Abstract
Drug efflux pumps in Pseudomonas aeruginosa were evaluated as potential targets for antibacterial therapy. The potential effects of pump inhibition on susceptibility to fluoroquinolone antibiotics were studied with isogenic strains that overexpress or lack individual efflux pumps and that have various combinations of efflux- and target-mediated mutations. Deletions in three efflux pump operons were constructed. As expected, deletion of the MexAB-OprM efflux pump decreased resistance to fluoroquinolones in the wild-type P. aeruginosa (16-fold reduction for levofloxacin [LVX]) or in the strain that overexpressed mexAB-oprM operon (64-fold reduction for LVX). In addition to that, resistance to LVX was significantly reduced even for the strains carrying target mutations (64-fold for strains for which LVX MICs were >4 μg/ml). We also studied the frequencies of emergence of LVX-resistant variants from different deletion mutants and the wild-type strain. Deletion of individual pumps or pairs of the pumps did not significantly affect the frequency of emergence of resistant variants (at 4× the MIC for the wild-type strain) compared to that for the wild type (10−6 to 10−7). In the case of the strain with a triple deletion, the frequency of spontaneous mutants was undetectable (<10−11). In summary, inhibition of drug efflux pumps would (i) significantly decrease the level of intrinsic resistance, (ii) reverse acquired resistance, and (iii) result in a decreased frequency of emergence of P. aeruginosa strains highly resistant to fluoroquinolones in clinical settings.
Decreased intracellular accumulation due to active efflux of antibiotics out of bacterial cells is one of the mechanisms that contributes to the failure of therapy with many currently used antibiotics. Both antibiotic-specific and multidrug-resistant pumps were identified. The latter class of transporter proteins can extrude out of the cell a large variety of structurally unrelated compounds with different modes of action. Many of them are currently used antibiotics (15–17, 24–27).
Pseudomonas aeruginosa is an important opportunistic pathogen in which three multicomponent, multidrug-resistant efflux pumps have been identified, namely, Mex-AB-OprM (30, 31), MexCD-OprJ (29), and MexEF-OprN (11). Of the known multidrug-resistant pumps in P. aeruginosa, only MexAB-OprM is expressed at a level sufficient to confer intrinsic multidrug resistance in wild-type cells. Deletion of the mexA, mexB, or oprM gene renders P. aeruginosa more susceptible to multiple antibiotics (6, 31, 38). Multidrug-resistant mutants with increased expression of any of the pumps can easily be isolated and manipulated under laboratory conditions (8, 19, 20, 32).
Fluoroquinolones, primary therapeutic antibiotics for P. aeruginosa, are effluxed by all the known Mex pumps. Mutants with elevated levels of expression of the pumps, which confer increased resistance to fluoroquinolones, have been identified among clinical strains: nalB mutants that overproduce the MexAB-OprM pump (2), nfxB mutants that overproduce MexCD-OprJ (10, 40), and nfxC mutants that overproduce the MexEF-OprN efflux pump (5). This resistance to fluoroquinolones through the overproduction of efflux pumps is distinct from the resistance to fluoroquinolone antibiotics through the mutation of quinolone resistance-determining regions (QRDRs) (9, 28, 39) in DNA gyrase and topoisomerase IV, which are encoded by gyrAB and parCE genes, respectively (9), in many organisms (28) including P. aeruginosa (14, 21).
In this report we show that deletion of efflux pumps reduces the level of resistance to fluoroquinolones even in highly resistant strains with multiple target mutations. We also show that deletion of all three described pumps significantly reduces the frequency of emergence of fluoroquinolone-resistant mutant strains. These results demonstrate the potential effects of inhibition of efflux pumps on the susceptibility to fluoroquinolones.
MATERIALS AND METHODS
Bacterial strains and media.
The bacterial strains used in this study are listed in Table 1. Bacterial cells were grown in Luria (L) broth (1% [wt/vol] tryptone, 0.5% [wt/vol] yeast extract, 0.5% [wt/vol] NaCl) or L agar (L broth plus 1.5% agar) at 37°C. The following antibiotics were added to the media at the indicated concentrations: tetracycline, 20 μg/ml for Escherichia coli and 100 to 150 μg/ml for P. aeruginosa; chloramphenicol, 20 μg/ml for E. coli and 100 μg/ml for P. aeruginosa; gentamicin, 15 μg/ml for both E. coli and P. aeruginosa; HgCl2, 15 μg/ml for both E. coli and P. aeruginosa; ampicillin, 100 μg/ml for E. coli; and kanamycin, 50 μg/ml for E. coli. L agar was supplemented with 5% (wt/vol) sucrose as required. Levofloxacin (LVX) was synthesized at Daiichi Pharmaceutical Co., Ltd. (Tokyo, Japan). All other antibiotics were purchased from Sigma Chemical Co. (St. Louis, Mo.).
TABLE 1.
Bacterial strains and plasmids used in this study
| Strain group and strain | Genotype or descriptiona | Source or reference |
|---|---|---|
| P. aeruginosa strains that lack or overexpress individual pumps or combinations of the pumps | ||
| PAM1020 | PAO1 prototroph | This study |
| PAM1032 | nalB (mexAB-oprM is overexpressed) | This study |
| PAM1033 | nfxB (mexCD-oprJ is overexpressed) | This study |
| PAM1034 | nfxC (mexEF-oprN is overexpressed) | This study |
| K590 | met-9011 amiE200 rpsL pvd-9 mexA::Tc | 30 |
| K613 | met-9011 amiE200 rpsL pvd-9 oprM::ΩHg | 31 |
| PAM1106 | mexA::Tc | This study |
| PAM1154 | oprM::ΩHg | This study |
| PAM1177 | nfxB oprM::ΩHg | This study |
| PAM1187 | nfxC oprM::ΩHg | This study |
| PAM1360 | mexA::Tc ΔmexCD-oprJ::Gm | This study |
| PAM1409 | ΔmexCD-oprJ::Gm | This study |
| PAM1610 | nalB ΔmexEF-oprN::ΩHg | This study |
| PAM1623 | ΔmexEF-oprN::ΩHg | This study |
| PAM1536 | nfxB ΔmexAB-oprM::Cm | This study |
| PAM1554 | ΔmexAB-oprM::Cm | This study |
| PAM1561 | ΔmexAB-oprM::Cm ΔmexCD-oprJ::Gm | This study |
| PAM1624 | ΔmexCD-oprJ::Gm ΔmexEF-oprN::ΩHg | This study |
| PAM1625 | ΔmexAB-oprM::Cm ΔmexEF-oprN::ΩHg | This study |
| PAM1626 | ΔmexAB-oprM::Cm ΔmexEF-oprN::ΩHg ΔmexCD-oprJ::Gm | This study |
| Strains with different levels of mexAB-oprM operon expression containing target-based mutations | ||
| P. aeruginosa | ||
| PAM1548 | gyrA (Thr83→Ile) | This study |
| PAM1324 | gyrA (Asp87→Tyr) | This study |
| PAM1572 | nalB gyrA (Thr83→Ile) | This study |
| PAM1573 | nalB gyrA (Thr83→Ile) | This study |
| PAM1481 | nalB gyrA (Asp87→Tyr) | This study |
| PAM1569 | nfxB gyrA (Thr83→Ile) | This study |
| PAM1482 | nfxB gyrA (Asp87→Tyr) | This study |
| PAM1570 | nfxC gyrA (Thr83→Ile) | This study |
| PAM1491 | nfxC gyrA (Asp87→Tyr) | This study |
| PAM1582 | nalB gyrA (Thr83→Ile) parC (Ser87→Leu) | This study |
| PAM1609 | nalB gyrA (Thr83→Ile) parC (Ser87→Leu) gyrA (Asp87→Tyr) | This study |
| PAM1064 | mexA-phoA::Tc | This study |
| PAM1667 | gyrA (Thr83→Ile) parC (Ser87→Leu) mexA-phoA::Tc | This study |
| PAM1669 | gyrA (Thr83→Ile) parC (Ser87→Leu) gyrA (Asp87→Tyr) mexA-phoA::Tc | This study |
| PAM1665 | gyrA (Thr83→Ile) oprM::ΩHg | This study |
| PAM1600 | gyrA (Thr83→Ile) parC (Ser87→Leu) oprM::ΩHg | This study |
| PAM1640 | gyrA (Thr83→Ile) parC (Ser87→Leu) gyrA (Asp87→Tyr) oprM::ΩHg | This study |
| E. coli | ||
| DH5α | endA hsdR17 supE44 thi-1 recA1 gyrA relA1 Δ(lacZYA-argF)U169 deoR [φ80dlacΔ(lacZ)]M15 | 1 |
| S17-1 | thi pro hsdR recA Tra | 36 |
| Plasmids | ||
| pX1918-GT | Apr Gmr; contains the selectable Gmr marker downstream from the xylE reporter gene | 35 |
| pNOT19 | Apr; pUC19 with 10-bp NdeI-NotI adaptor in NdeI site | 34 |
| pMOB3 | Kmr CmrsacB oriT | 34 |
| pHP45ΩHg | Apr, HgCl2r; derivative of pHP45Ω with Ω interposon containing the mer operon from Tn501 | 4 |
| pRS14 | Tcr; contains a 4.3-kb HindIII fragment carrying the mexAB-oprM operon with a 4.1-kb internal deletion | 37 |
| pSUP202-mexA-phoA | Tcr Cbr Cmr; pSUP202 carrying the 5′ upstream region of mexA fused to promoterless phoA gene | K. Poole |
| pX1918-Cm | Apr Cmr; pX1918GT in which BamHI fragment with GmrxylE cassette replaced by BamHI fragment with Cmr from pMOB3 | This study |
| pMOB3-Gm | Kmr Gmr; pMOB3 in which BamHI fragment with Cmr replaced by BamHI fragment with GmrxylE cassette from pX1918-GT | This study |
| pAL219 | Apr; pNOT19 without SalI site (removed by Klenow treatment and religation) | This study |
| pAL225 | Apr; pAL219 with 4.3-kb HindIII (contains ΔmexAB-oprM) from pRS14 in HindIII | This study |
| pAL231 | Apr Cmr; pAL225 with SalI Cmr fragment from pX1918-Cm in SalI (located in mexAB-oprM region) | This study |
| pAL232 | Apr Cmr Gmr; pAL231 with 6.9-kb NotI fragment from pMOB3-Gm with oriT, sacB, and Gmr cloned in NotI located in insert portion by NotI partial digest | This study |
| pAL234 | Apr; pNOT19 with 0.65-kb EcoRI-BamHI PCR fragment with part of mexE in EcoRI-BamHI | This study |
| pAL237 | Apr; pAL234 with 0.98-kb BamHI-HindIII PCR fragment with part of oprN in BamHI-HindIII | This study |
| pAL239 | Apr Hgr; pAL237 with 5.5-kb BamHI fragment with Hgr from pHP45ΩHg in BamHI | This study |
| pAL241 | Apr Gmr; pAL239 with 6.7-kb NotI fragment from pMOB3 with oriT, sacB, and Gmr in NotI located in vector portion by NotI partial digest | This study |
| pAL215 | Apr; pNOT19 with 0.95-kb EcoRI-BamHI PCR fragment with nfxB and part of mexC and 0.97-kb BamHI-HindIII PCR fragment with part of oprJ in EcoRI-HindIII | This study |
| pAL217 | Apr Gmr; pAL215 with 2.4-kb BamHI Gmr fragment from pX1918-GT in BamHI | This study |
| pAL224 | Apr Cmr Gmr; pAL217 with 5.3-kb NotI fragment from pMOB3 with SacB, oriT, and Cmr in NotI located in vector portion by NotI partial digest | This study |
ΩHg, Hg resistance derivative of interposon Ω; Apr, ampicillin resistance; Cmr, chloramphenicol resistance; Gmr, gentamicin resistance; Tcr, tetracycline resistance; Kmr, kanamycin resistance; Cbr, carbenicillin resistance; oriT, origin of transfer from RP4; sacB, sacB locus from Bacillus subtilis.
Selection of multidrug-resistant mutants of P. aeruginosa.
Selection of multidrug-resistant mutants of P. aeruginosa was performed as described previously (20). The frequency of resistance was determined as the ratio of the numbers of CFU per milliliter that appeared after overnight incubation on antibiotic-containing L agar plates versus the numbers that appeared after overnight incubation on antibiotic-free L agar plates.
Stepwise selection of LVX resistance.
Wild-type strain PAM1020 (LVX MIC, 0.25 μg/ml) was plated on LBA plates with LVX at 4× the MIC. The first-generation spontaneous mutants were selected at a frequency of 10−6 to 10−7. The same procedure was repeated several times for subsequent generations of mutants, each time with higher concentrations of LVX but still at 4× the MIC. During the next four steps of selection, spontaneous mutants were isolated at a frequency of ca. 10−8. The highest MIC achieved after five selection steps was 128 μg/ml.
Transductions.
Transductions in P. aeruginosa were performed with phage F116L by a previously described protocol (13).
MIC determinations.
MICs were determined in 96-well microtiter plates by a standard broth microdilution method (22) in Muller-Hinton broth (Difco). The inoculum was 104 to 105 cells/ml.
DNA manipulations.
Plasmid DNA was purified with the RPM Spin Kit (Bio 101, Inc., Vista, Calif.). Chromosomal DNA was prepared by using the Qiagen Blood and Cell Culture Mini Kit (Qiagen Inc., Valencea, Calif.). DNA fragments were gel purified and extracted with the Qiagen Gel Purification Kit or the Bio 101 GeneClean Kit. Restriction enzymes were obtained from New England Biolabs (Beverly, Mass.), and AmpliTaq was obtained from Perkin-Elmer (Branchburg, N.J.). Plasmid DNA was introduced into E. coli strains by electroporation (Bio-Rad Laboratories, Mississauga, Ontario, Canada). All molecular biology techniques were performed according to the manufacturer’s instructions or as described by Sambrook et al. (33). PCR was carried out in a Perkin-Elmer GeneAmp 9600 thermal cycler. Typically, 30 cycles of denaturation (30 s at 95°C), annealing (30 s at 55°C), and extension (1 min at 72°C) were used to amplify the DNA used in the construction of operon deletions. Analysis of the sequences of the QRDRs was performed directly with PCR-amplified genomic DNA segments. Cycle sequencing was carried out with the ABI-PRISM fluorescent dye terminator kit (Applied Biosystems Inc., Foster City, Calif.). The QRDR of the gyrA (14) gene was amplified with primers TTATGCCATGAGCGAGCTGGGCAACGACT (29mer) and TTCCGTTGACCAGCAGGTTGGGAATCTT (28mer). The QRDR of the parC (21) gene was amplified with primers ATCTGAGCCTGGAAG (15mer) and AGCAGCACCTCGGAATAG (18mer).
Construction of a recombinant plasmid for deletion of the mexAB-oprM operon.
Plasmid pAL232 was constructed to replace a part of the sequence of the mexAB-oprM operon with the chloramphenicol resistance [cat (Cmr)] gene in the chromosome of P. aeruginosa. Construction was performed as follows. First, we created auxiliary plasmids pAL219, pX1918-Cm, and pMOB3-Gm. pAL219 is a derivative of pNOT19 (34) whose SalI site was removed by the Klenow treatment and religation. pX1918-Cm is a derivative of pX1918-GT (35) in which a BamHI fragment carrying a gentamicin resistance [aacC1 (Gmr)] gene was replaced with a BamHI fragment carrying the cat gene. The cat gene was obtained from plasmid pMOB3 (34). pMOB3-Gm is a derivative of pMOB3 in which a BamHI fragment carrying a cat gene was replaced with a BamHI fragment carrying an aacC1 gene. The aacC1 gene was obtained from plasmid pX1918-GT. Second, plasmid pAL225 was constructed from pAL219 and pRS14. Plasmid pRS14, obtained from K. Poole (37), contains a 4.3-kb HindIII fragment carrying the mexAB-oprM operon with a 4.1-kb internal deletion (obtained by SacII digestion and religation). Plasmid pAL225 was created by cloning the 4.3-kb HindIII fragment from pRS14 into the HindIII site of pAL219. Third, plasmid pAL231 was created by inserting a 1.6-kb SalI fragment with a cat gene (isolated from plasmid pX1918-Cm) into the unique SalI site of pAL225 located in the oprM gene, close to the remaining SacII site. A final construct, plasmid pAL232, was obtained by ligating the 6.9-kb NotI fragment from pMOB3-Gm into the NotI site of pAL231. Besides the mexAB-oprM sequence being partially replaced with the cat gene, this plasmid also contained sacB and oriT.
Construction of recombinant plasmids for deletion of mexEF-oprN operon.
Plasmid pAL241 was constructed to replace a part of the sequence of the mexEF-oprN operon with the mercury resistance [mer (Hgr)] operon in the chromosome of P. aeruginosa. Construction was performed as follows. A 0.65-kb portion of the mexE gene was amplified from the chromosome and was subsequently ligated into the EcoRI and BamHI sites of pNOT19 to create pAL234. Primers MexE-EcoRI (GCTGAACGAGTGGGACGAATTCAC) and MexE-BamHI (CAGGATCCGGTTGACCTGGTTGTCGA) were used. A 0.98-kb portion of the oprN gene was amplified from the chromosome with primers OprN-BamHI (CGGGATCCAACGATCGCTTCCCGGT) and OprN-HindIII (CTCAAGCTTGGTGCCTTCGCGGTACGGAT). The resulting PCR fragment was ligated into the BamHI and HindIII sites of pAL234 to create pAL237. The 5.5-kb BamHI fragment of pHP45ΩHg (4) containing the mercury resistance determinant was ligated into the BamHI site of pAL237 to create plasmid pAL239. The mercury resistance determinant therefore separates the two gene fragments. The final construct, pAL241, was obtained by ligating the 6.7-kb NotI fragment of pMOB3 containing the sacB, oriT, and aacC1 genes into pAL239.
Construction of a recombinant plasmid for deletion of the mexCD-oprJ operon.
Plasmid pAL224 was constructed to replace a part of the sequence of the mexCD-oprJ operon with the gentamicin resistance gene in the chromosome of P. aeruginosa. Construction was performed as follows. First, we constructed plasmid pAL215. The 0.95-kb EcoRI-BamHI fragment that contains the gene nfxB and the 5′ end of the gene mexC and the 0.97-kb BamHI-HindIII fragment containing part of the gene oprJ were inserted into pNOT19 to obtain pAL215. The nfxB-mexC fragment was obtained by chromosomal PCR with the primers NfxB-EcoRI (TTTGAATTCGCCAAGTGCCAGTATCG) and NfxB-BamHI (TTTGGATCCCGATCCTTCCTATTGCACG); the oprJ fragment was obtained by chromosomal PCR with the primers OprJ-BamHI (GGGGGATCCGAGTACGAACTGGACCTC) and OprJ-HindIII (CCCAAGCTTTAGCACCGTTTCCCACAC). Second, a 2.4-kb BamHI fragment from pX1918-GT containing a gentamicin marker was inserted between the nfxB gene fragment and the oprJ gene fragment to create pAL217. The final construct, pAL224, was created by ligation of a 5.3-kb NotI fragment obtained from pMOB3 containing sacB, oriT, and a cat gene into pAL217.
Deletions of efflux pump operons in chromosome of P. aeruginosa.
Plasmids pAL224, pAL232, and pAL241 were transformed into E. coli S-17 (36) and were subsequently mobilized into various strains of P. aeruginosa via conjugation. Conjugation was performed as described elsewhere (30). Subsequent sucrose selection rendered strains PAM1360, PAM1536, and PAM1610, which were then used as sources of the mexCD-oprJ::Gm, mexAB-oprM::Cm, and mexEF-oprN::ΩHg deletions, respectively.
Gene replacement.
Strains PAM1106 (PAM1020 mexA::Tc) and PAM1154 (PAM1020 oprM::ΩHg) were obtained by transducing tetracycline (Tc) or Hg resistance markers from strains K590 (30) or K613 (31), respectively, which were kindly provided by K. Poole. Strain PAM1064 (PAM1020 mexA-phoA::Tc) was constructed as follows. Plasmid pSUP202-mexA-phoA (a gift from K. Poole) contains the mexA-phoA transcriptional fusion inserted into vector pSUP202 (which confers the Tcr Cbr Cmr phenotype), which cannot replicate in P. aeruginosa but which does contain the mob (mobilization) site. This plasmid was mobilized into P. aeruginosa PAM1020. One of the transconjugants, PAM1064, was confirmed by PCR and its antibiotic susceptibility profile to contain a chromosomal mexA-phoA fusion, an intact and functional mexAB-oprM operon, and closely linked plasmid-encoded Tcr and Cbr markers.
SDS-PAGE and Western immunoblotting.
Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) was performed by a previously described protocol (6) with 10% (wt/vol) acrylamide in the running gel. Proteins separated by SDS-PAGE were electrophoretically transferred to a nitrocellulose membrane (BA85; Schleicher & Schuell) as described previously (7), with the exception that SDS (0.1% [wt/vol]) was included in the buffer and transfer was carried out at 100 mA for 90 min. The membranes were processed as described previously (6) with murine monoclonal antibodies specific for the OprM, OprJ, or OprN protein (obtained from N. Gotoh) as the primary antibodies and alkaline phosphatase-conjugated goat antibodies to mouse immunoglobulin G as the secondary antibodies (Bio-Rad). The blots were developed with the AP Conjugate Substrate Kit (Bio-Rad) by the manufacturer’s protocol.
RESULTS
Creation of isogenic strains overexpressing individual efflux pumps.
Strain PAO1(PAM1020) was chosen as a parent strain for all subsequent selection and construction procedures (Table 1). Two types of selections were used: PAM1020 was plated either on LBA plates with levofloxacin at 4× the MIC (1 μg/ml) or on plates with combinations of antibiotics. The latter procedure was based on the previously reported susceptibility profiles for the mutants overexpressing individual efflux pumps (19, 20). Each mutant was profiled with a panel of antibiotics. Mutants that did not show the multidrug-resistant phenotype were tested for the presence of gyrA mutations (QRDRs were PCR amplified and sequenced). Two types of gyrA mutants were isolated: gyrA (Asp87→Tyr) and gyrA (Thr83→Ile), as exemplified by strains PAM1324 and PAM1548, respectively. Mutants with mutations in nalB (resulting in overexpression of MexAB-OprM) and nfxB (resulting in overexpression of MexCD-OprJ) were isolated at a frequency of 10−6 to 10−7, gyrA mutants were isolated at a frequency 10−8, and nfxC mutants (resulting in overexpression of the MexEF-OprN pump) were isolated at a frequency of 10−9 to 10−10. Overexpression of individual efflux pumps in multidrug-resistant mutants (nalB, nfxB, and nfxC) was confirmed with monoclonal antibodies (obtained from N. Gotoh) that were raised against the OprM, OprJ, or OprN protein (data not shown). LVX MICs (1 to 2 μg/ml) were comparable for gyrA and pump-overexpressing mutants.
Creation and characterization of isogenic mutants lacking individual efflux pumps and combinations of pumps.
In order to model the effects of inhibition of multiple pumps, we have constructed the strain that lacks all three known efflux pumps and strains that lack one or two efflux pumps in various combinations. Strains with deletions of individual operons and the MexAB-OprM/MexCD-OprJ double knockout were reported previously (6, 11, 29–31, 38), and their viabilities were not impaired. Neither the double-deletion mutants nor the triple-deletion mutant that were constructed in the course of our work had detectable growth defects under laboratory conditions (data not shown). These data suggest that a drug that inhibits Mex pumps, singularly or in multiples, will have no antibacterial effect by itself.
As expected, deletion of the mexAB-oprM operon (strain PAM1554) resulted in a dramatic reduction in intrinsic resistance to fluoroquinolones and other antibiotics (data not shown). Deletion of both MexCD-OprJ and MexEF-OprN pumps did not have an additional effect on the intrinsic resistance even when the mexAB-oprM operon was deleted (data not shown). The MIC of LVX for triple-deletion strain PAM1626 was 0.015 μg/ml.
It was previously shown that overexpression of the MexCD-OprJ efflux pump compensated for the lack of the MexAB-OprM pump for antibiotics which are substrates of MexCD-OprJ (7). We have shown here that the same is true for the MexEF-OprN efflux pump. The susceptibility of PAM1034 (in which MexEF-OprN is overexpressed) to antibiotics that are the substrates for MexEF-OprN (data not shown) was nearly the same as that of PAM1187 (PAM1034 oprM::ΩHg).
Effect of overexpression of various efflux pumps on strains with gyrA mutations.
We studied the effects of overexpression of various efflux pumps on strains containing mutations in the target genes. A series of strains with various gyrA mutations that also overexpress efflux pumps was constructed. To do so, we transduced nalB, nfxB, and nfxC mutations from strains PAM1032, PAM1033, and PAM1034, respectively, into PAM1324 with gyrA (Asp87→Tyr) or PAM1548 with gyrA (Thr83→Ile) mutations. Our results (Table 2) indicate that when both gyrA and efflux pump-overexpression mutations are present in the same strain, the MIC of LVX is increased above the MIC for either mutant alone. The gyrA mutation (Asp87→Tyr) increased the LVX MIC fourfold for the strain in which efflux pumps were not overexpressed (compare PAM1020 and PAM1324), while the gyrA mutation (Thr83→Ile) resulted in an eightfold increase in the MIC (compare PAM1020 and PAM1548). The same four- or eightfold increase in the MIC due to these mutations was also observed in strains which overexpressed any of these three efflux pumps (Table 2). Since various efflux pumps confer slightly different levels of resistance to LVX to begin with, the MICs of this antibiotic for the resulting transductants were also different.
TABLE 2.
Effect of target mutations in strains overexpressing various efflux pumpsa
| Strain | Pump status | gyrA status | LVX MIC (μg/ml) |
|---|---|---|---|
| PAM1020 | WTb | WT | 0.25 |
| PAM1548 | WT | gyrA (Thr83→Ile) | 2 |
| PAM1324 | WT | gyrA (Asp87→Tyr) | 1 |
| PAM1032 | nalB | WT | 1 |
| PAM1572 | nalB | gyrA (Thr83→Ile) | 8 |
| PAM1481 | nalB | gyrA (Asp87→Tyr) | 4 |
| PAM1033 | nfxB | WT | 2 |
| PAM1569 | nfxB | gyrA (Thr83→Ile) | 16 |
| PAM1482 | nfxB | gyrA (Asp87→Tyr) | 8 |
| PAM1034 | nfxC | WT | 4 |
| PAM1570 | nfxC | gyrA (Thr83→Ile) | 32 |
| PAM1491 | nfxC | gyrA (Asp87→Tyr) | 16 |
The nalB, nfxB, or nfxC mutation was transduced from strain PAM1032, PAM1033, or PAM1034, respectively, into PAM1548 [gyrA(Thr83→Ile)] or PAM1324 [gyrA(Asp87→Tyr)]. All transductants were selected on various combinations of antibiotics in accordance with the specificity of each particular efflux pump. LVX was not used for the selection.
WT, wild type.
Effect of mexAB-oprM operon on strains with multiple target mutations.
To establish further the contribution of efflux pumps to acquired resistance to fluoroquinolones, we investigated the effects that an efflux pump(s) would have on the strains with multiple target mutations. To obtain such mutants, we used stepwise selection by increasing the concentrations of LVX in the medium. After the first step of selection we obtained both efflux and target-based mutant strains, and all of them had comparable susceptibilities to LVX (MICs, 1 to 2 μg/ml). It is noteworthy that efflux mutants arose at a higher frequency (see above). The stepwise mutants were obtained in the following order: PAM1020 (wild type) > PAM1032 (nalB) > PAM1573 (nalB gyrA [Thr83→Ile]) > PAM1582 (nalB gyrA [Thr83→Ile] parC [Ser87→Leu] gyrA [Asp87→Tyr]). For quadruple mutant PAM1609 the LVX MIC was 128 μg/ml (Table 3).
TABLE 3.
Effect of mexAB-oprM operon on LVX susceptibility of strains with multiple target mutations
| gyrA or parC mutation | MIC (μg/ml) for indicated strain with the following pump status:
|
||
|---|---|---|---|
| nalBa | WTb | oprM::ΩHgc | |
| None | 2 (PAM1032) | 0.25 (PAM1020) | 0.015 (PAM1154) |
| gyrA (Thr83→Ile) | 8 (PAM1573) | 2 (PAM1548) | 0.125 (PAM1665) |
| gyrA (Thr83→Ile) parC (Ser87→Leu) | 32 (PAM1582) | 4 (PAM1667) | 0.5 (PAM1600) |
| gyrA (Thr83→Ile) parC (Ser87→Leu) gyrA (Asp87→Tyr) | 128 (PAM1609) | 16 (PAM1669) | 2 (PAM1640) |
The strains were obtained by stepwise selection with increasing concentrations of LVX. Strain PAM1032 was selected from wild-type strain PAM1020. The order of the strains in the column corresponds to the order in which the strains were selected, so that for example, PAM1032 is a parent of PAM1573. All mutant selections were performed with LVX at 4× the MIC for the corresponding parent.
WT, wild type. PAM1548 was obtained as a spontaneous LVX-resistant mutant selected from strain PAM1020. PAM1667 and PAM1669 were constructed by transduction of the mexAB-oprM operon with the wild-type level of expression (no nalB mutation) from strain PAM1064 into PAM1582 and PAM1609, respectively, as described in Materials and Methods.
Strains PAM1665, PAM1600, and PAM1640 were constructed by transduction of the Hg resistance from strain PAM1154 (PAM1020 oprM::ΩHg) into strains PAM1573, PAM1582, and PAM1609, respectively.
In order to elucidate the role of efflux pumps (in this case, the MexAB-OprM pump) in strains with multiple target mutations, we constructed two other series of mutants. First, we constructed strains with the same target mutations but with the wild-type level of expression of the mexAB-oprM operon (Table 3). To construct these strains, the Tcr marker from PAM1064 was transduced into the strains obtained from the stepwise selection process. Second, the MexAB-OprM efflux pump was inactivated by deletion of the oprM gene from the mutants obtained in the course of the stepwise selection (Table 3).
Our results indicate that the same target mutations afford different degrees of LVX resistance depending on the status of the efflux pumps. Overproduction of the MexAB-OprM efflux pump (due to the presence of the nalB mutation) always increased the LVX MIC eightfold, regardless of the presence of the target mutations. Remarkably, inactivation of the MexAB-OprM efflux pump resulted in a consistent 64-fold decrease in resistance to LVX (in strains which overexpressed this efflux pump), also regardless of the presence of additional target mutations in the same strain.
Effect of deleting efflux pump operons on the emergence of clinically relevant resistance to fluoroquinolones.
Since overexpression of any of the efflux pumps will lead to increased resistance to LVX, one can hypothesize that the frequency of emergence of resistant variants will be decreased if efflux pumps are inactive. Various deletion mutants were used to test this hypothesis. Selection was performed at 1 μg/ml (4× the MIC for the wild type). The results are presented in Table 4. Deletion of only individual efflux pumps did not alter the frequency of emergence of resistant mutants compared to that for the wild-type strain (despite the low level of resistance of the ΔmexAB-oprM mutant PAM1554, for which the MIC was 0.015 μg/ml). The mutants isolated in this experiment were shown to overexpress the MexCD-OprJ efflux pump (data not shown). Two of the strains that lacked two efflux pumps, either ΔmexAB-oprM ΔmexEF-oprN (PAM1625 [MIC, 0.015 μg/ml]) or ΔmexCD-oprJ ΔmexEF-oprN (PAM1624 [MIC, 0.25 μg/ml]) also demonstrated no alteration in frequency. Mutants overexpressing MexCD-OprJ or MexAB-OprM were isolated from the double-knockout strains (data not shown). When the ΔmexAB-oprM ΔmexCD-oprJ double mutant was used in the selection (PAM1561 [MIC, 0.015 μg/ml]), the frequency was detectable but was significantly decreased. Mutants obtained from PAM1561 were confirmed to overexpress the MexEF-OprN efflux pump (data not shown). However, the frequency of emergence of LVX-resistant mutants was undetectable when the triple-deletion mutant PAM1626 (ΔmexAB-oprM ΔmexCD-oprJ ΔmexEF-oprN [MIC, 0.015 μg/ml]) was used in the selection experiments with LVX at 1 μg/ml). Importantly, no target-based mutations were isolated under these selective conditions. Mutants with a low level of LVX resistance were isolated at a frequency of 10−8 to 10−9 when selection was performed with LVX at 4× the MIC (0.05 μg/ml) for the triple-deletion mutant. This frequency is in good accordance with that expected for target-based mutations.
TABLE 4.
Frequency of LVX-resistant mutants in strains with deletions of the efflux pump operons
| Strain | Pump status | LVX MIC (μg/ml) | Frequency of LVX-resistant mutantsa |
|---|---|---|---|
| PAM1020 | WTb | 0.25 | 2 × 10−7–4 × 10−7 |
| PAM1554 | ΔmexAB-oprM::Cm | 0.015 | 2 × 10−7–4 × 10−7 |
| PAM1409 | ΔmexCD-oprJ::Gm | 0.25 | 2 × 10−7–4 × 10−7 |
| PAM1623 | ΔmexEF-oprN::ΩHg | 0.25 | 2 × 10−7–4 × 10−7 |
| PAM1625 | ΔmexAB-oprM::Cm ΔmexEF-oprN::ΩHg | 0.015 | 2 × 10−7–10−7 |
| PAM1624 | ΔmexCD-oprJ::Gm ΔmexEF-oprN::ΩHg | 0.25 | 2 × 10−6 |
| PAM1561 | ΔmexAB-oprM::Cm ΔmexCD-oprJ::Gm | 0.015 | 1 × 10−9 |
| PAM1626 | ΔmexAB-oprM::Cm ΔmexCD-oprJ::Gm ΔmexEF-oprN::ΩHg | 0.015 | <1 × 10−11 |
The frequency of resistance to LVX was determined by plating 100 μl of an overnight culture of the corresponding mutant strain onto LBA containing LVX (1 μg/ml). Frequencies were determined as ratios between the number of colonies that grew on LBA plates containing LVX (expressed as numbers of CFU per milliliter to the number of colonies appearing on drug-free LBA plates after overnight growth.
WT, wild type.
DISCUSSION
We have chosen P. aeruginosa and fluoroquinolone antibiotics to evaluate the consequences of inhibition of efflux pumps in this organism. One obvious expectation from inhibition of the efflux pumps became apparent after several groups reported that the MexAB-OprM efflux pump significantly contributes to the high intrinsic resistance in P. aeruginosa (6, 31, 38). It is clear that inhibition of the MexAB-OprM efflux pump alone should decrease the intrinsic resistance of the wild-type strains of P. aeruginosa to many clinically relevant antibiotics that are the substrates of this pump. For example, as we have shown in this report, the susceptibility of the mexAB-oprM deletion mutant to LVX was increased eightfold compared to that of the wild-type strain. It is equally obvious that inhibition of multiple efflux pumps should reverse the acquired fluoroquinolone resistance associated with efflux pump overexpression. Indeed, susceptibility to LVX was increased 64-fold in the mutant that lacks three known efflux pumps (which would be the maximal expected effect of pump inhibition) compared to those for the strains that overexpress efflux pumps. However, the unqualified efficacy of efflux pump inhibitors for use in conjunction with fluoroquinolones may be argued, since efflux is not the sole mechanism of fluoroquinolone resistance and target modification mutations (in gyrase and topoisomerase IV) have been recognized to confer resistance to fluoroquinolones. To assess the relative contributions of the efflux pumps and the target modification in the acquisition of resistance to fluoroquinolones by P. aeruginosa, isogenic strains with various combinations of efflux and target mutations were used.
With these strains, it was demonstrated that overexpression of the mexAB-oprM operon due to a particular nalB mutation resulted in the same relative (eightfold) increase in resistance to LVX whether or not multiple target-based mutations were present in the same strain. This indicates that efflux contributes equally to fluoroquinolone resistance over a wide range of fluoroquinolone concentrations. Deletion of the MexAB-OprM efflux pump from the strain in which this pump was overexpressed resulted in a 64-fold reduction in the LVX MIC, independent of the presence of additional resistance mechanisms. These results indicate that, depending on the level of expression of efflux pumps, inhibition of the efflux pumps should result in 8- to 64-fold reductions in LVX MIC even for strains with target mutations. Analysis of isogenic mutant strains also showed that individual efflux- and target-based mutations resulted in comparable four- to eightfold increases in the LVX MIC.
An important observation that we have made, which is in a good agreement with previously reported results (12), is that frequencies of occurrence of mutants due to pump overexpression are ca. 10-fold higher compared with those due to target-based mutations, at least in the case of the MexAB-OprM and MexCD-OprJ pumps. Therefore, it is conceivable that a high proportion of mutants present among both moderately and highly resistant clinical strains of P. aeruginosa are efflux mediated. Indeed, recently, several laboratories have reported the presence of multiple resistance mechanisms, including efflux, in a single bacterial strain isolated from the clinic (3, 40). These observations further support the notion that an inhibitor of multiple efflux pumps will serve as a good LVX-potentiating agent.
Another important beneficial consequence of inhibition of multiple efflux pumps demonstrated in this report is the decreased frequency of emergence of P. aeruginosa strains with clinically relevant levels of resistance to fluoroquinolones. Specifically, the emergence of clinically relevant resistant mutants for which the LVX MIC is 1 μg/ml was nondetectable (<10−11) for the mexAB-oprM mexCD-oprJ mexEF-oprN triple-deletion strain (MIC, 0.015 μg/ml). While inhibition of the efflux pumps should prevent the appearance of efflux-mediated mutants, we also did not obtain strains with increased resistance due to target-based mutations. As we have shown here, in order for the bacteria without efflux pumps to grow under the selective conditions used (LVX at 1 μg/ml), such bacteria are required to acquire simultaneously at least three target-based mutations to attain the necessary level of resistance (Table 3, PAM1640). Multiple target-based mutations are required since, as we have shown in this report, a single target-based mutation provides only a four- to eightfold increase in LVX resistance. Furthermore, the simultaneous acquisition of multiple mutations in a single experiment is an extremely rare event. It is also noteworthy that no additional efflux-based mutants conferring an increase in LVX resistance like that provided by three known efflux-based pumps were selected from the triple-deletion strain. Similar effects of inhibition of efflux pumps on the frequency of emergence of resistance were obtained in experiments with Staphylococcus aureus. When selection for norfloxacin resistance was performed in the presence of the NorA efflux pump inhibitor reserpine (23), a significant decrease in the frequency of emergence of resistance was observed (18).
In conclusion, we have demonstrated that efflux pumps contribute significantly to LVX resistance in P. aeruginosa. Inhibition of efflux pumps will (i) decrease intrinsic resistance, (ii) significantly reverse acquired resistance, and (iii) result in a decreased frequency of emergence of P. aeruginosa strains highly resistant to fluoroquinolones. These results occur only with simultaneous inhibition of multiple efflux pumps in P. aeruginosa. The benefits of broad-spectrum bacterium efflux pump inhibitors for the control of LVX resistance in P. aeruginosa warrant vigorous searches for such inhibitors.
ACKNOWLEDGMENTS
We thank K. Poole for providing numerous strains and plasmids and H. Schweizer for the plasmids used in gene disruption experiments. We thank N. Gotoh for monoclonal antibodies against OprM, OprJ, and OprN proteins. We are grateful to G. Miller, M. Schmidt, D. Biek, P. Nakane, M. Dudley, and K. Sato for reading the manuscript and providing insightful comments. We are thankful to T. Akasaka for sharing with us the sequence of the parC gene of P. aeruginosa prior to publication.
This work was supported by Daiichi Pharmaceutical Co., Ltd., and Microcide Pharmaceuticals, Inc.
REFERENCES
- 1.Ausubel F M, Brent R, Kingston R E, Moore D D, Deidman J G, Smith J A, Struhl K. Short protocols in molecular biology. 2nd ed. New York, N.Y: John Wiley & Sons, Inc.; 1992. [Google Scholar]
- 2.Chen H Y, Yuan M, Livermore D M. Mechanisms of resistance to beta-lactam antibiotics amongst Pseudomonas aeruginosa isolates collected in the UK in 1993. J Med Microbiol. 1995;43:300–309. doi: 10.1099/00222615-43-4-300. [DOI] [PubMed] [Google Scholar]
- 3.Everett M J, Jin Y F, Ricci V, Piddock L J. Contributions of individual mechanisms to fluoroquinolone resistance in 36 Escherichia coli strains isolated from humans and animals. Antimicrob Agents Chemother. 1996;40:2380–2386. doi: 10.1128/aac.40.10.2380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Fellay R, Frey J, Krisch H. Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of gram-negative bacteria. Gene. 1987;52:147–154. doi: 10.1016/0378-1119(87)90041-2. [DOI] [PubMed] [Google Scholar]
- 5.Fukuda H, Hosaka M, Iyobe S, Gotoh N, Nishino T, Hirai K. nfxC-type quinolone resistance in a clinical isolate of Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1995;39:790–792. doi: 10.1128/AAC.39.3.790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Gotoh N, Itoh N, Tsujimoto H, Yamagishi J, Oyamada Y, Nishino T. Isolation of OprM-deficient mutants of Pseudomonas aeruginosa by transposon insertion mutagenesis: evidence of involvement in multiple antibiotic resistance. FEMS Microbiol Lett. 1994;122:267–273. doi: 10.1111/j.1574-6968.1994.tb07179.x. [DOI] [PubMed] [Google Scholar]
- 7.Gotoh N, Tsujimoto H, Tsuda M, Okamoto K, Nomura A, Wada T, Nakahashi M, Nishino T. Characterization of the MexC-MexD-OprJ multidrug efflux system in ΔmexA-mexB-oprM mutants of Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1998;42:1938–1943. doi: 10.1128/aac.42.8.1938. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hirai K, Suzue S, Irikura T, Iyobe S, Mitsuhashi S. Mutations producing resistance to norfloxacin in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1987;31:582–586. doi: 10.1128/aac.31.4.582. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hooper D C. Quinolone mode of action. Drugs. 1995;49:10–15. doi: 10.2165/00003495-199500492-00004. [DOI] [PubMed] [Google Scholar]
- 10.Jakics E B, Iyobe S, Hirai K, Fukuda H, Hashimoto H. Occurrence of the nfxB type mutation in clinical isolates of Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1992;36:2562–2565. doi: 10.1128/aac.36.11.2562. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kohler T, Michea-Hamzehpour M, Henze U, Gotoh N, Curty L K, Pechere J C. Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa. Mol Microbiol. 1997;23:345–354. doi: 10.1046/j.1365-2958.1997.2281594.x. [DOI] [PubMed] [Google Scholar]
- 12.Kohler T, Michea-Hamzehpour M, Plesiat P, Kahr A L, Pechere J C. Differential selection of multidrug efflux systems by quinolones in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1997;41:2540–2543. doi: 10.1128/aac.41.11.2540. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Krishnapillai V. A novel transducing phage. Its role in recognition of a possible new host-controlled modification system in Pseudomonas aeruginosa. Mol Gen Genet. 1972;114:134–143. doi: 10.1007/BF00332784. [DOI] [PubMed] [Google Scholar]
- 14.Kureishi A, Diver J M, Beckthold B, Schollaardt T, Bryan L E. Cloning and nucleotide sequence of Pseudomonas aeruginosa DNA gyrase gyrA gene from strain PAO1 and quinolone-resistant clinical isolates. Antimicrob Agents Chemother. 1994;38:1944–1952. doi: 10.1128/aac.38.9.1944. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Lee, V. J., and O. Lomovskaya. 1998. Efflux-mediated resistance to antibiotics in bacteria: challenges and opportunities. Curr. Lit.: Antibacterial Res. 1:39–42.
- 16.Levy S B. Active efflux mechanisms for antimicrobial resistance. Antimicrob Agents Chemother. 1992;36:695–703. doi: 10.1128/aac.36.4.695. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lewis K. Multidrug resistance pumps in bacteria: variations on a theme. Trends Biochem Sci. 1994;19:119–123. doi: 10.1016/0968-0004(94)90204-6. [DOI] [PubMed] [Google Scholar]
- 18.Markham P N, Neyfakh A A. Inhibition of the multidrug transporter NorA prevents emergence of norfloxacin resistance in Staphylococcus aureus. Antimicrob Agents Chemother. 1996;40:2673–2674. doi: 10.1128/aac.40.11.2673. . (Letter.) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Masuda N, Ohya S. Cross-resistance to meropenem, cephems, and quinolones in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1992;36:1847–1851. doi: 10.1128/aac.36.9.1847. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Masuda N, Sakagawa E, Ohya S. Outer membrane proteins responsible for multiple drug resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1995;39:645–649. doi: 10.1128/AAC.39.3.645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Nakano M, Deguchi T, Kawamura T, Yasuda M, Kimura M, Okano Y, Kawada Y. Mutations in the gyrA and parC genes in fluoroquinolone-resistant clinical isolates of Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1997;41:2289–2291. doi: 10.1128/aac.41.10.2289. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.National Committee for Clinical Laboratory Standards. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 4th ed. Approved standards. NCCLS document M7-A4. Wayne, Pa: National Committee for Clinical Laboratory Standards; 1997. [Google Scholar]
- 23.Neyfakh A A, Borsch C M, Kaatz G W. Fluoroquinolone resistance protein NorA of Staphylococcus aureus is a multidrug efflux transporter. Antimicrob Agents Chemother. 1993;37:128–129. doi: 10.1128/aac.37.1.128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Nikaido H. Antibiotic resistance caused by gram-negative multidrug efflux pumps. Clin Infect Dis. 1998;27(Suppl. 1):S32–S41. doi: 10.1086/514920. [DOI] [PubMed] [Google Scholar]
- 25.Nikaido H. Multidrug efflux pumps of gram-negative bacteria. J Bacteriol. 1996;178:5853–5859. doi: 10.1128/jb.178.20.5853-5859.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Nikaido H. Prevention of drug access to bacterial targets: permeability barriers and active efflux. Science. 1994;264:382–388. doi: 10.1126/science.8153625. [DOI] [PubMed] [Google Scholar]
- 27.Paulsen I T, Brown M H, Skurray R A. Proton-dependent multidrug efflux systems. Microbiol Rev. 1996;60:575–608. doi: 10.1128/mr.60.4.575-608.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Piddock L J. Mechanisms of resistance to fluoroquinolones: state-of-the-art 1992–1994. Drugs. 1995;49:29–35. doi: 10.2165/00003495-199500492-00006. [DOI] [PubMed] [Google Scholar]
- 29.Poole K, Gotoh N, Tsujimoto H, Zhao Q, Wada A, Yamasaki T, Neshat S, Yamagishi J, Li X Z, Nishino T. Overexpression of the mexC-mexD-oprJ efflux operon in nfxB-type multidrug-resistant strains of Pseudomonas aeruginosa. Mol Microbiol. 1996;21:713–724. doi: 10.1046/j.1365-2958.1996.281397.x. [DOI] [PubMed] [Google Scholar]
- 30.Poole K, Heinrichs D E, Neshat S. Cloning and sequence analysis of an EnvCD homologue in Pseudomonas aeruginosa: regulation by iron and possible involvement in the secretion of the siderophore pyoverdine. Mol Microbiol. 1993;10:529–544. doi: 10.1111/j.1365-2958.1993.tb00925.x. [DOI] [PubMed] [Google Scholar]
- 31.Poole K, Krebes K, McNally C, Neshat S. Multiple antibiotic resistance in Pseudomonas aeruginosa: evidence for involvement of an efflux operon. J Bacteriol. 1993;175:7363–7372. doi: 10.1128/jb.175.22.7363-7372.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Rella M, Haas D. Resistance of Pseudomonas aeruginosa PAO to nalidixic acid and low levels of beta-lactam antibiotics: mapping of chromosomal genes. Antimicrob Agents Chemother. 1982;22:242–249. doi: 10.1128/aac.22.2.242. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
- 34.Schweizer H P. Allelic exchange in Pseudomonas aeruginosa using novel ColE1-type vectors and a family of cassettes containing a portable oriT and the counterselectable Bacillus subtilis sacB marker. Mol Microbiol. 1992;6:1195–1204. doi: 10.1111/j.1365-2958.1992.tb01558.x. [DOI] [PubMed] [Google Scholar]
- 35.Schweizer H P, Hoang T T. An improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa. Gene. 1995;158:15–22. doi: 10.1016/0378-1119(95)00055-b. [DOI] [PubMed] [Google Scholar]
- 36.Simon R, Priefer Y, Puehler A. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Bio/Technology. 1983;1:784–791. [Google Scholar]
- 37.Srikumar R, Li X Z, Poole K. Inner membrane efflux components are responsible for beta-lactam specificity of multidrug efflux pumps in Pseudomonas aeruginosa. J Bacteriol. 1997;179:7875–7881. doi: 10.1128/jb.179.24.7875-7881.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Yoneyama H, Ocaktan A, Tsuda M, Nakae T. The role of mex-gene products in antibiotic extrusion in Pseudomonas aeruginosa. Biochem Biophys Res Commun. 1997;233:611–618. doi: 10.1006/bbrc.1997.6506. [DOI] [PubMed] [Google Scholar]
- 39.Yoshida H, Bogaki M, Nakamura M, Nakamura S. Quinolone resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli. Antimicrob Agents Chemother. 1990;34:1271–1272. doi: 10.1128/aac.34.6.1271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Yoshida T, Muratani T, Iyobe S, Mitsuhashi S. Mechanisms of high-level resistance to quinolones in urinary tract isolates of Pseudomonas aeruginosa. Antimicrob Agents Chemother. 1994;38:1466–1469. doi: 10.1128/aac.38.7.1466. [DOI] [PMC free article] [PubMed] [Google Scholar]
