Skip to main content
ZooKeys logoLink to ZooKeys
. 2022 Mar 9;1088:99–114. doi: 10.3897/zookeys.1088.69141

New psychropotid species (Echinodermata, Holothuroidea, Elasipodida) of the Western Pacific with phylogenetic analyses

Chuan Yu 1,2, Dongsheng Zhang 1,2,3, Ruiyan Zhang 1, Chunsheng Wang 1,2,3,4,
PMCID: PMC8927086  PMID: 35437371

Abstract

Holothurians of the family Psychropotidae are widely distributed but remain the least studied deep-sea holothurians. On an expedition to the Western Pacific, six psychropotid specimens were collected by the Jiaolong Human Operated Vehicle (HOV). Through morphological examination, four of them were identified as a new species, Benthodytesjiaolongisp. nov., which was characterized as having minute papillae, a narrow brim, and a terminal anus; and the ossicles were rods and primary crosses. The remaining two specimens were identified as Psychropotesverrucicaudatus Xiao, Gong, Kou & Li, 2019, first recorded at the Kyushu-Palau Ridge. The phylogenetic analysis showed that B.jiaolongisp. nov. and P.verrucicaudatus were embedded in the clades Benthodytes and Psycheotrephes, respectively, and that Benthodytes was paraphyletic. The new species clustered with Benthodytessanguinolenta and was separated from the clade containing the other Benthodytes species.

Keywords: Benthodytes , deep-sea, holothurians, Psychropotes , taxonomy

Introduction

Holothurians of the family Psychropotidae (Elasipodida) were first identified by Théel (1882) who defined four genera of deep-sea sea cucumbers discovered on the H.M.S. Challenger Expedition. Subsequently, Hérouard (1909) and Belyaev and Vinogradov (1969) erected Triconus Hérouard and Nectothuria Belyaev & Vinogradov, which were later regarded as synonyms of Psychropotes by Hansen (1975). Meanwhile, Euphronides Théel, 1882 was also accepted as a synonym of Psychropotes. Psychropotidae comprises three genera and 37 species. Hansen (1975) distinguished the three genera by the presence or absence of an unpaired dorsal appendage, the position of the anus, and the presence or absence of circum-oral (or post-oral) papillae. Although, taxonomists have long worked on this family, Psychropotidae are still the least studied deep-sea holothurians. Thus, the phylogenetic relationships within Psychropotidae remain unclear.

An expedition of the Jiaolong Human Operated Vehicle (HOV) concentrated on further increasing our understanding of the biodiversity, connectivity, and conservation value of the Western Pacific. During sampling, six specimens of Psychropotidae were collected from seamounts on the Kyushu-Palau Ridge and Weijia Guyot (Fig. 1). Based on an analysis of the external morphological characters and ossicles, we identified four specimens as a new species (Benthodytesjiaolongi sp. nov.) and the other two as new records of Psychropotesverrucicaudatus Xiao, Gong, Kou & Li, 2019.

Figure 1.

Figure 1.

Red dots show the location of Benthodytesjiaolongi sp. nov. and green dots indicate the location of Psychropotesverrucicaudatus Xiao, Gong, Kou & Li, 2019.

Materials and methods

Sampling and morphological observations

The samples described in the present study were collected by the Jiaolong HOV at a depth of 2408–2602 m, from the Kyushu-Palau Ridge and Weijia Guyot. Before preservation, a Canon EOS 5DII camera (Canon Inc., Tokyo, Japan) was used to take photographs of the specimens on board the ship. Then, a piece of dorsal tissue was cut from all specimens and frozen at -20 °C for DNA extraction. Finally, the specimens were fixed in 10% seawater formalin or 99% alcohol and deposited at the Repository of Second Institute of Oceanography (RSIO). Sodium hypochlorite was used to dissolve body tissues (tentacles, dorsum, ventrum, brim, dorsal warts and gonads), and ossicles present in these tissues were rinsed five times with purified water. The ossicles were observed using a scanning electron microscope (TM 1000; Hitachi, Ltd., Tokyo, Japan).

PCR amplification and phylogenetic analysis

Total genomic DNA was extracted from 100 mg of muscle tissue using a DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. Two partial mitochondrial genes, 16S rRNA and cytochrome oxidase subunit 1 (COI), were amplified using primers 16S-arL/brH and COI-ef/er (Miller et al. 2017). The PCR reactions were performed using a 50-µL reagent mix, containing 25 μL 2× Phanta Max Master Mix (Vazyme, Biotech Co., Ltd., Nanjing, China), 20-μL DNase free ddH2O, 2-μL of each primer, and 1-μL template DNA, as suggested by the manufacturer. The PCR amplification procedure is shown in Table 1. PCR products were confirmed by 1.5% agarose gel electrophoresis and purified using an OMEGA PCR kit (Omega, Biotek, Norcross). The purified PCR products were sequenced on an ABI 3730XL sequencer (Sangon, Biotech Co., Ltd., Shanghai). Sequence data were edited with Geneious R6.1.6 (Matthew et al. 2012) and deposited in GenBank (Table 2).

Table 1.

PCR amplification procedures.

Primer Sequence 5′→ 3' PCR procedure
COI-ef ATAATGATAGGAGGRTTTGG Pre denaturation: 95 °C for 3 min
COI-er GCTCGTGTRTCTACRTCCAT 40 cycles:
Denaturation: 95 °C for 40 s
Annealing: 45 °C for 40 s
Extension: 72 °C for 50 s
16S-arL CGCCGTTTATCAAAAACAT Pre denaturation:95 °C for 3 min
16S-brH CCGGTCTGAACTCAGATCACG 35 cycles:
Denaturation: 95 °C for 40 s
Annealing: 50 °C for 40 s
Extension: 68 °C for 50 s

Table 2.

Details of specimens and GenBank accession numbers in this study.

Family Species GenBank accession number
16S COI
Psychropotidae Théel, 1882 Benthodytesmanusensis Xiao, Li & Sha, 2018 MH627223.1 MH627222.1
Benthodytessanguinolenta Théel, 1882 HM196507.1
Benthodytesmarianensis Li, Xiao, Zhang & Zhang, 2018 MH049433.1 MH049435.1
Benthodytesjiaolongi sp. nov. MW992746 MW990356
Benthodytesjiaolongi sp. nov. MW992747 MW990357
Psycheotrephesexigua Théel, 1882 KX874392.1
Psychropoteslongicauda Théel, 1882 DQ777099.1 KU987469.1
Psychropotesmoskalevi Gebruk & Kremenetskaia in Gebruk et al., 2020 MN310400.1 MN313655.1
Psychropotesraripes Ludwig, 1893 MN310403.1 MN313656.1
Psychropotesverrucicaudatus Xiao, Gong, Kou & Li, 2019 MW992749 MW980089
Psychropotesverrucicaudatus Xiao, Gong, Kou & Li, 2019 MW992748 MW980088
Elpidiidae Théel, 1882 Peniagonediaphana Théel, 1882 KX856725.1 KX874384.1
Peniagoneincerta Théel, 1882 HM196402.1
Peniagone sp. AKM-2016 KX856726.1 KX874385.1
Peniagonevignoni Hérouard, 1901 HM196381.1
Elpidiaglacialis Théel, 1876 HM196413.1
Amperimarobusta Théel, 1882 KX856728.1 KX874381.1
Protelpidiamurrayi Théel, 1879 KX856727.1 KX874382.1
Scotoplanes sp.TT-2017 LC230158.1
Laetmogoidae Ekman, 1926 Laetmogonewyvillethomsoni Théel, 1879 HM196504.1
Pannychiamoseleyi Théel, 1882 KX856731.1 KX874380.1
Benthogoneabstrusa Sluiter, 1901 KX856733.1 KX874374.1
Enypniasteseximia Théel, 1882
Pelagothuriide Ludwig, 1893 KX856730.1 KX874383.1
Stichopodidae Haeckel, 1896 Apostichopuscalifornicus Stimpson, 1857 KP398509.1 KP398509.1
Apostichopusparvimensis H.L. Clark, 1913 KX856750.1 KX874373.1

For a more comprehensive phylogenetic analysis, we not only used the sequences of Psychropotidae obtained here, but also used mitochondrial sequences of Elpidiidae Théel, 1882 and two species of Stichopodidae Haeckel, 1886, an outgroup (Table 2). Twenty-five COI and 18 16S sequences were aligned using MAFFT 7 (Katoh and Standley 2013) using the E-INS-I strategy. Alignment gaps and missing data were represented as ‘-’ and ‘?’. The 16S and COI alignments were concatenated (COI/16S = 687/578 bp), analyzed with Maximum likelihood (ML) and Bayesian inference (BI) algorithms. JModelTest 2.1.10 (Darriba et al. 2012) was used to find the best-fit model from 88 competing models using Akaike information criterion (AIC) calculations. In each case, GTR+I+G was the best-fit model for BI analyses. MrBayes 3.2 (Huelsenbeck and Ronquist 2001) was used to conduct BI analyses. Markov Chain Monte Carlo (MCMC) iterations were run for 1 000 000 generations with sampling every 100 generations. The first 25% of trees were discarded as burn-in, and the consensus trees were summarized in 75% majority-rule trees. RAxML GUI 1.5 (Silvestro and Michalak 2012; Stamatakis 2014) was used to perform the ML analysis with the GTR+GAMMA+I substitution model for 1000 bootstraps, as recommended by Miller et al. (2017).

Results and discussion

Order Elasipodida Théel, 1882

Suborder Psychropotina Hansen, 1975

Family Psychropotidae Théel, 1882

Genus. Benthodytes

Théel, 1882

6628A0F2-FF02-5656-8D47-9090EAD15C4A

Diagnosis

(according to Hansen 1975). Anus dorsal. Unpaired dorsal appendages absent. Circum-oral (or post-oral) papillae present. Tentacles soft, pliable, and retractile.

. Benthodytes jiaolongi sp. nov.

4C5D41F2-E001-5F16-9CC4-C7BD5818D277

http://zoobank.org/85760628-2F68-4800-B9DA-694C8BF167A2

Figs 2 , 3 , 4

Figure 2.

Figure 2.

A, BBenthodytesjiaolongi sp. nov. (RSIO3710601, holotype) in situ on the seamount Weijia Guyot C specimen (RSIO6017101, paratype) in situ on the Kyushu-Palau Ridge D specimen (paratype) before preservation in 10% seawater formalin.

Figure 3.

Figure 3.

Benthodytesjiaolongi sp. nov. A dorsal view B ventral view.

Figure 4.

Figure 4.

A–C scanning electron micrographs of dorsal body wall ossicles from Benthodytesjiaolongi sp. nov., RSIO590506 D–F dorsal body wall ossicles from Benthodytesjiaolongi sp. nov., RSIO6017101 G–J ossicles of tentacles.

Type material examined.

Holotype: RSIO6017101, adult specimen, collection number: DY60-JL171-B01, 16.935°N, 134.911°E,12 January 2021, 2602 m; Paratype: RSIO3710601, adult specimen, collection number: DY37-JL106-B01, 13.017°N, 156.947°E, 1 May 2016, 2408 m.

Non-type material examined.

RSIO590504, adult specimen, collection number: DY59-ROV05-B04, 16.916°N, 134.916°E, 20 July 2020, 2692 m; RSIO590506, adult specimen, collection number: DY59-ROV05-B06, 16.933°N, 134.916°E, 20 July 2020, 2453 m.

Diagnosis.

Body elongated and subcylindrical when fixed. Skin red with violet, thin, soft. No obvious large papillae arranged on dorsal surface. Some minute papillae, conical with tips, on the anterior dorsum. Brim narrow, thin, flattened. Mouth ventral, anus terminal. Eighteen tentacles; circum-oral papillae present. Dorsal ossicles include rods and primary crosses with four arms. Rods present in tentacles. Ossicles of ventrum not observed.

Description of holotype.

(RSIO6017101). Length was approximately 25 cm before preservation in 10% seawater formalin. Color violet in life (Fig. 2C); skin transparent, thin, soft, and gelatinous after fixing. Brim retracted less than 0.7 cm in width. Approximately nineteen pairs of dorsal papillae poorly developed, minute, closely placed in two bands along anterior dorsal radii. Another four single minute papillae on posterior dorsal edge. Approximately 28 pairs midventral tube feet arranged in two rows. Mouth ventral, with circum-oral papillae. Anus terminal, unguarded. Due to the contraction, tentacles could not be clearly observed. Few ossicles observed. Dorsal ossicles in the anterior body wall, consisting of primary crosses with spiny arms, and spinous rods (Fig. 4A–F). Rods approximately 400 μm long, arms of crosses approximately 200 μm long. Tentacles with rods, 400–500 μm long (Fig. 4G–J). Other body parts devoid of ossicles.

Description of paratypes.

RSIO3710601. Specimen approximately 22 cm in length, 5 cm wide at maximum point. Color red-violet in situ at the seabed (Fig. 2A, B); pale violet at sea surface, with transparent skin; white color after preservation in 10% seawater formalin for 5 years. Paired dorsal papillae as present in holotype absent, minute papillae also not distinguished. Owing to long-term preservation, quantity of midventral tube feet could not be determined, but were arranged in two rows. Brim could not be distinguished. Mouth ventral, with circum-oral papillae, anus terminal. Eighteen tentacles retracted to stalk. Ossicles not observed.

RSIO590504.Specimen approximately 22 cm in length before preservation in 10% seawater formalin. Color red-violet on deck, skin transparent; white color after preservation. During sampling, a piece of sponge was stuck in the ROV pump sampler, and the specimen was damaged by the sponge, meaning that the tentacles could not be determined and the dorsal tips could not be distinguished. Quantity of midventral tube feet could not be determined. Mouth ventral, anus terminal. Ossicles not observed.

RSIO590506. Specimen approximately 13 cm in length before preservation in 99% alcohol and heavily damaged. Color red-violet at sea surface, skin transparent. The specimen was stained with sponge as was RSIO590504 and many external characters could not be distinguished. Mouth ventral, anus terminal. Few rods observed on dorsal region (Fig. 4A-C). Rods approximately 400 μm, spine terminal. Ossicles from body wall not observed.

Etymology.

The name is derived from the first Chinese HOV ‘Jiaolong’.

Type species.

Benthodytestypica Théel, 1882 (by original designation).

Type locality.

Kyushu-Palau Ridge, tropical Western Pacific. Depth: 2453–2692 m.

Distribution.

Known from Weijia Guyot and Kyushu-Palau Ridge.

Remarks.

Hansen (1975) revised the genus Benthodytes and proposed that this genus, except Benthodytessuperba Koehler & Vaney, 1905, could be divided into two distinct groups based on the ossicles and external morphology.

The first group was characterized by the regular crosses, ossicles with bipartite central apophysis and well-developed dorsal papillae. This group included five species: B.incerta Ludwig, 1894; B.lingua Perrier, 1896; B.valdiviae Hansen, 1975; B.sibogae Sluiter, 1901a and B.plana Hansen, 1975. Benthodytessanguinolenta Théel, 1882 and B.typica Théel, 1882 formed the second group characterized by strongly reduced rod ossicles, and minute dorsal papillae.

Recently, five more species were identified: B.gosarsi Gebruk, 2008; B.wolffi Rogacheva & Cross in Rogacheva et al. 2009; B.violeta Martinez, SolísMarín & Penchaszadeh, 2014; B.manusensisXiao et al., 2018; B.marianensisLi et al., 2018. They can be assigned to first group.

Benthodytesjiaolongi sp. nov. clearly belongs in the genus Benthodytes and is close to Benthodytessanguinolenta Théel, 1882 and Benthodytestypica Théel, 1882, for the minute papillae and reduced rod ossicles.

Benthodytestypica was described by Théel in 1882 based on specimens collected by the Challenger Expedition. The original description indicated approximately eight, minute, retractile processes located on each of the dorsal ambulacra and unbranched spinose calcareous spicula scattered on the integument. Hansen (1975) re-examined B.typica and reported that the specimens showed considerable variation. Benthodytespapillifera Théel, 1882 was described based on 13 specimens taken from three Pacific Challenger stations. Théel (1882) described this species as being similar to B.sanguinolenta based on the tentacles and tube feet. Hansen (1975) re-examined specimens from each of the stations and proposed that the variation in B.papillifera represented the geographic variation of B.typica. In the original description of Benthodytesglutinosa Perrier, 1896, Perrier (1896) indicated that the differences from B.typica were the more elongated shape and the complete absence of dorsal papillae. Hansen (1975) considered this species to be a synonym of B.typica.

In general, the morphological features of B.typica can be summarized as follows: 3–7 pairs of minute papillae arranged on the dorsal surface and rods scattered on the body integument and tentacles. Benthodytesjiaolongi sp. nov. differs from B.typica in its arrangement and number of dorsal papillae and composition of ossicles. The dorsal minute papillae of Benthodytesjiaolongi sp. nov. are arranged in two bands along the anterior dorsal ambulacra, and those of B.typica are arranged in a row with 3–7 pairs of papillae. The rods of B.jiaolongi sp. nov. are present in the tentacles and dorsum, and the primary crosses are only present in the dorsum. However, B.typica only present rods scattered on the ventrum, dorsum and tentacles.

The characteristics of B.sanguinolenta as described by Théel (1882) included the many minute retractile processes scattered on the dorsal surface; the form of calcareous deposits could not be distinguished. According to a re-examination by Hansen (1975), the dorsal minute papillae were arranged in two radial bands and the rods were only present on the midventral tube feet and tentacle discs of specimens from station 663. Rogacheva et al. (2009) recorded B.sanguinolenta and the main characteristics can be described as: minute dorsal papillae arranged in two bands or between the two bands; approximately 1–4 papillae placed in a band, narrowing to one or two papillae at the posterior end; ossicles were not found. The differences in the characteristics between the new species B.jiaolongi sp. nov. and B.sanguinolenta can be listed as follows: (1) Dorsal papillae of B.sanguinolenta are arranged in two bands, whereas those of the new species were arranged in two rows on the anterior dorsal ambulacra; (2) Ossicles of the new species were only present in the tentacles and in the dorsum. Rods are present in the tentacles and dorsum, and primary crosses are only present in the dorsum; whereas the rods are only present in tube feet and in the tentacles in B.sanguinolenta.

Genus Psychropotes Théel, 1882

. Psychropotes verrucicaudatus

Xiao, Gong, Kou & Li, 2019

9A0938C7-C0E0-516A-9DC5-0B63FDEF6F3D

Figs 5 , 6 , 7

Figure 5.

Figure 5.

A, BPsychropotesverrucicaudatus Xiao, Gong, Kou & Li, 2019 (RSIO6018004) in situ C, D specimen (RSIO6018004) before preservation E, F red arrows point to the giant ossicles, specimen (RSIO6018004) after preservation in 10% seawater formalin. Scale bars: 5 cm (A–E); 1 cm (F).

Figure 6.

Figure 6.

PsychropotesverrucicaudatusA–D giant ossicles from the dorsal warts.

Figure 7.

Figure 7.

Psychropotesverrucicaudatus ossicle from A–C ventral body wall D–G dorsal body wall H–K brim L–R tentacle.

  • Psychropotes verrucicaudatus Xiao, Gong, Kou & Li, 2019: 421–430.

Material examined.

Catalog number: RSIO6018004, adult specimen, collection number: DY60-JL180-B04, 13.569°N, 134.352°E, 25 January 2021, 2469 m; Catalog number: RSIO6017005, adult specimen, collection number: DY60-JL170-B05, 12.079°N, 134.860°E, 8 January 2021, 2361 m.

Description.

RSIO6018004. Specimen resembles a barbell after collection, approximately 20 cm in length before preservation 10% seawater formalin (Fig. 5C, D). Before preservation, height of appendage was approximately 50 mm, and width at base approximately 30 mm (Fig. 5C, D). Dorsal skin transparent with brownish red color on seabed and dark brown on deck. Warts covering dorsal skin and appendage; giant ossicles in warts visible (Fig. 5E, F). Approximately 30 pairs of degenerated tube feet arranged in two rows along middle of ventrum. Sixteen tentacles forming a circle. Brim broad and covered with warts on dorsum.

A giant cross with four arms visible in each wart. Arms 800–1000 μm in length, and maximum width between large arms approximately 500 μm. Arm flexion approximately 250 / 400 μm (Fig. 6A–D). Height of central rudimentary apophyses approximately 200–300 μm. Ventral ossicles divided into two types: primary cross with spiny arms (Fig. 8A, C) and cross with three arms (Fig. 7B), length of arm approximately 200 μm. Primary crosses with spinous arms in dorsum (Fig. 7D–F) and brim (Fig. 7H–J); arms up to 200 μm in length. Dorsal ossicles with spinous rod, 170 μm in length (Fig. 7G), and large primary crosses with spiny arms in brim (Fig. 7K). Tentacles with rods with irregular shape (Fig. 7L–R). Large rod with two apophyses at the end, approximately 900–1000 μm in length (Fig. 7L-M); small rod with apophyses in middle area was approximately 200 μm in length (Fig. 7N). Other rods with spiny arms, 500–800 μm in length (Fig. 7O-R).

Figure 8.

Figure 8.

Bayesian inference (BI) and maximum likelihood (ML) trees based on the concatenated sequences. The Bayesian posterior probabilities (BI) and Maximum likelihood bootstrap (BS) values are shown as BI/ML at each node. Scale bar indicates the evolutionary branch length.

RSIO6017005. Specimen approximately 18 cm in length, height of appendage approximately 40 mm, and width at base approximately 20 mm. Mouth and anus ventral. Skin transparent, light brown color. Dorsal skin and appendage covered with warts; warts also present in dorsum of brim. Giant ossicles visible in warts. Tentacles damaged, more than 12. Ossicles as in RSIO6018004.

Type locality.

Jiaolong Seamount, South China Sea, Western Pacific Ocean, sandy bottom, depth 3615 m.

Type species.

Psychropoteslongicauda Théel, 1882.

Distribution.

Known from Jiaolong Seamount of South China Sea and Kyushu-Palau Ridge.

Intraspecific variation.

The specimens were clearly a new record for the South China Sea, as the species was previously known only from the Jiaolong seamount. The present specimens differed from those of Xiao et al. (2019) in external morphology and the ossicles. Due to the bad preservation, Xiao et al. (2019) could not observe the ossicle assemblage of the warts, which was possible in the specimens here under study.

The intraspecific differences can be listed as follows: (1) In the present specimens, the skin was transparent and the color was darker than that of the type specimen; (2) The width of the appendage at the base was also larger than that of the type specimen; (3) The length of the primary crossing arms distributed in the dorsum, ventrum, and brim was longer than that of the type specimen. Furthermore, the spinous rod of the dorsal ossicles was not present in the type specimen, and the ventral body wall of the specimens did not possess the tripartite ossicles of the type specimens; and (4) Most of the ossicles of the tentacles in our specimens were the same as those of type specimen, but longer.

Phylogenetic analyses

Owing to limited genetic sequences, the phylogenetic relationships of Elasipodida remains little studied. The new classification system of Elasipodida was constructed by Miller et al. (2017), whereby Deimatidae was separated from Elasipodida. The remaining families of Elasipodida included Elpidiidae, Laetmogonidae, Pelagothuriidae, and Psychropotidae, but their positions within Elasipodida remained unresolved. Li et al. (2018) used mitochondrial and nuclear genes to perform phylogenetic analyses of Elasipodida, especially the Psychropotidae, and the results showed that Benthodytes was a paraphyletic group of Psychropotidae based on analyses of the mitochondrial genes.

To obtain clearer phylogenetic relationships, we concatenated 25 COI and 18 16S sequences into a dataset to build ML and BI trees. Although the genetic sequences were limited, the topological structures of the ML and BI trees were mostly consistent with morphological classification. In addition, B.jiaolongi sp. nov. and P.verrucicaudatus were embedded in the clades of Benthodytes and Psycheotrephes, respectively (Fig. 8). The phylogenetic relationships of Psychropotidae clustered into four parts and were inconsistent with the traditional classification system (Hansen 1975). Benthodytes was divided into two clades in Psychropotidae and the new species was clustered with the clade of B.sanguinolenta. In addition, Psychropotes was a sister group to Psycheotrephes, and the clade of B.jiaolongi sp. nov. and B.sanguinolenta was a sister group to other Psychropotidae species. Psychropotesverrucicaudatus was not recovered in the clades of Psychropotes, but was clustered in the clade of Psycheotrephesexigua Théel, 1882, which meant that P.verrucicaudatus might belong to Psychrotrephes. Elpidiidae clustered into two clades: (1) Penigone clustered together into a supported group, but Peniagonediaphana Théel, 1882 was a sister group to other Peniagone species; (2) The other four genera of Elpidiidae clustered into a group, and Elpidiaglacialis Théel, 1876 was distant from the other three genera. Protelpidiamurrayi Théel, 1879 and Scotoplanes sp. TT 2017 were sister taxa, and Amperimarobusta Théel, 1882 was sister to these genera.

Laetmogonidae was an obvious polyphyletic group, and Pannychiamoseleyi Théel, 1882 was placed in the outmost clade of the other three families. Laetmogonewyvillethomsoni Théel, 1879 clustered with Elpidiidae and was sister to this clade; Benthogoneabstrusa Sluiter, 1901 was clustered with Enypniasteseximia Sluiter, 1901, but the Bayesian posterior probabilities and bootstrap values of this clade were low.

Based on the morphological and phylogenetic analyses, B.jiaolongi sp. nov. can be identified as a new species closely related to B.sanguinolenta. In addition, our specimens provided a new record of P.verrucicaudatus in the Western Pacific, broadening its distribution. Our results support the hypothesis that Benthodytes is paraphyletic and that the clade of B.sanguinolenta and B.jiaolongi sp. nov. is separated from the other species of Benthodytes.

Supplementary Material

XML Treatment for Benthodytes
XML Treatment for Benthodytes jiaolongi
XML Treatment for Psychropotes verrucicaudatus

Acknowledgements

We are grateful to all the scientists and crew on the R/V “Shen Hai Yi Hao” and “Xiang yang hong 9”, and the Jiaolong HOV team for help in the collection of the deep-sea specimens. We also thank Dr Lu Bo for helping process the specimens on board. We would like to thank Dr Gebruk and Rogacheva for their help and valuable suggestions and comments on this article. We sincerely thank Dr Xiao Ning for fruitful discussion and critical comments. This study was supported by the foundation of China Ocean Mineral Resources R & D Association (No. DY135-E2-2-03, No. DY135-E2-2-06), the Project of State Key Laboratory of Satellite Ocean Environment Dynamics, Second Institute of Oceanography (SOEDZZ2002).

Citation

Yu C, Zhang D, Zhang R, Wang C (2022) New psychropotid species (Echinodermata, Holothuroidea, Elasipodida) of the Western Pacific with phylogenetic analyses. ZooKeys 1088: 99–114. https://doi.org/10.3897/zookeys.1088.69141

Funding Statement

Second Institute Of Oceanography,MNR.China Ocean Mineral Resources R & D Association (No. DY135-E2-2-03, No. DY135-E2-2-06), the Project of State Key Laboratory of Satellite Ocean Environment Dynamics, Second Institute of Oceanography (SOEDZZ2002)

References

  1. Belyaev M, Vinigradov E. (1969) A new pelagic holothurian (Elasipoda, Psychropotidae) from abyssal depths in the Kurile-Kamchatka Trench. Zoologicheskii Zhurnal 48(5): 709–716. [Google Scholar]
  2. Darriba D, Taboada GL, Doallo R. (2012) jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9(8): 1–2. 10.1038/nmeth.2109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Gebruk AV, Kremenetskaia A, Rouse GW. (2019) A group of species “Psychropoteslongicauda” (Psychropotidae, Elasipodida, Holothuroidea) from the Kurile-Kamchatka trench area (North-West Pacific). Progress in Oceanography 180(2020): e102222. 10.1016/j.pocean.2019.102222 [DOI]
  4. Hansen B. (1975) Scientific results of the Danish deep-sea expedition round the world 1950–52. Systematics and biology of the deep-sea holothurians. Part. l. Elasipoda. Vinderup: The Galathea Committee, 1–262.
  5. Hérouard E. (1909) Triconus, nouveau genre de la famille des Psychropotineae. Bulletin Institut Musée Oceanographique, Monaco 145: 1–5. [Google Scholar]
  6. Huelsenbeck JP, Ronquist F. (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17(8): 754–755. 10.1093/bioinformatics/17.8.754 [DOI] [PubMed] [Google Scholar]
  7. Katoh K, Standley DM. (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Li Y-N, Xiao N, Zhang L-P, Zhang H-B. (2018) Benthodytesmarianensis, a new species of abyssal elasipodid sea cucumbers (Elasipodida: Psychropotidae) from the Mariana Trench area. Zootaxa 4462(3): 443–450. 10.11646/zootaxa.4462.3.10 [DOI] [PubMed] [Google Scholar]
  9. Matthew L, Richard M, Amy W, Steven S-H. (2012) Geneious Basic: An Integrated and Extendable Desktop Software Platform for the Organization and Analysis of Sequence Data. Bioinformatics 28(12): 1647–1649. 10.1093/bioinformatics/bts199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Miller AK, Kerr AM, Paulay G, Reich M, Wilson NG, Carvajal JI, Rouse GW. (2017) Molecular phylogeny of extant Holothuroidea (Echinodermata). Molecular Phylogenetics and Evolution 111(1137): 110–131. 10.1016/j.ympev.2017.02.014 [DOI] [PubMed] [Google Scholar]
  11. Perrier R. (1896) Sur les Élasipodes recueillis par le Travailleur et le Talisman. Comptes rendus hebdomadaires des séances de l’Académie des sciences 123(21): 900–903. [Google Scholar]
  12. P. Mark O’ L, Paulay G, Davey N, Michonneau F. (2011) The Antarctic region as a marine biodiversity hotspot for echinoderms: Diversity and diversification of sea cucumbers. Deep-Sea Research II 58(2011): 264–275. 10.1016/j.dsr2.2010.10.011 [DOI] [Google Scholar]
  13. Rogacheva A, Cross IA, Billett DSM. (2009) Psychropotid holothurians (Echinodermata: Holothuroidea: Elasipodida) collected at abyssal depths from around the Crozet Plateau in the Southern Indian Ocean. Zootaxa 2096(1): 460–478. 10.11646/zootaxa.2096.1.28 [DOI] [Google Scholar]
  14. Silvestro D, Michalak I. (2012) raxmlGUI: a graphical front-end for RAxML. Organisms Diversity & Evolution 12(4): 335–337. 10.1007/s13127-011-0056-0 [DOI] [Google Scholar]
  15. Stamatakis A. (2014) RAxML Version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30(9): 1312–1313. 10.1093/bioinformatics/btu033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Takano T, Itoh H, Kano Y. (2017) Dna-based identification of an echinoderm host for a deep-sea parasitic snail (Gastropoda: Eulimidae). Molluscan Research 38(3): 212–217. 10.1080/13235818.2017.1372865 [DOI] [Google Scholar]
  17. Théel H. (1882) Report on Holothurioidea. Pt. I. Report of the Scientific Results of the Voyage of H.M.S. Challenger. Zoology 4(13): 1–176. [Google Scholar]
  18. Xiao N, Gong L, Kou Q, Li X-Z. (2019) Psychropotesverrucicaudatus, a new species of deep-sea holothurian (Echinodermata: Holothuroidea: Elasipodida: Psychropotidae) from a seamount in the South China Sea. Bulletin of Marine Science 95(3): 421–430. 10.5343/bms.2018.0041 [DOI] [Google Scholar]
  19. Xiao N, Li X, Sha Z. (2018) Psychropotid holothurians (Echinodermata: Holothuroidea: Elasipodida) of the tropical Western Pacific collected by the KEXUE expedition with description of one new species. Marine Biology Research 14(8): 816–826. 10.1080/17451000.2018.1546012 [DOI] [Google Scholar]
  20. Zhang Z, Bao X, Dong Y, Gao X, Lei G, Li S, Liu W, Hou H, Shi J, Pu H. (2015) Complete mitochondrial genome of Parastichopuscalifornicus (Aspidochirotida: Stichopodidae). Mitochondrial DNA Part A 27(5): 3569–3570. 10.3109/19401736.2015.1074222 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Benthodytes
XML Treatment for Benthodytes jiaolongi
XML Treatment for Psychropotes verrucicaudatus

Articles from ZooKeys are provided here courtesy of Pensoft Publishers

RESOURCES