Skip to main content
Current Issues in Molecular Biology logoLink to Current Issues in Molecular Biology
. 2021 Oct 13;43(3):1583–1591. doi: 10.3390/cimb43030112

Oxidized Cell-Free DNA Rapidly Skews the Transcriptional Profile of Brain Cells toward Boosting Neurogenesis and Neuroplasticity

Anton D Filev 1,2,*, Svetlana V Kostyuk 1,2, Pavel E Umriukhin 1,3, Vladimir M Pisarev 1,2
Editor: Emiel PC van der Vorst
PMCID: PMC8929019  PMID: 34698136

Abstract

Cell-free DNA (cfDNA) is liberated and accumulated in neural tissue due to cell damage. The oxidative and nitrosative stress in the brain that accompanies various pathological conditions has been shown to increase the oxidation of cellular and cell-free DNA. Whether the high concentration of non-oxidized and oxidized cfDNA may affect the transcriptome response of brain cells has not been studied. In the current work, we studied whether cfDNA fragments affect several key pathways, including neurogenesis, at the level of gene expression in brain cells. In the study, primary rat cerebellum cell cultures were used to assess the effects of oxidized and non-oxidized cfDNA on the expression of 91 genes in brain cells. We found that only oxidized cfDNA, not non-oxidized cfDNA, significantly altered the transcription in brain cells in 3 h. The pattern of change included all 10 upregulated genes (S100A8, S100A9, S100b, TrkB, Ngf, Pink1, Aqp4, Nmdar, Kcnk2, Mapk1) belonging to genes associated with neurogenesis and neuroplasticity. The expression of inflammatory and apoptosis genes, which oppose neurogenesis, decreased. The results show that the oxidized form of cfDNA positively regulates early gene expression of neurogenesis and neuroplasticity. At the same time, the question of whether chronic elevation of cfDNA concentration alters brain cells remains unexplored.

Keywords: neurogenesis, inflammation, oxidized cell-free DNA, mRNA

1. Introduction

Every day, many thousands of neurons are born and differentiate from neural precursors, supporting brain tissue renewal [1,2]. An imbalance between death, birth, and differentiation may contribute to various neuropathologies [3,4]. It has been found that in chronic stress, neurodegenerative diseases, traumatic brain injury, sepsis, and stroke, the increased cell-free DNA (cfDNA) concentration in plasma is associated with the course and/or outcome [5,6,7,8,9]. Oxidative stress after cerebral ischemia is shown to induce DNA damage in the brain [10]. Our previous studies demonstrated that cfDNA in plasma might also contain oxidized nucleotides in several neurological diseases and may be associated with the disease course [11,12]. It is believed that mitochondrial DNA is less methylated [13] and more oxidized (with 10–15 times more 8-oxo-2′-deoxyguanosine (8-oxo-dG) residue [14]) than nuclear DNA. cfDNA molecules containing 8-oxo-dG demonstrate more prominent biological effects [15], presumably due to faster penetration into various cells (rat cerebellum cells, MCF7, fibroblasts) [15,16,17]. Released from cells mainly as part of exosomes [18], cfDNA is taken up by both the nearest bystander cells and distant outlying cells. Intracellularly, cfDNA molecules bind specific DNA sensors (TLR9, NLRP3, cGAS, etc.) to activate the inflammatory, oxidation, and adaptive responses. At the same time, cfDNA induces antioxidant mechanisms through increased levels of the Nrf2 and Hmox1 genes and protein expression [15,16,19].

While various effects of cfDNA on cells of different origin have been described, the mechanism of its action on brain cells remains unexplored. In the current study, we evaluated the early effects of oxidized and non-oxidized cfDNA on the expression of genes that control inflammation, oxidation, neurogenesis and neuroplasticity, apoptosis, autophagy/mitophagy, and DNA repair (a total of 91 genes).

2. Materials and Methods

2.1. Primary Cell Culture

Cerebellum tissue of 8-day-old Wistar rats was used for primary cell culture (PCC). Lysis solution (1 V 0.25% trypsin solution + 1 V Versene–EDTA solution) was added to the tissue and kept in a water bath for 15 min at 37 °C. Then the tube was centrifuged at 200× g for 30 s, and the supernatant was removed and washed with D-PBS solution and DMEM. The tissue was homogenized with a Pasteur pipette. The resulting cell suspension was passed through a 70 µm filter (SPL Life Sciences, Camarillo, CA, USA) on a 50 mL tube, then centrifuged at 200× g for 3 min, and the supernatant was removed. The cell pellet was diluted to the required volume with a neural cell culture medium (Neurobasal ™ Medium, B27 supplement, 2% FBS). All solutions and consumables were from PanEco (Moscow, Russia).

The cells were seeded on 6-well Nuclon TM plates (Thermo Fisher Scientific, Waltham, MA, USA) with pre-treated poly-D-lysine (Sigma-Aldrich, St. Louis, MO, USA) (concentration 50 μg/mL per hour, washed 3 times with deionized water, and dried in a sterile zone). The PCC was kept for 72 h in a CO2 incubator (5% CO2, 95% air, 37 °C, 98–100% humidity) (Eppendorf, Hamburg, Germany). The culture medium was changed every 3 days, and cell recovery was accessed by light microscopy (AxioVert, Carl Zeiss Microscopy, Jena, Germany).

2.2. CfDNA Purification and Oxidation

It is believed that in circulation, cfDNA accumulates in small fragments (150–180 b. p.) [20]. At the same time, DNA releases from cells to intracellular space of various sizes (200–10,000 b. p.) depending on the mechanisms of its production [21,22,23]. Previously, the effects of DNA fragments were studied using both long [17] and short [24] DNA fragments. For our experiments, we used total DNA from brain (cells and intracellular space) containing both genomic DNA and mitochondrial DNA. We pose that brain cells produce cfDNA of different sizes (200–10,000 b. p.), and those DNA fragments that we add to cell culture may mimic cfDNA liberating during brain cell damage.

DNA purification and oxidation were performed as described in [16,25]. Briefly, DNA was extracted from forebrain tissue of newborn rats using phenol-chloroform reagents. This method contains proteinase K and RNase treatments for protein and RNA removal, respectively. Then, DNA was oxidized by 3% hydrogen peroxide solution with UV λ = 312 (30 s). To ensure that the effect of oxidized cfDNA in cell culture is not due to presence of a residual hydrogen peroxide, the samples were treated as described in Table S2. Non-oxidized or oxidized cfDNA was added to the culture medium at a final concentration of 50 ng/mL. The average content of 8-oxo-dG was 400–600 per 106 nucleotides.

2.3. Sampling and mRNA Purification

To analyze the gene expression, all procedures were performed in accordance with the manufacturers’ protocols for the reagent kits. Total RNA was isolated from brain tissue specimens using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and treated with DNase I. The purity of the isolated RNA was determined spectrophotometrically by using a NanoDrop™ OneC (Thermo Fisher Scientific, Waltham, MA, USA). An RNA Clean & Concentrator–5 kit (Zymo Research, Irvine, CA, USA) was used to remove contaminants from the RNA samples. The RNA concentration was assessed using a Qubit 3.0 fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). The RNA integrity number (RIN) was determined electrophoretically using an Agilent 2100 bioanalyzer and Agilent RNA 6000 Nano Kit (both from Agilent Technologies, Santa Clara, CA, USA); only samples with RIN >5 were used for further analysis.

2.4. RT PCR

RT PCR was performed with specific primers (Evrogen, Moscow, Russia) (Table 1) and SybrGreen intercalating dye (Invitrogen, Waltham, MA, USA) on a StepOnePlus™ Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). The Ppia gene was chosen as the housekeeping gene.

Table 1.

Primer sequences for RT PCR.

Gene Sequence Tm Length
Ppia F TCGCGTCTGCTTCGAGCTGT 64.6 135
R TGGCACATGAATCCTGGAAT 57.2
Nlrp3 F GACCAGCCAGAGTGGAATGA 59.38 118
R TACAAATCGAGATGCGGGAG 57.49
Nf-kB1 F GACCGGCAACTCACAGACAG 60.95 170
R TCATAGATGGCGTCTGACAC 57.13
Nf-kB2 F CAATCACCTGCACCAGACAC 59.12 187
R TCCACTGTGCAACACTGCCT 62.27
Myd88 F CTCAGCCTGTCTCCAGGTGT 61.19 148
R CAAGACGGGTCCAGAACCAG 60.32
Tlr2 F GGCTGGAGGTCTCCAGGTCA 63.10 157
R AGACCTGGAGCTGCCATCAC 61.91
Sting1 F GCCATGTCCAGTCCAGGTAC 60.11 153
R CAAGATGCCAAGCAAGGCGC 63.15
Trkb F AAAGGTTAGAAATCATCAAT 47.66 330
R CCAGAGGGGTATTCTTGCTG 57.66
Bdnf F CGTCCACGGACAAGGCAACT 62.99 146
R CCAGCAGCTCTTCGATCACG 61.14
S100a8 F CCTCAGTTTGTGCAGAATAA 53.5 191
R TATTCTGTAGACATATCCAA 47.8
S100a9 F GAAGAGGGAGAAAAGAAATG 51.4 179
R CTTTGCCGTGGCTGTGGTCA 63.6

2.5. Multiplex Gene Expression Analysis

To explore the expression of 91 genes in the brain tissue specimens by a previously created gene panel [26], the nCounter FLEX Analysis System and the CodeSet reagent kit (Nanostring Technology, Inc., Seattle, WA, USA) were employed. This technology allows direct multiplex assay of gene transcription activity. The method is based on detecting targets labelled with unique color barcodes attached to target-specific probes. The analysis was performed according to the manufacturer’s protocol. We selected 5 HKGs, B2m, Gapdh, Hmbs, Ppia, and Ywhaz, which have been used in various studies as proven HKGs [27,28,29]. We studied the gene expression for signaling pathways associated with inflammation, oxidation, autophagy, mitophagy, apoptosis, DNA repair, neurogenesis, and neuroplasticity. The expression level of the studied genes was normalized to the reference genes and then to the control group (without cfDNA addition).

2.6. Statistics

Analysis of variance (one-way ANOVA, the Holm–Sidak method), with a Bonferroni correction for multiple comparisons (p adjusted = p unadjusted * 91), was performed using SigmaStat 3.1 (Systat Software Inc., San Jose, CA, USA). Two-fold differences in expression vs. control were considered significant at p adj < 0.01 for multiplex gene expression analysis, and p < 0.01 for RT PCR.

3. Results

3.1. Early Effects of Oxidized and Non-Oxidized cfDNA on Gene Expression in Brain Cells

Multiplex gene expression analysis was used to assess the expression of 91 genes following 3 h incubation of rat brain cell cultures with oxidized and non-oxidized cfDNA. Non-oxidized cfDNA did not show any significant effect on the expression of the studied genes (Table S1). In contrast, oxidized cfDNA differentially changed the expression of 47 out of 91 genes (Figure 1).

Figure 1.

Figure 1

Multiplex gene expression analysis of cells of rat cerebellum after oxidized cell-free DNA treatment for 3 h. (a) Gene distribution according to type of change in gene expression. (b) High (more than 10-fold) alteration of gene expression. (c) Moderate (2- to 10-fold) alteration of gene expression. One-way ANOVA, Holm–Sidak method. p adj < 0.0001 (all shown genes).

Ten genes showed significantly increased expression profiles: S100 family (S100b 23-fold, S100A8 5.2-fold, S100A9 43.8-fold), neurogenesis and neuroplasticity (TrkB 7.4-fold, Ngf 3.4-fold, Mapk1 2.88-fold), mitophagy (Pink1 3.9-fold), Nmdar (2.69-fold), Kcnk2 (3.24-fold), and Aqp4 (4.02-fold) (Figure 1b,c and Table S1).

Expression of 37 genes decreased in the range of >10-fold (7 genes), 5- to 10-fold (6 genes), and 2- to 5-fold (24 genes) (Figure 1b,c and Table S1). The oxidized DNA-induced transcriptional profile included decreased expression of genes of the antioxidant system (Hmox1 36.2-fold, Nqo1 3.6-fold, Nrf2 2.4-fold) and the inflammation system (Cxcl1 204.1-fold, Icam1 14.2-fold, Il1b 10.4-fold, Tlr4 5.7-fold, Myd88 3.4-fold, Nf-kB1 2.3-fold, Nf-kB2 5.2-fold), cfDNA sensors (Tlr9 2.9-fold, cGas 4.8-fold, Sting1 4.7-fold), and apoptosis/survival signaling (Bax 2.7-fold, Bcl2 2.9-fold, Survivin 3.5-fold, Tgfb 5.4-fold).

3.2. Dynamics of Inflammation-Related Gene Expression during the First 24 h after cfDNA Treatment

Considering that cfDNA promotes the activation of inflammation in various human and mammalian cells, and no data for brain cells are available, we studied by RT PCR the expression of six proinflammatory genes (Tlr2, Nf-kB1, Nf-kB2, Myd88, and Sting1 and Nlrp3 (both encoding DNA receptors)) and three genes associated with neuro- and neuritogenesis (Trkb, Bdnf, S100a8, and S100a9) at 1, 3, and 24 h in a series of independent experiments. The Ppia gene was used as an internal control gene.

Oxidized cfDNA induced transcription profile changes similar to multiplex analysis were noted after 1–3 h (Figure 2). The results show the dynamics common to all inflammatory genes: the maximum decrease in gene expression was noted after 1 h of incubation (Nf-kB1 4.02-fold, Nf-kB2 5.29-fold, Myd88 3.0-fold, Nlrp3 1.92-fold, Tlr2 2.3-fold, and Sting1 1.7-fold, p < 0.0002), followed by a gradual increase by 24 h to the control level (Nf-kB1, Nf-kB2, Myd88, Nlrp3) (Figure 2a–c,f). Some genes remained downregulated by the end of one day of incubation (Tlr2 and Sting1, both 1.6-fold, p < 0.00001) (Figure 2d,e). The results confirm that Bdnf gene expression does not change after 3 h of incubation; however, it is upregulated by oxidized cfDNA at 1 and 24 h (Figure 2g).

Figure 2.

Figure 2

RT PCR gene expression analysis of cells of rat cerebellum after oxidized cfDNA treatment for 1, 3, and 24 h. Bar charts illustrate expression level of (a) Nf-kB1, (b) Nf-kB2, (c) Myd88, (d) Tlr2, (e) Sting1, (f) Nlrp3, and (g) Bdnf. * p < 0.01: non-oxidized cfDNA and oxidized cfDNA vs. control; ^ p < 0.01: oxidized cfDNA vs. non-oxidized cfDNA. One-way ANOVA, Holm–Sidak method. The X-axis illustrates experimental conditions: duration from 1 to 24 h and cell exposure to non-oxidized (white) and oxidized (gray) cfDNA. Y-axis illustrates mRNA concentration (mRNA target gene/mRNA Ppia) compared to control.

Non-oxidized cfDNA exhibited activity later, and it was less prominent compared to the effect of oxidized cfDNA. Therefore, after 3 h of incubation of cells with fragments of non-oxidized cfDNA, a decrease in gene expression was noted for the following inflammation-related genes: Nf-kB1 (2.4-fold, p = 0.004), Nf-kB2 (2.6-fold p > 0.05), and Myd88 (2.1-fold, p = 0.011) (Figure 2). Only after 24 h, in response to non-oxidized cfDNA, was the expression of proinflammatory genes Nf-kB1 and Nf-kB2 increased (2.35-fold, p = 0.002 and 2.12-fold, p = 0.0146, respectively). In contrast, at 24 h and other time points, the oxidized cfDNA had no effect on the expression of inflammation-related genes. We could not assess only the expression of Trkb, S100a8, and S100a9 genes in repeated experiments by RT PCR because of weak signals presumably due to low mRNA yield and different sensitivities of the nCounter FLEX Analysis System and RT PCR.

4. Discussion

Cell-free DNA is a molecule that transmits stress signals to human and mammalian cells [15]. Oxidized cfDNA molecules or fragments exhibit significantly more activity compared to the non-oxidized form [15,16,17]. There are limited data on the effect of cfDNA on brain cells [16]. In the current work, we expanded the spectrum of the studied genes to assess the signaling cascades that may be involved in the early response of cells to non-oxidized vs. oxidized cfDNA treatment. We focused on the genes of inflammation, oxidation, antioxidation, DNA repair, apoptosis, autophagy, mitophagy, neurogenesis, neuroplasticity, and neuritogenesis. Investigation of no one of these groups was the main aim of our study. The results show that only oxidized cfDNA rapidly (in 3 h) altered the gene expression profile of brain cells. Despite that all upregulated genes (independently of whether pleiotropic they are or not) are involved in multiple functions, one function is common for these genes: they positively control pathways responsible for the development and maturation of new brain cells. These genes regulate neuritogenesis (S100A8/S100A9) [30], cell proliferation (S100B) [31], neurogenesis and neuroplasticity (TrkB [32], Ngf [33], NmdaR [34], Mapk1 [32,33], Pink1 [35,36]), and decreased inflammation and are associated with neurogenesis (Aqp4 [37], Kcnk2) [38,39]. On the contrary, genes encoding molecules involved in proinflammatory pathways and diminished neurogenesis (NF-kB1, Myd88, Cxcl1, and others) are suppressed (Figure 3 and Table S1).

Figure 3.

Figure 3

Hypothetical explanation of revealed alterations of gene expression in brain cells after 3 h oxidized cfDNA treatment. Upregulated genes are in red, and downregulated genes are in blue. Genes or cell components whose dynamics were not assessed are in gray, ligands of receptors are in orange, and receptors are in green. AA, arachidonic acid; cfDNA, cell-free DNA; ocfDNA, oxidized cfDNA.

An increase in cfDNA concentration occurs under both physiological and pathological conditions [5,6,7,8,9]. We assume that cfDNA has a beneficial or damaging effect depending on the duration of its increased concentration. States such as physical activity are characterized by a brief rise in cfDNA concentration [40], associated with stimulation of neurogenesis in adults [4,41]. Physical activity enhances neurogenesis in the hippocampus and improves cognitive functions by increasing cerebral blood flow, BBB permeability, angiogenesis, and expression of neurotrophic factors [4,41]. In addition, it has been shown that during training, the inflammatory process decreases [42]. It is also known that in humans, the concentrations of nuclear cfDNA and mitochondrial cfDNA (which contains an increased amount of 8-oxo-dG compared to nuclear DNA) are increased for several hours after a treadmill test [40]. In the current work, we show similar changes occurring in brain cells under the action of oxidized cfDNA at the level of gene transcription: an increase in the expression of genes associated with neurogenesis and a decrease in the expression of genes of the inflammatory, oxidation, and apoptosis/survival systems. On the other hand, the long-term increase in cfDNA observed in mental disorders is associated with poor outcomes, apparently due to chronic inflammation [11]. We have previously shown that 11-day exposure to oxidized cfDNA leads to decreased gene expression of the key components of the brain antioxidant system, heme oxygenase 1 (Hmox1) and the transcription factor Nrf2 [43]. These results warrant an extended analysis of the brain cell transcriptome following the chronic action of oxidized cfDNA, which has not been performed so far.

There are some limitations in our study. We used rat brain DNA thoroughly purified from proteins. However, in vivo, cfDNA can be formulated within the exosomes [18] or bind to proteins, such as HMGB1 [44]. It has been shown that HMGB1 acts to regulate neurogenesis and neuroplasticity in vivo and in vitro [44]. Whether cfDNA and HMGB1 could act together to target the neurogenesis/neuroplasticity of neural cells requires further studies. There is another limitation of our study: we used cerebellum primary cell culture. Despite data on existence of neurogenesis in adult cerebellum of vertebrates [45], the results may be confirmed in hippocampal cell cultures commonly employed in studies of neurogenesis.

Based on the transcriptional patterns of oxidized cfDNA in brain cells in vitro, as revealed in the present study, we suggest that the biological role of cfDNA might include increasing the preparedness of brain cells for damage. We believe that cfDNA liberated from severely damaged cells warns undamaged cells of possible failure by rapidly activating the transcription of genes that contribute to post-damage recovery of neurons and glial cells.

Thus, oxidized cfDNA is a molecule capable of rapidly switching gene expression toward activation of neurogenesis and neuroplasticity at an early stage of the insult, associated with cell death and liberation of cfDNA. An increased amount of cfDNA in the vicinity of bystander cells may be ruinous for them. Indeed, the chronic enhanced concentration of DNA in plasma is associated with poor outcomes in patients with diseases that involve massive cell death [19,46,47]. These data warrant future studies on determining the optimal non-oxidized cfDNA/oxidized DNA regimen to avoid neurotoxicity and excessive inflammation while maintaining neurogenesis and activating neuroplasticity for neurorepair.

Acknowledgments

Graphical abstract and Figure 3 were created by www.BioRender.com (last access was on 28 August 2021).

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/cimb43030112/s1, Table S1: Multiplex gene expression analysis of cells of rat cerebellum after oxidized and non-oxidized cfDNA treatment for 3 h, Table S2: Preparation of oxidized cell-free DNA from non-oxidized cell-free DNA.

Author Contributions

A.D.F. substantially contributed to the design of the study, the performance of the experiments, gene expression analysis, and data interpretation and was involved in the preparation of the manuscript and its publication. P.E.U. contributed to the performance of the experiments and took part in the revision of the manuscript and preparation for publication. V.M.P. and S.V.K. substantially contributed to the design of the study, data interpretation and the major revision of the manuscript, and gave final approval for this version to be published. All authors have read and approved the final version of the manuscript, and agree with the order of presentation of the authors.

Funding

The study was funded by RFBR grant no. 19-34-90072 and by the Ministry of Science and Higher Education of the Russian Federation, no. AAAA-A19-119032090049-0.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the ethical committee of the Research Centre for Medical Genetics (protocol no. 6/3, dated 14 September 2020).

Informed Consent Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Cameron H.A., McKay R.D. Adult neurogenesis produces a large pool of new granule cells in the dentate gyrus. J. Comp. Neurol. 2001;435:406–417. doi: 10.1002/cne.1040. [DOI] [PubMed] [Google Scholar]
  • 2.Spalding K.L., Bergmann O., Alkass K., Bernard S., Salehpour M., Huttner H.B., Boström E., Westerlund I., Vial C., Buchholz B.A., et al. Dynamics of hippocampal neurogenesis in adult humans. Cell. 2013;153:1219–1227. doi: 10.1016/j.cell.2013.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Schoenfeld T.J., Cameron H.A. Adult neurogenesis and mental illness. Neuropsychopharmacology. 2015;40:113–128. doi: 10.1038/npp.2014.230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Shohayeb B., Diab M., Ahmed M., Ng D.C.H. Factors that influence adult neurogenesis as potential therapy. Transl. Neurodegener. 2018;7:4. doi: 10.1186/s40035-018-0109-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Fatouros I.G., Destouni A., Margonis K., Jamurtas A.Z., Vrettou C., Kouretas D., Mastorakos G., Mitrakou A., Taxildaris K., Kanavakis E., et al. Cell-free plasma DNA as a novel marker of aseptic inflammation severity related to exercise overtraining. Clin. Chem. 2006;52:1820–1824. doi: 10.1373/clinchem.2006.070417. [DOI] [PubMed] [Google Scholar]
  • 6.Gambardella S., Limanaqi F., Ferese R., Biagioni F., Campopiano R., Centonze D., Fornai F. ccf-mtDNA as a Potential Link Between the Brain and Immune System in Neuro-Immunological Disorders. Front. Immunol. 2019;10:1064. doi: 10.3389/fimmu.2019.01064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.O’Connell G.C., Petrone A.B., Tennant C.S., Lucke-Wold N., Kabbani Y., Tarabishy A.R., Chantler P.D., Barr T.L. Circulating extracellular DNA levels are acutely elevated in ischaemic stroke and associated with innate immune system activation. Brain Inj. 2017;31:1369–1375. doi: 10.1080/02699052.2017.1312018. [DOI] [PubMed] [Google Scholar]
  • 8.Schneck E., Samara O., Koch C., Hecker A., Padberg W., Lichtenstern C., Weigand M.A., Uhle F. Plasma DNA and RNA differentially impact coagulation during abdominal sepsis-an explorative study. J. Surg. Res. 2017;210:231–243. doi: 10.1016/j.jss.2016.11.044. [DOI] [PubMed] [Google Scholar]
  • 9.Khubutia M.S., Shabanov A.K., Skulachev M.V., Bulava G.V., Savchenko I.M., Grebenchikov O.A., Sergeev A.A., Zorov D.B., Zinovkin R.A. Mitochondrial and Nuclear DNA in Patients with Severe Polytrauma. Gen. Reanimatol. 2013;9:24. doi: 10.15360/1813-9779-2013-6-24. [DOI] [Google Scholar]
  • 10.Li P., Stetler R.A., Leak R.K., Shi Y., Li Y., Yu W., Bennett M., Chen J. Oxidative stress and DNA damage after cerebral ischemia: Potential therapeutic targets to repair the genome and improve stroke recovery. Neuropharmacology. 2018;134:208–217. doi: 10.1016/j.neuropharm.2017.11.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Shmarina G.V., Ershova E.S., Simashkova N.V., Nikitina S.G., Chudakova J.M., Veiko N.N., Porokhovnik L.N., Basova A.Y., Shaposhnikova A.F., Pukhalskaya D.A., et al. Oxidized cell-free DNA as a stress-signaling factor activating the chronic inflammatory process in patients with autism spectrum disorders. J. Neuroinflamm. 2020;17:212. doi: 10.1186/s12974-020-01881-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ershova E.S., Jestkova E.M., Martynov A.V., Shmarina G.V., Umriukhin P.E., Bravve L.V., Zakharova N.V., Kostyuk G.P., Saveliev D.V., Orlova M.D., et al. Accumulation of Circulating Cell-Free CpG-Enriched Ribosomal DNA Fragments on the Background of High Endonuclease Activity of Blood Plasma in Schizophrenic Patients. Int. J. Genom. 2019;2019:8390585. doi: 10.1155/2019/8390585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Shock L.S., Thakkar P.V., Peterson E.J., Moran R.G., Taylor S.M. DNA methyltransferase 1, cytosine methylation, and cytosine hydroxymethylation in mammalian mitochondria. Proc. Natl. Acad. Sci. USA. 2011;108:3630–3635. doi: 10.1073/pnas.1012311108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yakes F.M., Van Houten B. Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc. Natl. Acad. Sci. USA. 1997;94:514–519. doi: 10.1073/pnas.94.2.514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Konkova M.S., Kaliyanov A.A., Sergeeva V.A., Abramova M.S., Kostyuk S.V. Oxidized Cell-Free DNA Is a Factor of Stress Signaling in Radiation-Induced Bystander Effects in Different Types of Human Cells. Int. J. Genom. 2019;2019:9467029. doi: 10.1155/2019/9467029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Filev A.D., Shmarina G.V., Ershova E.S., Veiko N.N., Martynov A.V., Borzikova M.A., Poletkina A.A., Dolgikh O.A., Veiko V.P., Bekker A.A., et al. Oxidized Cell-Free DNA Role in the Antioxidant Defense Mechanisms under Stress. Oxid. Med. Cell Longev. 2019;2019:1245749. doi: 10.1155/2019/1245749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kostyuk S.V., Konkova M.S., Ershova E.S., Alekseeva A.J., Smirnova T.D., Stukalov S.V., Kozhina E.A., Shilova N.V., Zolotukhina T.V., Markova Z.G., et al. An exposure to the oxidized DNA enhances both instability of genome and survival in cancer cells. PLoS ONE. 2013;8:e77469. doi: 10.1371/journal.pone.0077469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fernando M.R., Jiang C., Krzyzanowski G.D., Ryan W.L. New evidence that a large proportion of human blood plasma cell-free DNA is localized in exosomes. PLoS ONE. 2017;12:e0183915. doi: 10.1371/journal.pone.0183915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Boyapati R.K., Tamborska A., Dorward D.A., Ho G.T. Advances in the understanding of mitochondrial DNA as a pathogenic factor in inflammatory diseases. F1000Research. 2017;6:169. doi: 10.12688/f1000research.10397.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhivotosky B., Orrenius S. Assessment of apoptosis and necrosis by DNA fragmentation and morphological criteria. Curr. Protoc. Cell Biol. 2001;12 doi: 10.1002/0471143030.cb1803s12. [DOI] [PubMed] [Google Scholar]
  • 21.Ermakov A.V., Kostyuk S.V., Konkova M.S., Egolina N.A., Malinovskaya E.M., Veiko N.N. Extracellular DNA fragments. Ann. N. Y. Acad. Sci. 2008;1137:41–46. doi: 10.1196/annals.1448.024. [DOI] [PubMed] [Google Scholar]
  • 22.Van der Vaart M., Pretorius P.J. The origin of circulating free DNA. Clin. Chem. 2007;53:2215. doi: 10.1373/clinchem.2007.092734. [DOI] [PubMed] [Google Scholar]
  • 23.Swarup V., Rajeswari M.R. Circulating (cell-free) nucleic acids--a promising, non-invasive tool for early detection of several human diseases. FEBS Lett. 2007;581:795–799. doi: 10.1016/j.febslet.2007.01.051. [DOI] [PubMed] [Google Scholar]
  • 24.Zhong Z., Liang S., Sanchez-Lopez E., He F., Shalapour S., Lin X.J., Wong J., Ding S., Seki E., Schnabl B., et al. New mitochondrial DNA synthesis enables NLRP3 inflammasome activation. Nature. 2018;560:198–203. doi: 10.1038/s41586-018-0372-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Javadi A., Shamaei M., Mohammadi Ziazi L., Pourabdollah M., Dorudinia A., Seyedmehdi S.M., Karimi S. Qualification study of two genomic DNA extraction methods in different clinical samples. Tanaffos. 2014;13:41–47. [PMC free article] [PubMed] [Google Scholar]
  • 26.Filev A.D., Silachev D.N., Ryzhkov I.A., Lapin K.N., Babkina A.S., Grebenchikov O.A., Pisarev V.M. Effect of Xenon Treatment on Gene Expression in Brain Tissue after Traumatic Brain Injury in Rats. Brain Sci. 2021;11:889. doi: 10.3390/brainsci11070889. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Gubern C., Hurtado O., Rodríguez R., Morales J.R., Romera V.G., Moro M.A., Lizasoain I., Serena J., Mallolas J. Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of cerebral ischaemia. BMC Mol. Biol. 2009;10:57. doi: 10.1186/1471-2199-10-57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Swijsen A., Nelissen K., Janssen D., Rigo J.M., Hoogland G. Validation of reference genes for quantitative real-time PCR studies in the dentate gyrus after experimental febrile seizures. BMC Res. Notes. 2012;5:685. doi: 10.1186/1756-0500-5-685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Gholami K., Loh S.Y., Salleh N., Lam S.K., Hoe S.Z. Selection of suitable endogenous reference genes for qPCR in kidney and hypothalamus of rats under testosterone influence. PLoS ONE. 2017;12:e0176368. doi: 10.1371/journal.pone.0176368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Sun J., Pan X., Christiansen L.I., Yuan X.L., Skovgaard K., Chatterton D.E.W., Kaalund S.S., Gao F., Sangild P.T., Pankratova S. Necrotizing enterocolitis is associated with acute brain responses in preterm pigs. J. Neuroinflamm. 2018;15:180. doi: 10.1186/s12974-018-1201-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Bresnick A.R., Weber D.J., Zimmer D.B. S100 proteins in cancer. Nat. Rev. Cancer. 2015;15:96–109. doi: 10.1038/nrc3893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lima Giacobbo B., Doorduin J., Klein H.C., Dierckx R.A.J.O., Bromberg E., de Vries E.F.J. Brain-Derived Neurotrophic Factor in Brain Disorders: Focus on Neuroinflammation. Mol. Neurobiol. 2019;56:3295–3312. doi: 10.1007/s12035-018-1283-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Marlin M.C., Li G. Biogenesis and function of the NGF/TrkA signaling endosome. Int. Rev. Cell Mol. Biol. 2015;314:239–257. doi: 10.1016/bs.ircmb.2014.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Åmellem I., Yovianto G., Chong H.T., Nair R.R., Cnops V., Thanawalla A., Tashiro A. Role of NMDA Receptors in Adult Neurogenesis and Normal Development of the Dentate Gyrus. eNeuro. 2021;8 doi: 10.1523/ENEURO.0566-20.2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Agnihotri S.K., Sun L., Yee B.K., Shen R., Akundi R.S., Zhi L., Duncan M.J., Cass W.A., Büeler H. PINK1 deficiency is associated with increased deficits of adult hippocampal neurogenesis and lowers the threshold for stress-induced depression in mice. Behav. Brain Res. 2019;363:161–172. doi: 10.1016/j.bbr.2019.02.006. [DOI] [PubMed] [Google Scholar]
  • 36.Brown S.J., Boussaad I., Jarazo J., Fitzgerald J.C., Antony P., Keatinge M., Blechman J., Schwamborn J.C., Krüger R., Placzek M., et al. PINK1 deficiency impairs adult neurogenesis of dopaminergic neurons. Sci. Rep. 2021;11:6617. doi: 10.1038/s41598-021-84278-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Liang R., Yong S., Huang X., Kong H., Hu G., Fan Y. Aquaporin-4 Mediates the Suppressive Effect of Lipopolysaccharide on Hippocampal Neurogenesis. Neuroimmunomodulation. 2016;23:309–317. doi: 10.1159/000467141. [DOI] [PubMed] [Google Scholar]
  • 38.Djillani A., Mazella J., Heurteaux C., Borsotto M. Role of TREK-1 in Health and Disease, Focus on the Central Nervous System. Front Pharmacol. 2019;10:379. doi: 10.3389/fphar.2019.00379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Fang Y., Tian Y., Huang Q., Wan Y., Xu L., Wang W., Pan D., Zhu S., Xie M. Deficiency of TREK-1 potassium channel exacerbates blood-brain barrier damage and neuroinflammation after intracerebral hemorrhage in mice. J. Neuroinflamm. 2019;16:96. doi: 10.1186/s12974-019-1485-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Hummel E.M., Hessas E., Müller S., Beiter T., Fisch M., Eibl A., Wolf O.T., Giebel B., Platen P., Kumsta R., et al. Cell-free DNA release under psychosocial and physical stress conditions. Transl. Psychiatry. 2018;8:236. doi: 10.1038/s41398-018-0264-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Seo J.H., Park H.S., Park S.S., Kim C.J., Kim D.H., Kim T.W. Physical exercise ameliorates psychiatric disorders and cognitive dysfunctions by hippocampal mitochondrial function and neuroplasticity in post-traumatic stress disorder. Exp. Neurol. 2019;322:113043. doi: 10.1016/j.expneurol.2019.113043. [DOI] [PubMed] [Google Scholar]
  • 42.Małkiewicz M.A., Szarmach A., Sabisz A., Cubała W.J., Szurowska E., Winklewski P.J. Blood-brain barrier permeability and physical exercise. J. Neuroinflamm. 2019;16:15. doi: 10.1186/s12974-019-1403-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Filev A.D., Kostyuk S.V., Pisarev V.M., Tabakov V.Y., Umriukhin P.E. Adaptive anti-oxidative responses to chronic exposure to stress-signaling molecule, oxidized cell-free DNA, in rat neural cells. IOP Conf. Ser. Earth Environ. Sci. 2020;548:072039. doi: 10.1088/1755-1315/548/7/072039. [DOI] [Google Scholar]
  • 44.Zhao X., Rouhiainen A., Li Z., Guo S., Rauvala H. Regulation of Neurogenesis in Mouse Brain by HMGB1. Cells. 2020;9:1714. doi: 10.3390/cells9071714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Carletti B., Rossi F. Neurogenesis in the cerebellum. Neuroscientist. 2008;14:91–100. doi: 10.1177/1073858407304629. [DOI] [PubMed] [Google Scholar]
  • 46.Jackson Chornenki N.L., Coke R., Kwong A.C., Dwivedi D.J., Xu M.K., McDonald E., Marshall J.C., Fox-Robichaud A.E., Charbonney E., Liaw P.C. Comparison of the source and prognostic utility of cfDNA in trauma and sepsis. Intensive Care Med. Exp. 2019;7:29. doi: 10.1186/s40635-019-0251-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Pisarev V.M., Chumachenko A.G., Filev A.D., Ershova E.S., Kostyuk S.V., Veiko N.N., Grigoriev E.K., Elysina E.V., Cherpakov R.A., Tutelyan A.V. Combination of DNA Molecular Biomarkers in the Prediction of Critical Illness Outcome. Gen. Reanimatol. 2019;15:31–47. doi: 10.15360/1813-9779-2019-3-31-47. (In Russian) [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Current Issues in Molecular Biology are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES