 15
| Primer name | Sequence 5ʹ–3ʹ | Target gene | References | Amplicon size (bp) | Final concentration PCR (nM) | Amplicon melting temperature (T m) HRM |
|---|---|---|---|---|---|---|
| APP1HRM_for | GAAAATGCAAGTACTACTAGCTTCTCCT | cps1B | This study | 169 | 400 | 75.4 ± 0.1 |
| APPP1HRM_rev | GGCATTAGCTTTTAATGATAATACTAGTAATTGTTC | cps1B | This study | 400 | ||
| APP2HRM_for | ACCAGAACGTCCTTCTAAAGC | cps2D | This study | 165 | 250 | 77.6 ± 0.1 |
| APP2HRM_rev | CTAAGAGCGAATCCATTCCCAT | cps2D | This study | 250 | ||
| APP4HRM_for | TGGGTTTGGTCCTGTTGTG | cps4B | This study | 199 | 200 | 76.3 ± 0.1 |
| AP4R | GGCTTTCTCCGTGTATGAATAAAGTG | cps4B | Bossé et al. (2018) | 200 | ||
| APP5HRM_for | AGCCACAAGACCCGAATG | cps5B | This study | 118 | 400 | 74.5 ± 0.1 |
| APP5HRM_rev | AATACCAAGCAGCAGCCAT | cps5B | This study | 400 | ||
| AP7F | TTGGAATGGATTCATGATTGGGC | cps7E | Bossé et al. (2014) | 191 | 200 | 73.1 ± 0.2 |
| APP7HRM_rev | CAAGGTTTCCCTTGAGGACCAT | cps7E | This study | 200 | ||
| APP8HRM_for | TGTTATTTAGGCAGTTCTGGAGAAC | cps8G | This study | 114 | 300 | 73.7 ± 0.1 |
| APP8HRM_rev | AGCTCCAAGAAGAGTACAATCATCT | cps8G | This study | 300 | ||
| APP10HRM_for | GTCTGGTGGTGATGGAACAAG | cps10A | This study | 180 | 400 | 77.3 ± 0.1 |
| APP10HRM_rev | TGATGCGAAATAGTAGATTGGTGCT | cps10A | This study | 400 | ||
| AP13F | GTTGTGTATCGAGGTTGGCATTTC | cps13E | Bossé et al. (2018) | 169 | 250 | 76.8 ± 0.1 |
| APP13HRM_rev | TCTTTATCTAATTCACTTGCTAGGTGTTC | cps13E | This study | 250 | ||
| APP15HRM_for | AGTATTATTAAGTGGCTTACCAAGACA | cps15B | This study | 166 | 500 | 74.8 ± 0.2 |
| APP15HRM_rev | TGAAGATAATAACTCTACCCAATTTCGT | cps15B | This study | 500 |
Abbreviations: APP‐HRM, Actinobacillus pleuropneumoniae‐high resolution melting; PCR, polymerase chain reaction.
Table 5.
APP‐HRM3 primers for detection of Actinobacillus pleuropneumoniae serovars 3, 6, 9, 11, 12, 14, 16, 17, 18, and 19
| Primer name | Sequence 5ʹ–3ʹ | Target gene | References | Amplicon size (bp) | Final concentration PCR (nM) | Amplicon melting temperature (T m) HRM |
|---|---|---|---|---|---|---|
| APP3HRM_for | ACACATATCAATCGGCAGGAGT | cps3F | This study | 141 | 200 | 75.7 ± 0.2 |
| AP3R | CATTCGCACCAGCAATCACC | cps3F | Bossé et al. (2018) | 200 | ||
| APP6HRM_for | CTCAATGCTATCATGCTCAACAAATG | cps6F | This study | 200 | 200 | 77.6 ± 0.1 |
| AP6R | GTCTGAAGTTTTATTCGCAGCTCC | cps6F | Bossé et al. (2018) | 200 | ||
| APP9/11HRM_for | CTTTACTTGAACCTAGGGTTAAGTTTATC | cps9/11F11F | This study | 85 | 500 | 73.3 ± 0.1/73.4 ± 0.1 |
| APP9/11HRM_rev | GCCTTATCACCTAATAGCACTGAG | cps9/11F11F | This study | 500 | ||
| AP12F | TAAAGGTATTATAACGCCGGCTCT | cps12A | Bossé et al. (2014) | 169 | 200 | 77.2 ± 0.1 |
| APP12HRM_rev | TCTCATAACGCAGCCATGC | cps12A | This study | 200 | ||
| APP14HRM_for | TCTACGGAAACCAAAGCTATGATT | cps14G | This study | 149 | 500 | 75.5 ± 0.1 |
| APP14HRM_rev | TGCTTCCAAGCGAGAATCA | cps14G | This study | 500 | ||
| AP16F | TTACTCACTTGGGCTAGGGATAG | cps16C | Bossé et al. (2017) | 125 | 400 | 76.4 ± 0.1 |
| APP16HRM_rev | TGCTCCTGCCATTGCGATA | cps16D | This study | 400 | ||
| APP17HRM_for | GTAATGGCGGTGTAATGCTA | cps17F | This study | 111 | 600 | 73 ± 0.1 |
| APP17HRM_rev | AATGGCTGATGTTACTACAGTATT | cps17F | This study | 600 | ||
| APP18HRM_for | TGGCAGCATAAAGGTCAATT | cps18B | This study | 105 | 500 | 73.6 ± 0.1 |
| APP18HRM_rev | ACGCTGTAAGTGTTTTGGTAT | cps18B | This study | 500 | ||
| APP19HRM_for | ACGGCAAATAATCGAGTTACT | cps19C | This study | 96 | 500 | 74.7 ± 0.2 |
| APP19HRM_rev | AGCATCAGGATCAATGTCAAT | cps19C | This study | 500 |
Abbreviations: APP‐HRM, Actinobacillus pleuropneumoniae‐high resolution melting; PCR, polymerase chain reaction.
Nineteen reference strains (Table 1) were used to develop the HRM assays. Data analysis was performed using Rotor‐Gene Q Software 2.3.1 (Qiagen) by melting curve analysis as well as analysis of generated normalized and difference plots. Samples revealing typical melting curves above the threshold value of 0.5 dF/dT were considered positive.
To examine the intra‐ and interassay variability of the amplicon melting temperatures (T m) of the novel HRM assay (APP‐HRM1, APP‐HRM2, and APP‐HRM3) representing its repeatability, 1.25 ng of genomic DNA of all 19 serovar reference strains were tested in triplicates in three individual experiments.
2.4. Specificity
To determine the specificity of the HRM assay, an exclusivity panel of 27 bacterial isolates comprising 18 different bacterial strains was tested applying the three assays APP‐HRM1, APP‐HRM2, and APP‐HRM3.
2.5. Analytical sensitivity
To determine the analytical sensitivities of the HRM assay, all reference strains were examined. Given the genome size of A. pleuropneumoniae between 2.2 and 2.4 Mbp (Bossé et al., 2016; Foote et al., 2008; Xu et al., 2010; Zhan et al., 2010), one genome equivalent (GE) of each reference strain corresponded to approximately 2.5 fg of genomic DNA.
To analyze the range of detection and linearity of all 19 A. pleuropneumoniae serovars, a 10‐fold serial dilution series containing 12.5 ng (5 × 106 GE), 1.25 ng (5 × 105 GE), 125 pg (5 × 104 GE), 12.5 pg (5 × 103 GE), 1.25 pg (500 GE), 125 fg (50 GE), 12.5 fg (5 GE) of genomic DNA was tested in triplicates using APP‐HRM1, APP‐HRM2, and APP‐HRM3. The linearity was expressed by the correlation coefficient (R 2) for each of the 19 A. pleuropneumoniae serovars. To evaluate the limit of detection (LOD), the lowest dilution was determined, at which all triplicates showed a positive melting curve above a threshold value of 0.5 dF/dT and a standard deviation of C t values ≤ 0.5 corresponding to a 95% confidence interval.
2.6. Efficiency
To calculate efficiencies of the HRM assays for each primer pair, Ct values measured in triplicates were plotted against GE in form of standard curves using a 10‐fold dilution series (5 × 106 GE, 5 × 105 GE, 5 × 104 GE, 5 × 103 GE, 500 GE, 50 GE, and 5 GE) of genomic DNA of each serovar reference strain. The PCR efficiency (E) was calculated from the slope (S) of the dilution curve in the linear range using the following equation: E = (101/ −S−1) × 100.
2.7. Clinical isolates
Fifteen clinical isolates obtained from the routine diagnostic lab of the Section of Veterinary Bacteriology were tested using primer‐mixes for APP‐HRM1, APP‐HMR2, and APP‐HRM3. The T m for each of the 15 isolates was determined and compared with the corresponding T m obtained from the 19 A. pleuropneumoniae serovar reference strains.
3. RESULTS
3.1. Conditions of HRM assays
In a first step, APP‐HRM1 allows simultaneously screening of A. pleuropneumoniae positive isolates using apxIV toxin as species‐specific target and identification of biovar by targeting nadV. A. pleuropneumoniae strains N273 (serovar reference strain 13), 3906 (serovar reference strain 14), SS4935 (clinical isolate serovar 2), and SS4936 (clinical isolate serovar 2) all contain apxIV and nadV, whereas all remaining A. pleuropneumoniae strains tested in the study are biovar 1 and therefore only harbor apxIV (Figure 1). For serotyping purposes, all positive samples resulting from APP‐HRM1 were tested using two different primer mixes (APP‐HRM2 and APP‐HRM3) in parallel. The combination of the assays APP‐HRM2 and APP‐HRM3 is capable of differentiating all 19 serovars of A. pleuropneumoniae (Figure 2). Performing APP‐HRM3 using primers described in Table 5, serovar 9 and serovar 11 could be differentiated when represented as a difference plot (Figure 3).
Figure 1.
High resolution melting (HRM) for identification of Actinobacillus pleuropneumoniae and biovar 2. APP‐HRM1 assay allows targeting the species‐specific gene apxIV for identification of A. pleuropneumoniae and nadV for biovar 2 detection, respectively. A. pleuropneumoniae strains N273 (serovar reference strain 13), 3906 (serovar reference strain 14), SS4935 (serovar 2), and SS4936 (serovar 2) (represented in blue) all contain apxIV and nadV, whereas all remaining A. pleuropneumoniae strains tested in the study (represented in red) are biovar 1 and therefore only harbor apxIV
Figure 2.
Illustration of high resolution (HRM) assay APP‐HRM2 (a–c) and APP‐HRM3 (d–f) capable of differentiating 19 serovars of Actinobacillus pleuropneumoniae. (a) Melting curves of the HRM step applying primers from APP‐HRM2. (b) Normalized plot for APP‐HRM2. (c) Difference plot for APP‐HRM2 normalized with DNA from A. pleuropneumoniae serovar 15. (d) Melting curves of the HRM step applying primers from APP‐HRM3. (e) Normalized plot for APP‐HRM3 (f) difference plot for APP‐HRM3 normalized with DNA from A. pleuropneumoniae serovar 14
Figure 3.
Identification of Actinobacillus pleuropneumoniae serovar 9 and serovar 11 using high resolution melting (HRM) assay APP‐HRM3. Differentiation of A. pleuropneumoniae serovar 9 and serovar 11 is based on a single‐nucleotide polymorphism in cps9/11F. A 10‐fold dilution series of A. pleuropneumoniae reference strains serovar 9 (light green) and serovar 11 (dark green) was tested in triplicates. Illustration of (a) PCR amplification curves, (b) melting curves of the HRM step, (c) normalized plot, and (d) difference plot normalized with genomic DNA from A. pleuropneumoniae serovar 11 (12.5 ng) visualizing two groups corresponding to A. pleuropneumoniae serovars 9 and 11. PCR, polymerase chain reaction
The results of the variability assays from APP‐HRM1 resulted in a coefficient of variation of CV% ≤ 0.09% for the intra‐ and interassay variability when targeting apxIV, whereas nadV as a target yielded a coefficient of variation for the intra‐assay variation of CV% ≤ 0.03% and CV% ≤ 0.05% for the interassay variation, respectively (available at https://doi.org/10.5281/zenodo.6045373). APP‐HRM2 and APP‐HRM3 revealed an intra‐ and interassay variation coefficient of CV% ≤ 0.06%. The obtained low coefficient of variation for all three APP‐HRM assays of lower than 0.1% demonstrated the novel HRM to be highly reproducible and robust (available at https://doi.org/10.5281/zenodo.6045373).
3.2. Specificity
The tested exclusivity panel of 27 pathogenic bacteria resulted in negative results for all tested non‐A. pleuropneumoniae strains when performing APP‐HRM1, APP‐HRM2, and APP‐HRM3. Furthermore, the reference strains of all 19 A. pleuropneumoniae serovars did not cross‐react with other serovars (Figure 2). Hence, the novel HRM assay had a specificity of 100%.
3.3. Analytical sensitivity
Standard curves were obtained using C t values from the tenfold dilution series of genomic DNA for each of the 19 A. pleuropneumoniae serovar reference strains amplified by apxIV and nadV‐specific primer pairs (APP‐HRM1) and by the 19 serovar‐specific primers pairs (APP‐HRM2 and APP‐HRM3) (Figures A1 and A2). For APP‐HRM1 the linear range of standard curves was between 5 × 106 and 50 GE for all tested A. pleuropneumoniae reference strains. The following LODs were identified to be within the relevant confidence level of 95%: 5 GE for A. pleuropneumoniae serovar 1, 7, 8, 9, 10, 15, and 16; and 50 GE for A. pleuropneumoniae serovar 2, 3, 4, 5a, 5b, 6, 11, 12, 13, 14, 17, 18, and 19, respectively. The standard curves for APP‐HRM1 showed high correlation coefficients of R 2 > 0.99. For visualization, the high sensitivity obtained for all A. pleuropneumoniae serovars when performing APP‐HRM1, a representative dilution series of A. pleuropneumoniae serovar 15 is shown (Figure 4) highlighting a low LOD of 5 GE with linearity of the standard curve across a large range of DNA quantities between 5,000,000 GE and 5 GE.
Figure 4.
Identification of Actinobacillus pleuropneumoniae targeting apxIV (APP‐HRM1) illustrating high sensitivity. APP‐HRM1 was performed with an A. pleuropneumoniae tenfold dilution series of genomic DNA (here as an example A. pleuropneumoniae serovar 15) using primers targeting apxIV. DNA quantities of the tenfold dilution series were 5,000,000 genome equivalents (GE) (red), 500,000 GE (orange), 50,000 GE (yellow), 5000 GE (green), 500 GE (light blue), 50 GE (blue), and 5 GE (violet). Representation of the 10‐fold dilution series as (a) qPCR amplification plot; (b) melting curves of the HRM step illustrating a limit of detection of 5 GE; (c) standard curve indicating linearity across a large range of DNA quantities between 5,000,000 GE and 5 GE with a high correlation coefficient (R 2 > 0.99). HRM, high resolution melting; qPCR, quantitative polymerase chain reaction
For APP‐HRM2 and APP‐HRM3 the linear range of standard curves was more variable in contrast to APP‐HRM1 due to the increased complexity of the master mixes containing up to 10 cps‐specific primer‐pairs. Obtained LODs within the relevant confidence level of 95% were 5 GE for A. pleuropneumoniae serovar 5b; 50 GE for A. pleuropneumoniae serovar 4, 5a, 10, and 16; 500 GE for A. pleuropneumoniae serovar 1, 2, 3, 7, 8, 9, 11, 14, 18, and 19; and 5000 GE for A. pleuropneumoniae serovar 6, 12, 13, 15, and 17, respectively. Standard curves had correlation coefficients of R 2 > 0.96 (Table 6).
Table 6.
Efficiency and limit of detection (LOD) of APP‐HRM1, APP‐HRM2, and APP‐HRM3 targeting apxIV, nadV, and serovar‐specific cps loci
| A. pleuropneumoniae serovar | Strain | APP‐HRM1 | APP‐HRM2, APP‐HRM3 | |||||
|---|---|---|---|---|---|---|---|---|
| LOD apxIV | LOD nadV | Efficiency (%) | R 2 | LOD cps | efficiency | R 2 | ||
| App serovar 1 | ATCC 27088 | 5 GE | 102 | 0.993 | 500 GE | 95% | 0.992 | |
| App serovar 2 | P1875 | 50 GE | 93 | 0.996 | 500 GE | 102% | 0.986 | |
| App serovar 3 | ORG1224 | 50 GE | 95 | 0.997 | 500 GE | 96% | 0.988 | |
| App serovar 4 | M62 | 50 GE | 99 | 0.999 | 50 GE | 98% | 0.994 | |
| App serovar 5a | K17 | 50 GE | 95 | 0.997 | 50 GE | 97% | 0.998 | |
| App serovar 5b | L20 | 50 GE | 97 | 0.993 | 5 GE | 96% | 0.999 | |
| App serovar 6 | femø | 50 GE | 96 | 0.996 | 5000 GE | 98% | 0.967 | |
| App serovar 7 | WF83 | 5 GE | 101 | 0.999 | 500 GE | 99% | 0.970 | |
| App serovar 8 | 405 | 5 GE | 98 | 0.998 | 500 GE | 93% | 0.988 | |
| App serovar 9 | CVJ 13261 | 5 GE | 101 | 0.998 | 500 GE | 96% | 0.977 | |
| App serovar 10 | D13039 | 5 GE | 98 | 0.999 | 50 GE | 97% | 0.996 | |
| App serovar 11 | 56153 | 50 GE | 103 | 0.995 | 500 GE | 102% | 0.974 | |
| App serovar 12 | 8329 | 50 GE | 98 | 0.996 | 5000 GE | 105% | 0.959 | |
| App serovar 13 | N 273 | 50 GE | 500 GE | 95 | 0.997 | 5000 GE | 94% | 0.991 |
| App serovar 14 | 3906 | 50 GE | 500 GE | 93 | 0.991 | 500 GE | 107% | 0.979 |
| App serovar 15 | HS143 | 5 GE | 98 | 0.999 | 5000 GE | 90% | 0.970 | |
| App serovar 16 | A‐85/14 | 5 GE | 98 | 0.994 | 50 GE | 101% | 0.994 | |
| App serovar 17 | 16287‐1 | 50 GE | 105 | 0.997 | 5000 GE | 108% | 0.973 | |
| App serovar 18 | 7311555 | 50 GE | 99 | 0.996 | 500 GE | 105% | 0.998 | |
| App serovar 19 | G1 9669 | 50 GE | 99 | 0.994 | 500 GE | 103% | 0.997 | |
Note: The LOD of APP‐HRM1 was between 5 and 50 genome equivalents (GE) corresponding to 12.5–125 fg of genomic DNA with PCR efficiencies of 93%–105%. LODs of APP‐HRM2 and APP‐HRM3 were between 5 and 5000 GE corresponding to 12.5 pg–12.5 fg genomic DNA with PCR efficiencies of 90%–108%.
Abbreviations: APP‐HRM, Actinobacillus pleuropneumoniae‐high resolution melting; LOD, limit of detection; PCR, polymerase chain reaction.
3.4. Efficiency
Using the equation mentioned in the methods, the efficiency values for each of the 19 A. pleuropneumoniae reference strains ranged between 93% and 105% for APP‐HRM1, whereas APP‐HRM2 and APP‐HRM3 revealed PCR efficiencies between 90% and 108% (Table 6, Figures A1 and A2).
3.5. Clinical isolates
Fifteen clinical isolates were analyzed with the novel HRM and the resulting Tms obtained from HRM assays APP‐HRM1, APP‐HRM2, and APP‐HRM3 were compared with T m of the 19 A. pleuropneumonia serovar reference strains. All 15 clinical isolates could be identified as A. pleuropneumoniae, whereas serovar 2 strains SS 4935 and SS 4936 additionally demonstrated the presence of nadV thus corresponding to biovar 2. With the two serotyping HRM assays APP‐HRM2 and APP‐HRM3, all samples could be unambiguously assigned to the correct serovar by considering uniquely the T m values (Figure 5).
Figure 5.
Representation of high resolution melting (HRM) results of DNA samples from 15 clinical Actinobacillus pleuropneumoniae isolates collected between 2014 and 2021 in Switzerland. (a) Illustration of HRM melting curves obtained with APP‐HRM2 and APP‐HRM3. (b) For each isolate, the corresponding amplicon melting temperatures (T m) obtained from APP‐HRM1, APP‐HRM2, and APP‐HRM3 are shown. aSerovar determination by multiplex polymerase chain reaction (Bossé et al., 2018; Stringer et al., 2021)
4. DISCUSSION
A. pleuropneumoniae infection is a worldwide problem in the pig industry (Sassu et al., 2018). Referring to the severity of symptoms caused by A. pleuropneumoniae and based on the assumption of a high A. pleuropneumoniae prevalence (>0.3), Stygar and coworkers calculated the additional yearly costs between €0.4 and 24 per space unit (Stygar et al., 2016). Due to the challenges of antibiotic usage and the generation of antibiotic resistance, the most promising approach to preventing A. pleuropneumoniae infection lies in vaccination (Cao et al., 2020; Michael et al., 2015). Current market‐leading vaccines are based on inactivated Apx toxins and outer membrane components of A. pleuropneumoniae or inactivated A. pleuropneumoniae of selected serovars (Del Pozo Sacristán et al., 2014; Sipos et al., 2021). Especially for a vaccine targeting certain prevalent serovars, a good diagnostic tool, for fast and reliable identification of A. pleuropneumoniae serovars predominant in affected farms and/or regions, might be beneficial for fighting and eradicating the pathogen.
In the present study, an efficient molecular tool for the identification and serotyping of A. pleuropneumoniae was developed, demonstrating a robust and accurate assay. The novel HRM assay consisting of the species‐specific APP‐HRM1 and two serovar‐specific HRM assays (APP‐HRM2 and APP‐HRM3) demonstrated the specificity of 100% for all 19 known A. pleuropneumoniae serovars. Exclusivity testing showed full A. pleuropneumoniae specificity as no signal was detected in 18 different bacterial strains. Using APP‐HRM1, A. pleuropneumoniae can be detected very sensitively between a detection limit of 5–50 GE corresponding to 125 fg–1.25 pg of DNA, representing a high sensitivity allowing to detect even low levels of A. pleuropneumoniae‐infected tissues. In contrast, the serotyping assays APP‐HRM2 andAPP‐HRM3 did not reach the same sensitivity as APP‐HRM1 due to a much more complex composition of the primer mixes with up to 10 primer pairs used in the two serotyping assays. Importantly, new serovars could be identified by observation of an apxIV‐positive signal using APP‐HRM1 detecting A. pleuropneumoniae at the species level in combination with no corresponding serovar‐specific melting curve in APP‐HRM2 and APP‐HRM3.
The primer pairs targeting serovar 9 and 11 can differentiate the serovars since the amplified PCR product encompasses a single‐nucleotide polymorphism (SNP) in cps 9/11F leading to slightly different T m of the corresponding PCR amplicons. Representation as a difference plot allows visualizing the slight difference in the melting curve. Due to missing clinical isolates representing these serovars, no validation using field isolates could be fulfilled. It is recommended in the future to test more isolates with serovar 9 and 11 of different origins for validation purposes and to prove the ability to robustly discriminate these closely related serovars.
When performing APP‐HRM1, PCR amplification of apxIV resulted in a melting curve with a T m of 71.8 ± 0.2 unambiguously identifying A. pleuropneumoniae, while the melting curve obtained by nadV specific primers yielded T m of 79.8 ± 0.2 determining biovar 2 isolates. Using APP‐HRM2 and APP‐HRM3, 13 A. pleuropneumoniae serovars (serovars 1, 4, 7, 8, 13, 16, 17, 18, and 19) could be determined explicitly inspecting the assigned T m listed in Tables 3, 4, 5. In contrast, serovar 3 and 14, serovar 9 and 11, and serovar 5 and 15 cannot explicitly be distinguished uniquely from the T m. Serovar 3 (T m = 75.7 ± 0.2) and serovar 14 (T m = 75.5 ± 0.1), serovar 9 (73.3 ± 0.1) and serovar 11 (73.4 ± 0.1), serovar 5 (T m = 74.5 ± 0.1) and serovar 15 (T m = 74.8 ± 0.2), respectively, harbor partly overlapping T m. Additionally, serovars 2 (T m = 77.6 ± 0.1) and 10 (T m = 77.3 ± 0.1) and similarly, serovars 6 (T m = 77.6 ± 0.1) and 12 (T m = 77.2 ± 0.1) have close T m values. Since this newly proposed HRM assay is based on the high resolution melting of PCR amplicons, which directly depends on its sequences, unique melting temperatures are expected for each serovar. It is a challenge to visualize the 19 different APP serovars in an HRM setting of only two reaction mixes. To unambiguously ensure the correct assignment of the serovar according to the Tm, it is recommended to perform the serotyping HRM assay (APP‐HRM2 and APP‐HRM3) using positive controls for each serovar.
Serovar prevalence differs from country to country. In England and Wales serovar 8 is most prevalent (Li et al., 2016), whereas serovar 7 plays an important role in Spain (Maldonado et al., 2009). Interestingly, several studies from central Europe reported clear dominance of serovar 2, as described in recent studies from Germany and Hungary (Sárközi et al., 2018; Schuwerk et al., 2021) and partially outdated ones from Belgium, Denmark, and the Netherlands (Dom et al., 1994; Jessing et al., 2003). Furthermore, in countries on other continents, such as Canada and Australia serovar 5, 7, and 15, respectively, were most frequently detected (Gottschalk & Lacouture, 2015; Turni et al., 2014). Serovar determination of 15 clinical A. pleuropneumoniae isolates collected between 2014 and 2021 in Switzerland revealed a quite heterogeneous serovar frequency with two to three isolates each of serovar 2, 3, 7, 13, 18, and 19. However, since a sample number of only 15 isolates is not representative, testing a larger strain collection in a future project would be necessary to determine the serovar prevalence and the accuracy of the HRM tool using clinical samples. It would be interesting to find out, whether one serovar is predominant, such as serovar 2 in neighboring countries, or if the serovar distribution of A. pleuropneumoniae in Switzerland is that heterogeneous.
To apply an HRM assay in the laboratory, a qPCR device capable of performing HRM is needed. Diverse brands of HRM‐compatible qPCR instruments exist in the market, which can be used for faster handling in comparison to conventional PCR. A closed one‐step system such as qPCR needs fewer manipulating steps in a shorter running time, in contrast to analyzing PCR products by agarose gel or capillary electrophoresis when working with conventional PCR. Therefore, the HRM method does not require any downstream processing of samples after qPCR thus increasing its efficiency, data is easy to access and interpret compared to the conventional methodology using band pattern recognition.
The development of the HRM assay represents a molecular tool, which allows screening for A. pleuropneumoniae. In an upcoming project, which aims at monitoring the continuance of A. pleuropneumoniae in Switzerland, further DNA samples directly isolated from lung and tonsillar tissue will be tested and validated systematically. Some preliminary experiments revealed the correct serovar assignment of diagnostic DNA samples of A. pleuropneumoniae positive animals, suggesting that clinical samples might be detected when performing the novel HRM assay.
5. CONCLUSION
From a monitoring perspective, as well as due to the different courses of disease associated with the various serovars, it is essential to differentiate the A. pleuropneumoniae serovars in different herds or countries. The developed species‐specific HRM assay (APP‐HRM1), as well as the two serotyping HRM assays distinguishing between all 19 serovars of A. pleuropneumoniae (APP‐HRM2 and APP‐HRM3), provide a useful diagnostic tool to discover virulent serovars. In the future, this newly proposed HRM assay may disclose the possibility for screening clinical samples and further evaluating the assay using a larger strain collection. Such a molecular tool can be applied in routine veterinary laboratories to get a rapid and precise overview of A. pleuropneumoniae strains presently circulating among pig farms.
Knowing the prevalent serovar, the right vaccines can be administered and pigs carrying virulent A. pleuropneumoniae strains can be prevented from being introduced into farms without any history of A. pleuropneumoniae‐related disease. Moreover, applying this HRM approach using the characteristic melting patterns of amplicons allows to potentially identify new A. pleuropneumoniae serovars in a straightforward and efficient way, thereby improving the presently available diagnostic tools.
CONFLICTS OF INTEREST
The authors declare no conflicts of interest.
ETHICS STATEMENT
None required.
AUTHOR CONTRIBUTIONS
Simone Scherrer: Conceptualization‐lead, investigation‐lead, writing original draft‐lead. Sophie Peterhans: Investigation‐supporting, methodology‐lead, writing original draft‐supporting. Christine Neupert: Investigation‐supporting, resources‐equal, writing‐review & editing‐supporting. Fenja Rademacher: Investigation‐supporting. Giody Bartolomei: Investigation‐supporting, writing‐review & editing‐supporting. Xaver Sidler: Resources‐equal, writing‐review & editing‐supporting. Roger Stephan: Project administration‐lead, writing‐review & editing‐supporting.
ACKNOWLEDGMENTS
We would like to thank all the members of the diagnostic lab of the Section of Veterinary Bacteriology, Vetsuisse Faculty, University of Zurich, for collecting the clinical field isolates. We thank Janine Bossé, László Fodor, Øystein Angen, and Vincent Perreten for kindly providing reference strains. The authors have not declared funding from any public or commercial agency.
1.
Figure A1.
Standard curves of 10‐fold dilution series acquired by the serovar‐specific APP‐HRM1 assay in the dynamic range of 5 × 106–5 genome equivalents for all reference Actinobacillus pleuropneumoniae strains are represented. PCR efficiencies between 93% and 103% with high correlation coefficients (R 2 > 0.99) were obtained. APP‐HRM, Actinobacillus pleuropneumoniae‐high resolution melting; PCR, polymerase chain reaction
Figure A2.
Standard curves of 10‐fold dilution series acquired by the serovar‐specific APP‐HRM2 and APP‐HRM3 assays in the range of linearity for all serovar reference strains of Actinobacillus pleuropneumoniae are represented. PCR efficiencies between 90% and 108% with correlation coefficients (R 2 > 0.96) were obtained. APP‐HRM, Actinobacillus pleuropneumoniae‐high resolution melting; PCR, polymerase chain reaction
Scherrer, S. , Peterhans, S. , Neupert, C. , Rademacher, F. , Bartolomei, G. , Sidler, X. , & Stephan, R. (2022). Development of a novel high resolution melting assay for identification and differentiation of all known 19 serovars of Actinobacillus pleuropneumoniae . MicrobiologyOpen, 11, e1272. 10.1002/mbo3.1272
DATA AVAILABILITY STATEMENT
All data are provided in this article except for the supplemental data, which are available in the Zenodo repository at https://doi.org/10.5281/zenodo.6045373 (Table S1: Inter‐ and intra‐assay variability of APP‐HRM1 and Table S2: Inter‐ and intra‐assay variability of APP‐HRM2 and APP‐HRM3).
REFERENCES
- Bossé, J. T. , Chaudhuri, R. R. , Li, Y. , Leanse, L. G. , Fernandez Crespo, R. , Coupland, P. , Holden, M. T. , Bazzolli, D. M. , Maskell, D. J. , Tucker, A. W. , Wren, B. W. , Rycroft, A. N. , & Langford, P. R. (2016). Complete genome sequence of MIDG2331, a genetically tractable serovar 8 clinical isolate of Actinobacillus pleuropneumoniae . Genome Announcements, 4(1), e01667‐15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bossé, J. T. , Li, Y. , Angen, Ø. , Weinert, L. A. , Chaudhuri, R. R. , Holden, M. T. , Williamson, S. M. , Maskell, D. J. , Tucker, A. W. , Wren, B. W. , Rycroft, A. N. , & Langford, P. R. (2014). Multiplex PCR assay for unequivocal differentiation of Actinobacillus pleuropneumoniae serovars 1 to 3, 5 to 8, 10, and 12. Journal of Clinical Microbiology, 52, 2380–2385. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bossé, J. T. , Li, Y. , Fernandez Crespo, R. , Lacouture, S. , Gottschalk, M. , Sárközi, R. , Fodor, L. , Casas Amoribieta, M. , Angen, Ø. , Nedbalcova, K. , Holden, M. T. G. , Maskell, D. J. , Tucker, A. W. , Wren, B. W. , Rycroft, A. N. , & Langford, P. R. (2018). Comparative sequence analysis of the capsular polysaccharide loci of Actinobacillus pleuropneumoniae serovars 1‐18, and development of two multiplex PCRs for comprehensive capsule typing. Veterinary Microbiology, 220, 83–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bossé, J. T. , Li, Y. , Sárközi, R. , Gottschalk, M. , Angen, Ø. , Nedbalcova, K. , Rycroft, A. N. , Fodor, L. , & Langford, P. R. (2017). A unique capsule locus in the newly designated Actinobacillus pleuropneumoniae serovar 16 and development of a diagnostic PCR assay. Journal of Clinical Microbiology, 55, 902–907. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cao, Y. , Gao, L. , Zhang, L. , Zhou, L. , Yang, J. , Deng, L. , Zhao, J. , Qi, C. , & Liu, J. (2020). Genome‐wide screening of lipoproteins in Actinobacillus pleuropneumoniae identifies three antigens that confer protection against virulent challenge. Scientific Reports, 10, 2343. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chiers, K. , De Waele, T. , Pasmans, F. , Ducatelle, R. , & Haesebrouck, F. (2010). Virulence factors of Actinobacillus pleuropneumoniae involved in colonization, persistence and induction of lesions in its porcine host. Veterinary Research, 41, 65. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Del Pozo Sacristán, R. , Michiels, A. , Martens, M. , Haesebrouck, F. , & Maes, D. (2014). Efficacy of vaccination against Actinobacillus pleuropneumoniae in two Belgian farrow‐to‐finish pig herds with a history of chronic pleurisy. Veterinary Record, 174, 302. [DOI] [PubMed] [Google Scholar]
- Dom, P. , Hommez, J. , Castryck, F. , Devriese, L. A. , & Haesebrouck, F. (1994). Serotyping and quantitative determination of in vitro antibiotic susceptibility of Actinobacillus pleuropneumoniae strains isolated in Belgium (July 1991‐August 1992). Veterinary Q, 16, 10–13. [DOI] [PubMed] [Google Scholar]
- Foote, S. J. , Bossé, J. T. , Bouevitch, A. B. , Langford, P. R. , Young, N. M. , & Nash, J. H. (2008). The complete genome sequence of Actinobacillus pleuropneumoniae L20 (serotype 5b). Journal of Bacteriology, 190, 1495–1496. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Frey, J. (1995). Virulence in Actinobacillus pleuropneumoniae and RTX toxins. Trends in Microbiology, 3, 257–261. [DOI] [PubMed] [Google Scholar]
- Gottschalk, M. (2012). Actinobacillosis. In Karriker A., Ramirez K., Stevenson G., & Zimmermann J. (Eds.), Diseases of swine (pp. 653–669). John Wiley & Sons, Inc. [Google Scholar]
- Gottschalk, M. (2015). The challenge of detecting herds sub‐clinically infected with Actinobacillus pleuropneumoniae . Veterinary Journal, 206, 30–38. [DOI] [PubMed] [Google Scholar]
- Gottschalk, M. , & Broes, A. (2019). Actinobacillosis. In Zimmerman J. J., Karriker L. A., Ramirez A., Schwartz K. J., Stevenson G. W., & Zhang J. (Eds.), Diseases of swine (pp. 749–766). John Wiley & Sons, Inc. [Google Scholar]
- Gottschalk, M. , & Lacouture, S. (2015). Canada: Distribution of Streptococcus suis (from 2012 to 2014) and Actinobacillus pleuropneumoniae (from 2011 to 2014) serotypes isolated from diseased pigs. Canadian Veterinary Journal, 56, 1093–1094. [PMC free article] [PubMed] [Google Scholar]
- Jessing, S. G. , Angen, Ø. , & Inzana, T. J. (2003). Evaluation of a multiplex PCR test for simultaneous identification and serotyping of Actinobacillus pleuropneumoniae serotypes 2, 5, and 6. Journal of Clinical Microbiology, 41, 4095–4100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li, Y. , Bossé, J. T. , Williamson, S. M. , Maskell, D. J. , Tucker, A. W. , Wren, B. W. , Rycroft, A. N. , & Langford, P. R. (2016). Actinobacillus pleuropneumoniae serovar 8 predominates in England and Wales. Veterinary Record, 179, 276. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maldonado, J. , Valls, L. , Martínez, E. , & Riera, P. (2009). Isolation rates, serovars, and toxin genotypes of nicotinamide adenine dinucleotide‐independent Actinobacillus pleuropneumoniae among pigs suffering from pleuropneumonia in Spain. Journal of Veterinary Diagnostic Investigation, 21, 854–857. [DOI] [PubMed] [Google Scholar]
- Michael, G. B. , Freitag, C. , Wendlandt, S. , Eidam, C. , Feßler, A. T. , Lopes, G. V. , Kadlec, K. , & Schwarz, S. (2015). Emerging issues in antimicrobial resistance of bacteria from food‐producing animals. Future Microbiology, 10, 427–443. [DOI] [PubMed] [Google Scholar]
- Mittal, K. R. (1990). Cross‐reactions between Actinobacillus (Haemophilus) pleuropneumoniae strains of serotypes 1 and 9. Journal of Clinical Microbiology, 28, 535–539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mittal, K. R. , & Bourdon, S. (1991). Cross‐reactivity and antigenic heterogeneity among Actinobacillus pleuropneumoniae strains of serotypes 4 and 7. Journal of Clinical Microbiology, 29, 1344–1347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mittal, K. R. , Higgins, R. , & Larivière, S. (1988). Serological studies of Actinobacillus (Haemophilus) pleuropneumoniae strains of serotype 6 and their antigenic relationship with other serotypes. Veterinary Record, 122, 199–203. [DOI] [PubMed] [Google Scholar]
- Peterhans, S. , Stevens, M. J. A. , Cernela, N. , Sidler, X. , Stephan, R. , & Scherrer, S. (2021). Draft genome sequences of two clinical Actinobacillus pleuropneumoniae serotype 19 strains from pigs in Switzerland. Microbiology Resource Announcements, 10, e0058821. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pohl, S. , Bertschinger, H. U. , Frederiksen, W. , & Mannheim, W. (1983). Transfer of Haemophilus pleuropneumoniae and the Pasteurella haemolytica‐like organism causing porcine necrotic pleuropneumonia to the genus Actinobacillus (Actinobacillus pleuropneumoniae comb. nov.) on the basis of phenotypic and deoxyribonucleic acid relatedness. International Journal of Systematic and Evolutionary Microbiology, 33, 510–514. [Google Scholar]
- Sárközi, R. , Makrai, L. , & Fodor, L. (2018). Actinobacillus pleuropneumoniae serotypes in Hungary. Acta Veterinaria Hungarica, 66, 343–349. [DOI] [PubMed] [Google Scholar]
- Sassu, E. L. , Bossé, J. T. , Tobias, T. J. , Gottschalk, M. , Langford, P. R. , & Hennig‐Pauka, I. (2018). Update on Actinobacillus pleuropneumoniae‐knowledge, gaps and challenges. Transboundary and Emerging Diseases, 65(Suppl 1), 72–90. [DOI] [PubMed] [Google Scholar]
- Schaller, A. , Kuhn, R. , Kuhnert, P. , Nicolet, J. , Anderson, T. J. , Maclnnes, J. I. , Segers, R. , & Frey, J. (1999). Characterization of apxIVA, a new RTX determinant of Actinobacillus pleuropneumoniae . Microbiology, 145, 2105–2116. [DOI] [PubMed] [Google Scholar]
- Schuwerk, L. , Hoeltig, D. , Waldmann, K. H. , Valentin‐Weigand, P. , & Rohde, J. (2021). Sero‐ and apx‐typing of German Actinobacillus pleuropneumoniae field isolates from 2010 to 2019 reveals a predominance of serovar 2 with regular apx‐profile. Veterinary Research, 52, 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sipos, W. , Cvjetković, V. , Dobrokes, B. , & Sipos, S. (2021). Evaluation of the efficacy of a vaccination program against Actinobacillus pleuropneumoniae based on lung‐scoring at slaughter. Animals (Basel), 11, 2778. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stringer, O. W. , Bossé, J. T. , Lacouture, S. , Gottschalk, M. , Fodor, L. , Angen, Ø. , Velazquez, E. , Penny, P. , Lei, L. , Langford, P. R. , & Li, Y. (2021). Proposal of Actinobacillus pleuropneumoniae serovar 19, and reformulation of previous multiplex PCRs for capsule‐specific typing of all known serovars. Veterinary Microbiology, 255, 109021. [DOI] [PubMed] [Google Scholar]
- Stygar, A. H. , Niemi, J. K. , Oliviero, C. , Laurila, T. , & Heinonen, M. (2016). Economic value of mitigating Actinobacillus pleuropneumoniae infections in pig fattening herds. Agricultural Systems, 144, 113–121. [Google Scholar]
- Turni, C. , Singh, R. , Schembri, M. A. , & Blackall, P. J. (2014). Evaluation of a multiplex PCR to identify and serotype Actinobacillus pleuropneumoniae serovars 1, 5, 7, 12 and 15. Letters in Applied Microbiology, 59, 362–369. [DOI] [PubMed] [Google Scholar]
- Vossen, R. H. , Aten, E. , Roos, A. , & den Dunnen, J. T. (2009). High‐resolution melting analysis (HRMA): More than just sequence variant screening. Human Mutation, 30, 860–866. [DOI] [PubMed] [Google Scholar]
- Xu, Z. , Chen, X. , Li, L. , Li, T. , Wang, S. , Chen, H. , & Zhou, R. (2010). Comparative genomic characterization of Actinobacillus pleuropneumoniae . Journal of Bacteriology, 192, 5625–5636. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhan, B. , Angen, Ø. , Hedegaard, J. , Bendixen, C. , & Panitz, F. (2010). Draft genome sequences of Actinobacillus pleuropneumoniae serotypes 2 and 6. Journal of Bacteriology, 192, 5846–5847. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data are provided in this article except for the supplemental data, which are available in the Zenodo repository at https://doi.org/10.5281/zenodo.6045373 (Table S1: Inter‐ and intra‐assay variability of APP‐HRM1 and Table S2: Inter‐ and intra‐assay variability of APP‐HRM2 and APP‐HRM3).