Brain-derived autophagosome profiling reveals the engulfment of nucleoid-enriched mitochondrial fragments by basal autophagy in neurons

Juliet Goldsmith; Alban Ordureau; J Wade Harper; Erika L F Holzbaur

doi:10.1016/j.neuron.2021.12.029

. Author manuscript; available in PMC: 2023 Mar 16.

Published in final edited form as: Neuron. 2022 Jan 19;110(6):967–976.e8. doi: 10.1016/j.neuron.2021.12.029

Brain-derived autophagosome profiling reveals the engulfment of nucleoid-enriched mitochondrial fragments by basal autophagy in neurons

Juliet Goldsmith ¹, Alban Ordureau ^2,³, J Wade Harper ², Erika L F Holzbaur ^1,⁴

PMCID: PMC8930448 NIHMSID: NIHMS1772846 PMID: 35051374

Summary

Neurons depend on autophagy to maintain cellular homeostasis, while defects in autophagy are pathological hallmarks of neurodegenerative disease. To probe the role of basal autophagy in the maintenance of neuronal health, we isolated autophagic vesicles from mouse brain tissue and used proteomics to identify the major cargos engulfed within basal autophagosomes, validating our findings in rodent primary and human iPSC-derived neurons. Mitochondrial proteins were identified as a major cargo in the absence of mitophagy adaptors such as OPTN. We find that nucleoid-associated proteins are enriched compared to other mitochondrial components. In the axon, autophagic engulfment of nucleoid-enriched mitochondrial fragments requires the mitochondrial fission machinery Drp1. We propose that localized Drp1-dependent fission of nucleoid-enriched fragments in proximity to sites of autophagosome biogenesis enhances their capture. The resulting efficient autophagic turnover of nucleoids may prevent accumulation of mitochondrial DNA in the neuron, thus mitigating activation of pro-inflammatory pathways that contribute to neurodegeneration.

eTOC

Autophagy is a conserved pathway for degradation of aggregated proteins and dysfunctional organelles that is required for neuronal homeostasis. Goldsmith et al. perform proteomic profiling of cargos degraded by autophagy in brain and neurons under basal conditions, identifying turnover of mitochondrial nucleoids as a primary function of neuronal autophagy.

Graphical Abstract

graphic file with name nihms-1772846-f0001.jpg

Introduction

Autophagy is a highly conserved cellular degradation and recycling process that initiates with the formation of a double membrane at the omegasome complex, associated with the endoplasmic reticulum (ER) in mammalian cells. The resulting phagophore elongates through a series of conjugation events that include the insertion of lipidated Atg8-family proteins into the growing membrane of the nascent autophagosome. Cargos destined to be degraded by autophagy are captured by the forming autophagosome either through stochastic bulk engulfment of proteins and small organelles in the vicinity, or more selectively via autophagy receptors that deliver specific, often ubiquitylated, cargo to Atg8-family proteins.

A number of studies have begun to define autophagy cargo across model systems. These experiments have employed isolation techniques including differential centrifugation (Dengjel et al., 2012; Mancias et al., 2014; Øverbye et al., 2007), selective pull-downs of Atg8-family proteins (Behrends et al., 2010; Gao et al., 2010; Schmitt et al., 2021), or proximity labeling (Le Guerroué et al., 2017; Zellner et al., 2021). Still to be determined are the cargos degraded by autophagy in neurons under basal conditions. Neurons are post-mitotic and long-lived cells, and thus uniquely dependent on the efficient clearance of damaged proteins and dysfunctional organelles via autophagy. Neuron-specific knockout of essential components of the autophagy machinery is sufficient to induce rapid neurodegeneration in mice (Hara et al., 2006; Komatsu et al., 2006). Furthermore, mutations impacting the autophagy pathway contribute to inherited neurodegenerative diseases including ALS/FTD and Parkinson’s disease (van Beek et al., 2018), while evidence of impaired autophagy is found in post-mortem brain samples from Alzheimer’s, Huntington’s and Parkinson’s disease patients (Anglade et al., 1997; Nixon et al., 2005; Tellez-Nagel et al., 1974). The unique dependence of neurons on autophagy to maintain cellular homeostasis is reflected in the spatially-specific regulation of the pathway; autophagosomes form constitutively at synaptic sites and in the distal axon, fuse with lysosomes and are trafficked toward the soma as cargo degradation proceeds (Hill & Colón-Ramos, 2020).

Here, we utilized proteomics to define the proteins captured by basal autophagy in mouse brain. We validate our key findings in primary rodent neurons and human iPSC-derived neurons. We find that both synaptic proteins and mitochondrial fragments are basal cargo in brain- and neuron-derived autophagosomes, and we demonstrate a Drp1-dependent mechanism for efficient capture of nucleoid-enriched mitochondrial fragments by locally-forming axonal autophagosomes. The clearance of nucleoids may be part of an essential homeostatic pathway that balances local energy demands with the mitigation of neuroinflammatory risk posed by accumulation of mitochondrial DNA.

Results and Discussion

Prior studies have reported the proteins that accumulate following knockout of essential autophagy genes in neurons and other cell types (An et al., 2019, 2020; Kuijpers et al., 2021; Mathew et al., 2014; T. Zhang et al., 2016). Here we sought to identify cargos degraded by autophagy in a minimally perturbed system. We used differential centrifugation on discontinuous Nycodenz and Percoll gradients to enrich for autophagic vesicles (AVs) (Figure 1A) (Maday et al., 2012; Strømhaug et al., 1998), which include both newly formed autophagosomes (APs) and APs that have fused with lysosomes to form autophagolysomes (APLs). This enrichment protocol avoids selection based on a single marker, thus including mature AVs in which Atg8 family proteins have been externally cleaved by Atg4. Following AV enrichment, we include a Proteinase K digestion step to distinguish between autophagosome cargo destined for degradation and externally associated proteins such as the motors and adaptors that transport AVs retrogradely along the axon (Boecker et al., 2021; Cason et al., 2021).

Immunoblots demonstrate that our protocol enriches for AVs marked by lipidated LC3 (LC3-II) (Figure 1B, Figure S1A). Consistent with this enrichment, 70% of vesicles isolated from a GFP-LC3B-expressing transgenic mouse were positive for GFP (Figure 1C). This represents the lower limit of AV enrichment achieved by fractionation, as not all AVs are expected to incorporate the GFP-LC3B marker. The AV fraction excludes markers of other organelles, including the nucleus, Golgi, ER, and early endosomes (Figure S1B–G). Rab7 and Rab11, which mark both late endosomes and AVs, were present in the AV fraction, but degraded by Proteinase K, indicating an association with the external AV membrane (Figure S1C, F) (Kuchitsu et al., 2018; Szatmari et al., 2014). Similarly, markers of lysosomes/late endosomes and multivesicular bodies were also degraded by Proteinase K, consistent with evidence that newly formed APs fuse rapidly with lysosomes (Figure S1D, G–H) (Maday et al., 2012). Although lysosomal markers were present on the surface of the AVs, most AVs were not acidified, as ~1% of GFP-LC3 AVs enriched from brain were positive for the acidic organelle dye LysoTracker, with an equivalent number identified LysoTracker+;GFP-LC3− (Figure S1I). We examined AV morphology by electron microscopy (EM), and found that >85% of vesicles were clearly delimited by a double membrane, the defining feature of an AP, while ~3% of vesicles were electron-dense, suggestive of APLs (Figure S1J, K). Combined, these findings indicate 80–90% of isolated vesicles are bona fide autophagosomes, of which 2–3% are acidified APLs.

Proteomics identify cargos of basal autophagy in the brain

We performed tandem mass tag liquid chromatography mass spectrometry (MS) on the AV and AV + Proteinase K fractions from 7–8 month old mouse brains (Table S1: Proteomic profiling of autophagosomes from mouse brain). The ratio of AV+PK/AV, which we call the cargo score, gives an indication of the likelihood that the identified protein is an autophagic cargo destined for degradation. A ranked cargo score plot of brain-derived AVs from five biological replicates displays 4190 unique proteins (ranked horizontally) with a median cargo score of 0.331 (Figure S2A). We find significant enrichment of two major cargo types: synaptic proteins and mitochondrial proteins. The engulfment and clearance of synaptic and mitochondrial markers by autophagosomes in neurons has been previously noted (Hoffmann et al., 2019; Maday et al., 2012), but here we find that under basal conditions these cargos are major substrates for autophagy in adult mammalian brain.

Previous studies have identified the autophagic degradation of proteasome components in fibroblasts and cancer cell lines (Dengjel et al., 2012; Schmitt et al., 2021; T. Zhang et al., 2016), yet we did not observe an enrichment of proteasome proteins in brain-derived AVs, suggesting cell-type specificity (Figure S2B). A significant accumulation of ER proteins was found in Atg5-deficient neurons (Kuijpers et al., 2021); While we found calnexin, but not calreticulin, in our AV fraction consistent with Atg5-deficient neurons (Figure S1B), gene ontology analysis did not identify the ER as one of the top terms (Figure S2C,D). This may reflect differences between the analysis of basal cargos from adult brain performed here and the analysis of long-term cargo accumulation throughout neuron development, as autophagy plays a role in remodeling the ER early in neuronal differentiation (Ordureau et al., 2021).

To further validate our proteomics dataset, we examined the autophagic engulfment of synaptic proteins, which comprised 16.6% of all proteins identified from the AV-enriched fraction isolated from mouse brain (Figure 1D). We found a significant enrichment of synaptic proteins (p=2.93⁻⁴⁵) by gene ontology analysis (Figure 1E), and confirmed that synapsin I, VAMP2 and synaptophysin were present in brain-derived AVs by immunoblotting (Figure 1F(i), Figure S3A,B). Both pre- and post-synaptic proteins were identified (Figure 1E, Figure S3C, D), which may reflect engulfment of synaptic proteins in neurons and/or glia within the brain; assessing the relative contributions of neuronal and glial autophagy to synaptic protein turnover will require further investigation (Figure S3E, F).

To test if synapsin is a cargo for autophagy within neurons, we performed a parallel AV enrichment from human iPSC-derived glutamatergic neurons (i³Neurons; Fernandopulle et al., 2018). Immunoblots indicate that synapsin I is present in both the AV and Proteinase K-protected fractions (Figure 1F(ii)). To verify that synapsin I is present within LC3-positive AVs, we generated an AV fraction from the brains of GFP-LC3 transgenic mice and performed a GFP pulldown to select for LC3-positive AVs only. Immunoblotting of the pulldown fraction showed synapsin I is an autophagic cargo (Figure 1G). We also performed live imaging in rat primary hippocampal neurons co-expressing GFP-LC3 and mCherry-Synapsin; ~60% of retrogradely trafficking axonal AVs marked by LC3, were positive for synapsin (Figure 1H, Figure S3G). These data are consistent with previous findings on the autophagic turnover of synaptic proteins (Compans et al., 2021; Hoffmann-Conaway et al., 2020; Hoffmann et al., 2019; Nikoletopoulou et al., 2017; Shehata et al., 2012), and further validate our AV enrichment protocol. While these studies demonstrate a role for basal autophagy in synaptic maintenance, future work is required to determine whether autophagy preferentially turns over “old” synaptic vesicle proteins as predicted (Truckenbrodt et al., 2018).

Mitochondrial fragments are engulfed by basal autophagy in neurons

20% of all identified proteins from our MS analysis are annotated as mitochondrial proteins; gene ontology analysis by Enrichr found a significant enrichment for mitochondrial proteins (p = 9.5⁻⁵⁵) (Figure 2A,B). Immunoblotting confirmed the copurification of mitochondrial proteins, including SOD1, cytochrome-c, and MIRO2 in AVs isolated from mouse brain (Figure S4A–B, Ci–xi). Other mitochondrial proteins such as succinate dehydrogenase A (SDHA) were less abundant in the AV fraction, suggesting differential autophagic turnover of mitochondrial proteins in mouse brain, comparable to observations from Drosophila (Vincow et al., 2019).

Figure 2: — A. Total fraction (donut plot inset) and ranked cargo score plot of proteomics data, highlighting mitochondrial proteins green. Median cargo score is depicted as dashed lines. Of the proteins that had cargo scores greater than the median value (2098), 385 (18%) were mitochondrial. B. Graph of p-values of the top gene ontology terms for Cellular Component from the Enrichr database. C. Representative electron micrographs. Indicated are the double membrane (arrow), AVs with mitochondria-like cargo (red boxes; i-ii, iv-viii), AVs with synaptic vesicle-like cargo (dashed boxes; iii, viii), and AVs with heterogenous cargo (i-iii, vii-viii). D. Quantification of types of AV cargo from EM (n=3, total events = 1409). E. Quantification of diameter of AVs and mitochondrial cargo by EM (n=3, total events ≥ 1262). F. AVs enriched from GFP-LC3 transgenic mouse brain homogenate were stained using MitoTracker Deep Red and imaged by spinning disk microscopy (n=4); (i-iii) representative image, percent of GFP-LC3+, MitoTracker+ puncta was quantified over (iv) all events counted and (v) biological replicates. G. Ranked cargo score plot, highlighting autophagy receptors in red. H-I. Select representative images and quantification of immunoblotting, normalized to total protein levels, for autophagy receptors and mitophagy-related proteins in brain-derived AVs (n≥3). See Figure S4(x–xiv) for additional representative immunoblots.

EM analysis confirmed the engulfment of mitochondrial fragments by AVs, as 50% of double membrane vesicles contained cargos with morphologically identifiable mitochondrial-like structure (Figure 2C–E). The median diameter of mitochondrial fragments engulfed within AVs is 0.59μm (95% CI = 0.58–0.61), much larger than mitochondrial-derived vesicles (Sugiura et al., 2014). MitoTracker staining of brain-derived GFP-LC3-positive AVs similarly demonstrated ~50% colocalization (Figure 2F), and suggests that mitochondrial fragments within AVs maintain their membrane potential.

Importantly, our data suggest that the mitochondrial fragments are not targeted to APs by PINK1/Parkin-dependent mitophagy. We found no enrichment of either PINK1 or Parkin, nor the selective autophagy receptors optineurin (OPTN), p62/SQSTM1, NDP52, BNIP3L (Nix), or TAX1BP1, by either MS or immunoblotting (Figure 2G–I, Figure S4Cx–xiv). In contrast, we did note a higher cargo score for the mitophagy and innate-immunity linked protein TBK1 (Figure 2G), recently suggested to associate with mitochondria under homeostatic conditions (Harding et al., 2021). These findings are consistent with PINK1/Parkin-independent autophagic clearance of mitochondria in the absence of induced mitochondrial damage (Le Guerroué et al., 2017; McWilliams et al., 2018; Ordureau et al., 2021).

Mitochondrial nucleoids are enriched in neuronal AVs

To further define which mitochondrial proteins are more likely to be autophagy cargo, we annotated the mitochondrial proteins identified by proteomics based on sub-organellar location/function. We found that proteins associated with mitochondrial DNA (mtDNA) had significantly higher cargo scores compared to all mitochondrial proteins or to proteins within the mitochondrial matrix or electron transport chain (Figure 3A,B, Figure S5A).

Figure 3: — A. Ranked cargo score plot, highlighting well-characterized mitochondrial nucleoid proteins (red) and nucleoid-associated proteins (pink) (He et al., 2012). B. Plot of median cargo scores across different subgroups of mitochondrial proteins (mean ± SEM, n=5, ANOVA with Dunnett’s). See Figure S5A for violin plot of individual protein values. C. Representative immunoblot and quantification of levels of TFAM, normalized to total protein, from brain-derived input, crude mitochondrial preparations, and AV fractions (n≥5; ANOVA with Šídák’s). D. Representative immunoblot and quantification, normalized to total protein levels, from GFP-LC3 mouse brain-derived AVs subsequently immunoprecipated with anti-GFP antibody, Protein A was the negative control (n=3, ANOVA with Šídák’s for TFAM and LC3-II, Kruskal-Wallis with Dunn for GFP). Pulldown (IP) and flow-through (FT) fractions are shown. E-F. Representative immunoblot and quantification of levels of TFAM, normalized to total protein levels, from AV fractions from (E) i³Neurons (n=8) and (F) primary cortical neurons (n=4), (ANOVA with Šídák’s). G. Representative confocal microscopy images and quantification of AVs enriched from brain homogenate stained for membrane (CMDR) or nucleic acids (SYBR gold) (n=3). H. qPCR for nuclear DNA (LINE sequences L1MdTf1 and L1MdTf2) and mitochondrial DNA (ND2, ND5, and COXII) was performed on DNA extracted from brain-derived AVs. The relative fold change (2^ΔΔCT) is plotted (mean ± SEM, n=4, ANOVA with Dunnett’s).

mtTFA/TFAM is an activator of mitochondrial transcription and a commonly used marker for mitochondrial nucleoids. TFAM is ~4-fold enriched in AVs compared to brain lysate, and 2.5-fold enriched over mitochondrial fractionation from brain by immunoblot (Figure 3C). To confirm that TFAM is engulfed within AVs, we performed a GFP pulldown on AVs derived from GFP-LC3 transgenic mouse brains. We found a 5-fold enrichment of TFAM in the GFP pulldown compared to input, indicating TFAM is present and enriched within LC3-positive AVs (Figure 3D).

To test whether the enrichment of TFAM in AVs occurs in neurons, we immunoblotted AVs isolated from either i³Neurons or primary mouse cortical neurons and found TFAM was present in both (Figure 3E,F). In contrast, AVs from pre-differentiated iPSCs did not have a similar levels of TFAM, suggesting the enrichment of nucleoids within AVs is neuron (and potentially glia) specific (Figure S5B). Consistent with this possibility, meta-analysis shows nucleoid proteins are not enriched as autophagy cargo in other cell types compared to our findings in brain and neurons (Table S2: Meta-analysis of mtDNA associated proteins identified through autophagosome proteomics, related to Figure 3). One potential explanation is the higher copy number of mtDNA in the brain compared to other tissues, (X. Zhang et al., 2020), resulting in increased basal turnover. A congruent hypothesis is that post-mitotic neurons remove extraneous mitochondria via autophagy unlike actively dividing cells.

We found approximately 50% of all vesicles from the AV fraction were positive for nucleic acids by SYBR staining (Figure 3G). To confirm the vesicles detected were bona fide AVs, we immunoprecipitated AVs with an anti-LC3 antibody attached to a coverslip, validated the pulldown efficacy (Figure S5C), and stained for nucleic acid with SYBR (Figure S5D), finding consistently that ~50% of the AVs contain nucleic acids. To determine whether this represented mtDNA, we performed qPCR with primers specific for mouse mtDNA (ND2, ND5, and COXII) or nuclear DNA (LINE1) on brain-derived AVs compared to brain lysate. We found mtDNA was 150-fold enriched over nuclear DNA in AVs (Figure 3H). Thus we demonstrate that basal neuronal autophagy engulfs mitochondrial fragments containing nucleoids, with no evidence that canonical mitophagy proteins or receptors are involved.

Nucleoid-enriched mitochondrial fragment engulfment by axonal autophagy requires Drp1-dependent mitochondrial fission

To validate the presence of nucleoids within AVs in live neurons, we expressed tagged TFAM and LC3 in primary rat hippocampal neurons for live imaging of AVs travelling retrogradely in the axon. GFP-LC3 and mCherry-LC3 colocalize, and therefore we use these markers interchangeably to identify AVs (Figure S6A). 10–20% of AVs identified by tagged LC3 were positive for either mito-dsRed or Cox8a respectively, consistent with previous reports (Maday et al., 2012; Wong & Holzbaur, 2014). In contrast, 40% of trafficking AVs were positive for TFAM (Figure 4A–C, Figure S6B). Thus, autophagic engulfment of nucleoid-enriched mitochondrial fragments occurs under basal conditions in the axon.

Figure 4: — A-C. (A) Representative kymographs and (B-C) quantification from primary hippocampal neurons expressing markers of mitochondria (mito-dsRed and Cox8a-BFP) or Snap-TFAM and fluorescently tagged LC3 (as indicated) as a marker for AVs. (Ai: yellow = mito-dsRed+, LC3+ trafficking AV; green = LC3+ AV; red = mito-dsRed+ vesicle; Aii: yellow = TFAM+, LC3+ trafficking AV; green = TFAM+ vesicle; red = LC3+ AV) (Bar = mean ± SEM, n≥4, ANOVA with Šídák’s). D-F. (D) Representative kymograph and (E-F) quantification from primary hippocampal neurons expressing GFP-LC3 to identify AVs, Snap-TFAM and mCherry-Synapsin to identify co-trafficking of AV cargo. (D: yellow = TFAM+, synapsin+, LC3+ trafficking AV; red= synapsin+, LC3+ trafficking AV; cyan = TFAM+ vesicle) (Bar = mean ± SEM, n=4 ANOVA with Šídák’s) G-I. (G) Representative kymograph and (H-I) quantification from primary hippocampal neurons expressing GFP-tagged wild-type Drp1 or dominant negative Drp1^K38A with Snap-TFAM, Cox8a-BFP and mCherry-LC3. (G: yellow = TFAM+, LC3+ trafficking AV; red = LC3+ AV; cyan = Cox8a+, TFAM+ vesicle; blue = Cox8a+ vesicle) (Bar = mean ± SEM, n=3, ANOVA with Šídák’s). J. Representative immunoblot and quantification of levels of mitochondrial fission machinery, normalized to total protein, from brain-derived AVs (Bar = mean ± SEM, n≥3, ANOVA with Šídák’s). Additional representative immunoblot in Figure S6C. K. Model of engulfment of nucleoid-enriched mitochondrial fragments by forming APs in neurons.

EM suggested that the contents of autophagosomes can be heterogenous (Figure 2C), so we investigated whether two validated AV cargos from neurons, TFAM and synapsin, are individually engulfed by APs or capable of co-capture, suggestive of bulk engulfment. Consistent with non-selective uptake, we found that about half of synapsin-positive trafficking AVs were also positive for TFAM (Figure 4D–F).

Mitochondrial dynamics via fission and fusion are essential for their function. Drp1-dependent fission has been shown to occur at mitochondria-ER contact sites, which also define sites of mtDNA replication (Friedman et al., 2011; Lewis et al., 2016). We investigated whether mitochondrial fission machinery was required for basal autophagic capture of nucleoid-enriched mitochondrial fragments. Overexpression of dominant negative Drp1 (GFP-Drp1^K38A) abrogated the levels of TFAM within AVs (Figure 4G–I). Drp1 is necessary but not sufficient for AV engulfment of nucleoid-enriched mitochondrial fragments, as overexpression of wildtype Drp1 did not lead to increased levels of TFAM in trafficking AVs (Figure 4H). Fission factors that distinguish the fate of the mitochondrial fragments have recently been described (Kleele et al., 2021): products of ER-associated, Mff-dependent fission commonly contain mtDNA and contribute to mitochondrial biogenesis, whereas products of lysosome-associated, Fis1-dependent fission commonly contain markers of mitochondrial damage and are degraded via mitophagy. Immunoblotting analysis indicates that Mff, but not Drp1, Fis1, or mitochondrial fusion proteins, is present in our AV fractions (Figure 4J, Figure S6C,D), suggesting axonal autophagosomes engulf nucleoid-containing mitochondrial fragments generated through normal, rather than damage-induced, fission processes.

What is driving nucleoid-enriched mitochondrial fragments to APs in the absence of autophagy receptors? We postulate that in neurons, Drp1- and Mff-dependent mitochondrial fission occurs at mitochondria-ER contact sites, which ensures that nucleoid-enriched mitochondrial fragments are generated in close proximity to phagophore formation from ER-associated omegasomes. Thus, newly forming APs are optimally localized to sweep up nucleoid-enriched mitochondrial fragments through bulk engulfment without necessitating adaptor proteins (Figure 4K). Whether this pathway contributes to maintaining mitochondrial genome integrity, as recently ascribed to PINK1/Parkin mitophagy (Ahier et al., 2021), remains to be determined. This model predicts that disruption of basal autophagy, either by aging (Stavoe et al., 2019) or neurodegenerative disease mutations, would result in mtDNA accumulation that may sensitize neurons to pro-inflammatory signaling (Borsche et al., 2020). As mutant TDP-43 and Huntingtin were recently demonstrated to induce release of mtDNA and mtRNA respectively, resulting in inflammation (Lee et al., 2020; Yu et al., 2020), further deficits in autophagy with age could exacerbate pathogenic inflammation in neurodegenerative disease by increasing mtDNA levels.

We speculate that basal autophagy maintains homeostatic balance in the neuron, in great part because of the non-selective nature of turnover. Because both mitochondria and synapse proteins were identified as key cargo, basal autophagy may balance energy production with the demands of synaptic transmission. Our evidence strongly suggests autophagic engulfment of nucleoid-enriched mitochondrial fragments is a distinct pathway from the targeted removal of damaged mitochondria, therefore a balance between the two processes could maintain a healthy mitochondrial population locally and temporally. Lastly, basal autophagy may balance the high energy requirements of neurons with the increased inflammation risk caused by accumulation of mtDNA.

STAR Methods

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Erika Holzbaur (holzbaur@pennmedicine.upenn.edu).

Materials availability

Plasmids used in this study are available upon request.

Data and code availability

The full proteomic data sets reported here are included in the supplement (Table S1). All other data are available from the lead contact upon request.
No original code was generated in the course of this study.
Any additional data or information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Animal models

For mass spectrometry and immunoblotting analysis of brain-derived autophagic vesicles, wildtype and GFP-LC3B transgenic mice (strain: B6Cg-Tg(CAG-EGFP/LC3)53Nmi/NmiRbrc) generated by Mizushima et al, 2004 and available from RIKEN BioResource Center in Japan (PMID 14699058) of both sexes at 7–8months of age were euthanized according to University of Pennsylvania Institutional Animal Care and Use Committee approved procedures and the brain above the brainstem was removed and homogenized in a sucrose buffer (see method details).

Cell lines, primary cultures

Primary rat hippocampal neurons from E18 Sprague Daly rats were purchased through the University of Pennsylvania Neuron Culture Service Center facility– the sex of the rats was not determined. Primary mouse cortical neurons were dissected and cultured in our lab. Briefly, E15.5 embryos from B6NTac (model #B6) mice were dissected and the cortex was removed and dissociated with 0.25% trypsin and trituration. Neurons were plated in attachment media (MEM supplemented with 10% horse serum, 33 mM D-glucose and 1 mM sodium pyruvate) on poly-L-lysine coated 35 mm glass-bottom imaging dishes (P35G-1.5–20-C; MatTek). After 4–6h, media was replaced with maintenance media (Neurobasal [GIBCO] supplemented with 2% B-27 [GIBCO], 33 mM D-glucose [Sigma], 2 mM GlutaMAX [GIBCO], 100 U/mL penicillin and 100 mg/mL streptomycin [Sigma]). AraC (1 μM) was added the day after plating to prevent glia cell proliferation. Every 3–4 days, 40% of the media was replaced with fresh Maintenance Media and at DIV7–9 the neurons were used for imaging or biochemical analysis.

Human i³N iPSCs that harbor a doxycycline-inducible mNGN2 transgene in the AAVS1 safe-harbor locus were a gift from Dr. Michael Ward (National Institutes of Health), and the characterization, culture, and differentiation protocols can be found (Fernandopulle et al 2018; Wang et al 2017; Boecker et al 2020). i³Neurons differentiate with >90% efficiency into glutamatergic neurons and become synaptically connected in culture. Briefly, iPSCs were cultured on Growth Factor Reduced Matrigel (Corning) in Essential 8 medium (ThermoFisher). Cytogenetic analysis of G-banded metaphase cells demonstrated a normal male karyotype. Cells are periodically tested for mycoplasma. Differentiation into i³Neurons was achieved by splitting the iPSCs with Accutase (Sigma) for a single cell suspension and plating on Matrigel-coated dishes in induction medium (DMEM/F12 supplemented with 2μg/mL doxycycline, 1% N2 supplement (Gibco), 1% non-essential amino acids (Gibco) and 1% GlutaMAX (Gibco). After three days, pre-differentiated i³Neurons were dissociated and plated onto poly-L-ornithine coated plates or imaging dishes at optimal densities. i³Neurons were cultured in BrainPhys Neuronal Medium (StemCell) supplemented with 2% B27 (GIBCO), 10 ng/mL BDNF (PeproTech), 10 ng/mL NT-3 (PeproTech) and 1 μg/mL Laminin (Corning) for 21 days prior to experimentation. Every 3–4 days, 40% of the medium was replaced with fresh culture medium. For each experiment, a biological replicate is defined as cells from different batches of inductions.

METHOD DETAILS

Isolation of autophagic vesicles by differential centrifugation

Enriched autophagosome fractions were isolated following a protocol modified from Strømhaug et al., 1998 and Maday et al., 2014. Briefly, one mouse brain or ~15 million neurons were collected in a 250mM sucrose solution buffered with 10μM HEPES and 1mM EDTA at pH 7.3, homogenized using a tissue grinder, incubated with Gly-Phe-β-naphthylamide (GPN) for 7 min at 37°C to destroy lysosomes and subsequently subjected to three differential centrifugations through 9.5% Nycodenz and 33% Percoll and 30% Optiprep discontinuous gradients to isolate vesicles of the appropriate size and density. Following collection, the autophagic vesicle enriched fraction (AV) was divided into three, one third was treated with 10μg Proteinase K for 45min at 37°C, similar to Le Guerroué et al., 2017 and Zellner et al., 2021, to degrade non-membrane protected proteins and enrich for internal autophagosome cargo (AV+PK), one third was membrane permeabilized by the addition of 0.2% Triton X-100 prior to the same proteinase K treatment as a negative control (AP+Tx+PK), and the other third was left untreated for identification of all internal and externally-associated proteins on autophagosomes. AV-enriched fractions were subsequently used for mass spectrometry, electron microscopy, immunoblotting and confocal microscopy. Detailed, step-by-step instructions and checklists can be found in additional supplemental material.

Crude mitochondrial fraction enrichment

Brain homogenate was split for AV fractionation and a fraction was used for crude mitochondrial preparations based on the protocol from (Schulz et al., 2015; Soubannier et al., 2012). Briefly, samples were spun at 2000×g, 7000×g, and 8000×g sequentially for 15 min at 4°C.

Proteomics- sample preparation and digestion

The AV and AV+PK fractions from five independent mouse brain preparations, from 3 male and 2 female mice, were lysed with RIPA buffer (50 mM HEPES (pH 7.4), 150 mM NaCl, 1% sodium deoxycholate, 1% NP-40, 0.1% SDS, 2.5 mM MgCl2, 10 mM sodium glycerophosphate, 10 mM sodium biphosphate) containing 1 μg/ml aprotinin, 1 μg/ml leupeptin, 1 mM benzamidine, 1 mM AEBSF and 1% final SDS. Lysates were sonicated on ice three times, followed by centrifugation (13000 rpm, 5 min). Protein concentration was measured by Bradford assay. Protein extracts (50 ug) were subjected to disulfide bond reduction with 5 mM TCEP (room temperature, 10 min) and alkylation with 25 mM chloroacetamide (room temperature, 20 min) and followed by TCA precipitation, prior to protease digestion. Samples were resuspended in 100 mM EPPS, pH 8.5 containing 0.1% RapiGest and digested at 37°C for 8 h with Trypsin at a 100:1 protein-to-protease ratio. Trypsin was then added at a 100:1 protein-to-protease ratio and the reaction was incubated for 6 h at 37°C. Following incubation, digestion efficiency of a small aliquot was tested. Tandem mass tag labeling of each sample was performed by adding 5 μl the 20 ng/μL stock of TMT reagent along with acetonitrile to achieve a final acetonitrile concentration of approximately 25% (v/v). Following incubation at room temperature for 1 h, labeling efficiency of a small aliquot was tested, and the reaction was then quenched with hydroxylamine to a final concentration of 0.5% (v/v) for 15 min. The TMT-labeled samples were pooled together at a 1:1 ratio. The sample was vacuum centrifuged to near dryness, resuspended in 5% formic acid for 15 min, centrifuged at 10000×g for 5 minutes at room temperature and subjected to C18 solid-phase extraction (SPE) (Sep-Pak, Waters).

Proteomics - Off-line basic pH reversed-phase (BPRP) fractionation

Dried TMT-labeled sample was resuspended in 100 μl of 10 mM NH₄HCO₃ pH 8.0 and fractionated using BPRP HPLC (Paulo et al., 2016). Briefly, samples were offline fractionated over a 90 min run, into 96 fractions by high pH reverse-phase HPLC (Agilent LC1260) through an aeris peptide xb-c18 column (Phenomenex; 250 mm × 3.6 mm) with mobile phase A containing 5% acetonitrile and 10 mM NH₄HCO₃ in LC-MS grade H₂O, and mobile phase B containing 90% acetonitrile and 10 mM NH₄HCO₃ in LC-MS grade H₂O (both pH 8.0). The 96 resulting fractions were then pooled in a non-continuous manner into 24 fractions (as outlined in Supplemental Fig. 5 of (Paulo et al., 2016)) and 12 fractions (even numbers) were used for subsequent mass spectrometry analysis. Fractions were vacuum centrifuged to near dryness. Each consolidated fraction was desalted via StageTip, dried again via vacuum centrifugation, and reconstituted in 5% acetonitrile, 1% formic acid for LC-MS/MS processing.

Proteomics – Liquid chromatography and tandem mass spectrometry

Mass spectrometry data were collected using an Orbitrap Fusion Lumos mass spectrometer, coupled to a Proxeon EASY-nLC1200 liquid chromatography (LC) pump (Thermo Fisher Scientific). Peptides were separated on a 100 μm inner diameter microcapillary column packed in house with ~35 cm of Accucore150 resin (2.6 μm, 150 Å, Thermo Fisher Scientific, San Jose, CA) with a gradient consisting of 5%–20% (0–70 min), 20–24% (70–80min) (ACN, 0.1% FA) over a total 90 min run at ~550 nL/min. For analysis, we loaded 1/8 of each fraction onto the column. To reduce ion interference compared to MS² quantification, each analysis used the Multi-Notch MS³-based TMT method (McAlister et al., 2014), combined with newly implemented Real Time Search analysis software (Erickson et al., 2019; Schweppe et al., 2020). The scan sequence began with an MS¹ spectrum (Orbitrap analysis; resolution 120,000 at 200 Th; mass range 350−1400 m/z; automatic gain control (AGC) target 3×10⁶; maximum injection time 50 ms). Precursors for MS² analysis were selected using a TopSpeed acquisition scheme of 3 sec/cycle. MS² analysis consisted of collision-induced dissociation (quadrupole ion trap analysis; Rapid scan rate; AGC 2.5×10⁴; isolation window 0.7 Th; normalized collision energy (NCE) 35; maximum injection time 35 ms). Monoisotopic peak assignment was used, previously interrogated precursors were excluded using a dynamic window (150 s ± 7 ppm), and dependent scan was performed on a single charge state per precursor. Following acquisition of each MS² spectrum, a synchronous-precursor-selection (SPS) API-MS³ scan was collected on the top 10 most intense ions b or y-ions matched by the online search algorithm in the associated MS² spectrum (Erickson et al., 2019; Schweppe et al., 2020). MS³ precursors were fragmented by high energy collision-induced dissociation (HCD) and analyzed using the Orbitrap (NCE 65; AGC 2.5×10⁵; maximum injection time 200 ms, resolution was 50,000 at 200 Th).

Proteomics - Data analysis

Mass spectra were processed using a Comet-based (v2018.01 rev.2) software pipeline (Eng et al., 2013). Spectra were converted to mzXML and monoisotropic peaks were reassigned using Monocle (Rad et al., 2021). MS/MS spectra were matched with peptide sequencesusing the Comet algorithm along with a composite sequence database including all canonical entries from the Mus musculus Reference Proteome UniProt database (SwissProt – 2017–05), as well as an in-house curated list of contaminants. This database was concatenated with one composed of all protein sequences in the reversed order. Trypsin was used as the digestion enzyme, two missed cleavages were allowed, and the minimal peptide length was set to 7 amino acids. Searches were performed using a 20 ppm precursor ion tolerance for total protein level analysis. The recommended product ion parameters for ion trap ms/ms were used (1.0005 tolerance, 0.4 offset (mono masses), theoretical_fragment_ions = 1). TMT tags on lysine residues and peptide N termini (+229. 1629 Da) and carbamidomethylation of cysteine residues (+57.021 Da) were set as static modifications, while oxidation of methionine residues (+15.995 Da) was set as a variable modification. Peptide-spectrum matches (PSMs) were adjusted to a 1% false discovery rate (FDR) and PSM filtering was performed using a linear discriminant analysis, as described previously (Huttlin et al., 2010), while considering the following parameters: Comet Log Expect and Diff Seq. Delta Log Expect, missed cleavages, peptide length, charge state, and precursor mass accuracy. For protein-level comparisons, PSMs were identified, quantified, and collapsed to a 1% peptide false discovery rate (FDR) and then collapsed further to a final protein-level FDR of 1% (Savitski et al., 2015). Moreover, protein assembly was guided by principles of parsimony to produce the smallest set of proteins necessary to account for all observed peptides. For TMT-based reporter ion quantitation, we extracted the summed signal-to-noise (S:N) ratio for each TMT channel and found the closest matching centroid to the expected mass of the TMT reporter ion (integration tolerance of 0.003 Da). Proteins were quantified by summing reporter ion counts across all matching PSMs using in-house software, as described previously (Huttlin et al., 2010). PSMs with poor quality, MS³ spectra with more than 5 TMT reporter ion channels missing, or isolation specificity less than 0.6, or with TMT reporter summed signal-to-noise ratio that were less than 200 or had no MS³ spectra were excluded from quantification.

Protein quantification values were exported for further analysis in Microsoft Excel and Perseus (Tyanova et al., 2016) and statistical test and parameters used are indicated in the corresponding datasets.

Immunoblotting

Samples were lysed in RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 0.1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, 2x Halt Protease and Phosphatase inhibitor, PMSF, Pepstatin A, TAME and Leupeptin), centrifuged at 18,000g for 20min to clear unlysed and membranaous fractions, and then the protein concentration was determined by Bradford assay. Proteins were resolved on 8%, 10%, 12% or 15% SDS-PAGE gels, based on size of proteins to be identified. Proteins were transferred to Immobilon-FL PVDF membranes (Millipore) using a wet blot transfer system (BioRad). 15% gels were transferred in buffer containing 20% methanol. Membranes were stained for total protein using Li-Cor Revert Total Protein Stain. Following imaging, the total protein was destained, blocked for 1hr at RT with TrueBlack WB Blocking Buffer (Biotium) and incubated with primary antibodies diluted in TrueBlack WB antibody diluent + 0.2% Tween-20 overnight at 4°C. Membranes were washed three times in TBS+ 0.1% Tween-20 and incubated with secondary antibodies (1:20,000 dilution) in TrueBlack WB antibody diluent + 0.2% Tween-20 + 0.1% SDS for 1hr at RT. Following three washes in TBS+ 0.1% Tween-20, membranes were imaged using Odyssey CLx Infrared Imaging System (LI-COR), and quantification of protein levels was performed using ImageStudio (Li-Cor).

For quantification of immunoblot data, an independent biological replicate is defined as a separate brain or neuron differentiation preparation. Data was excluded if the total protein levels were unquantifiable.

GFP immunoprecipitation

25μl of GFPtrap or Protein A dynabeads were washed three times in buffer (10mM Tris pH 7.5, 150mM NaCl, 0.5mM EDTA), added to AV fraction samples containing protease and phosphatase inhibitors to a final volume of 500ul, and incubated on a rotator at 4°C for 1hr. Beads were subsequently washed three times in wash buffer and transferred to a new tube before boiling in 2x denaturing sample buffer. Independent biological replicates are defined as a separate brain homogenate AV preparation.

Transfection for live imaging

For all transfections, 0.3μg of each plasmid was combined with 12ul lipofectamine 2000 total in final vol of 300ul OptiMEM and left on neurons for 45min at 37°C in a 5% CO₂ incubator. mCherry-Synapsin coexpression with GFP-LC3 was expressed for 72h, while all other constructs were imaged after 48h. For Snap labeling, neurons expressing Snap-TFAM or a negative control (GFP transfected) were incubated with 100nM of Snap-Cell 647-SiR for 30min at 37°C in a 5% CO₂ incubator. After incubation, neurons were washed 3 times and equilibrated with complete neuron media for 30min at 37°C in a 5% CO₂ incubator. Following three more washes, neurons were switched to imaging media and imaged immediately.

Neuron imaging was performed in low fluorescence Hibernate E (for primary neurons) or Hibernate A (for i3Neurons) medium (Brain Bits) supplemented with 2% B27 and 2mM GlutaMAX. Neurons were imaged in an environmental chamber at 37°C on a Perkin Elmer UltraView Spinning Disk Confocal system with a Nikon Eclipse Ti inverted microscope, using an Apochromat 100× 1.49 NA oil immersion objective. Images were acquired with a Hamamatsu EMCCD C9100–50 camera controlled using Volocity software. Axons were identified based on morphological parameters and imaging occurred in the mid- to distal-axon defined as greater than 200μm from the soma. Timelapse recordings were acquired at a frame rate of 2 frames per second for 5 minutes.

For quantification, an independent biological replicate is defined as a separate neuron preparation and transfection. Only neurons with moderate levels of fluorescent protein expression were imaged. For all kymographs, only trafficking AVs (movement > 10μm) in the mid- to distal- axon (>200 μm from soma) were quantified for analysis. For kymograph analysis, an average of 7 axons with 22 moving LC3 puncta per experiment were observed per experiment (axons per experiment: 7.05 ± 0.60 SEM, 25% Percentile = 4.75, 75% Percentile = 10; LC3 puncta per experiment: 22.45 ± 1.93 SEM, 25% Percentile = 15, 75% Percentile = 29.25).

Electron microscopy

AV fractions and brain homogenate fractions were pelleted and fixed with 2.5% glutaraldehyde, 2.0% paraformaldehyde in 0.1M sodium cacodylate buffer, pH 7.4, overnight at 4°C. Fixed samples were then transferred to the Electron Microscopy Resource Laboratory at the University of Pennsylvania, where all subsequent steps were performed. After buffer washes, the samples were post-fixed in 2.0% osmium tetroxide for 1 hr at room temperature and then washed again in buffer, followed by dH₂O. After dehydration through a graded ethanol series, the tissue was infiltrated and embedded in EMbed-812 (Electron Microscopy Sciences, Fort Washington, PA). Thin sections were stained with lead citrate and examined with a JEOL 1010 electron microscope fitted with a Hamamatsu digital camera and AMT Advantage image capture software. Regions of dense AVs were chosen for imaging. Biological replicates are defined as separate brain-derived AV preparations.

Immunofluorescence of AVs

AVs were prepared from wildtype or GFP-LC3 mouse brains and stained with 1:200,000 dilution of CMDR, 1:100,000 dilution of SYBRgold, 10nM of MitoTracker Deep Red, or 10nM of LysoTracker Deep Red. The samples were plated on coverslips with the addition of 0.2% methyl cellulose for 10 minutes in the dark before imaging, to concentrate AVs at the coverslip surface. Independent biological replicates are considered to be different brain homogenate AV preparations. Randomly selected fields where AVs were stationary were used for quantification. All image analysis was performed on raw data. Images were prepared in FIJI, and contrast and brightness were adjusted equally to all images within a series. Quantification of the percent of SYBR+ puncta or GFP-LC3 puncta colocalized to CMDR (mean ± SEM) was performed using automated distanced-based colocalization (FIJI, coloc2).

AVs from GFP-LC3 transgenic mouse brains or wild-type mouse brains were immunoprecipitated using an anti-LC3 antibody. Briefly, the anti-LC3 antibody ab48394 at a 1:20 dilution fixed to a plasma cleaned coverslip with 0.5% nitrocellulose and blocked in 3%BSA for 30min. AVs stained with SYBRgold or CMDR at the dilutions used above were incubated at RT for 45min and washed 2x in PBS before imaging on the confocal microscope. Automated segmentation (FIJI, Weka Trainable Segmentation) was used to identify puncta prior to colocalization analysis.

qPCR

Total brain and AV fraction samples from four independent biological replicates were DNA extracted using Trizol, and qPCR was performed using the Luna Universal qPCR master mix and protocol, with 50ng DNA and final primer concentration of 0.25μM. For each biological replicate, 3 technical replicates were performed. The plate reader and analysis was performed using the QuantStudio 3 Real-Time PCR System controlled by QuantStudio Design and Analysis Software (ThermoFisher Scientific).

QUANTIFICATION AND STATISTICAL ANALYSIS

Mitochondrial annotations and sublocalizations were performed using the MitoCarta2.0 and UniProt databases (Calvo et al., 2016).

GraphPad prism software (v9.1.0) was used for statistical analysis. The statistical test performed for all immunoblot analyses and kymograph quantification analyses is Ordinary one-way ANOVA with Šídák’s multiple comparisons test, or Kruskal-Wallis test with Dunnet’s multiple comparison test for data not normally distributed. The statistical test for the median cargo score values of subgroups of organelles (Figure 3 and Supplemental Figure 2) is RM one way ANOVA with Dunnet’s multiple comparison test. The statistical test for all of the individual cargo score values not averaged over biological replicate (Supplemental Figure 3 and 5) is the Dunn Test, performed in R. Statistical tests used are indicated in the figure legends. Biological replicates (n), defined in the method details, are always displayed as individual data points and the precision measures (mean ± SEM) are displayed. Significance was defined as a p-value < 0.05, and where appropriate, directly reported in the figure. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. R (v4.0.4) was used for cargo score plots and some statistical analysis of mass spectrometry data sets. See code availability statement for additional details. Enrichr (Chen et al., 2013; Kuleshov et al., 2016; Xie et al., 2021) and SynGO (Koopmans et al., 2019) were used to compute the p-values of gene ontology term enrichment. Proteins with a cargo score greater than the median were input into the softwares – the p-value calculation is dependent on Fisher’s exact test and the q-value displays the Benjamini-Hochburg multiple hypothesis testing correction. Enrichr precomputes a background expected rank for each term in the gene set library. Neither software takes into account the background protein expression levels in specific organs.

Supplementary Material

NIHMS1772846-supplement-1.pdf^{(9.7MB, pdf)}

NIHMS1772846-supplement-2.xlsx^{(4MB, xlsx)}

KEY RESOURCES TABLE.

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
LC3 Rabbit polyclonal antibody	Novus Biologicals	NB100-2220
Synapsin I (for detection of mouse) Rabbit polyclonal antibody	EMD Millipore	Ab1543P
Synapsin I (for detection of human) Mouse monoclonal antibody	Synaptic Systems	106-011
GM130 Mouse monoclonal antibody	BD Biosciences	610823
Histone H3 Rabbit polyclonal antibody	Cell Signaling Technology	9715
Calnexin Rabbit polyclonal antibody	Enzo life sciences	ADI-SPA-860-D
Calreticulin Rabbit monoclonal antibody	Abcam	Ab92516
Rab11A Rabbit polyclonal antibody	Zymed	71-5300
Rab7 Mouse monoclonal antibody	Abcam	Ab50533
Rab5 Mouse polyclonal antibody	BD Biosciences	610281
EEA1 Mouse polyclonal antibody	BD Biosciences	610456
HSP60 Mouse monoclonal antibody	Enzo Life Sciences	SPA-806
SOD1 Sheep polyclonal antibody	EMD Millipore	574597
SDHA Rabbit monoclonal antibody	Cell Signaling Technology	11998
PHB2 Rabbit monoclonal antibody	Cell Signaling Technology	14085S
Cytochrome c Mouse monoclonal antibody	Santa Cruz	Sc-13561
TOMM20 Mouse monoclonal antibody	Santa Cruz	Sc-17764 (F-10)
TOMM40 Rabbit polyclonal antibody	Proteintech	18409-1-AP
TOMM70 Rabbit polyclonal antibody	Proteintech	14528-1-AP
Miro2 Rabbit polyclonal antibody	Proteintech	11237-1-AP
P62/SQSTM1 Guinea Pig polyclonal antibody	American Research Products	03-GP62-C
NDP52 Rabbit polyclonal antibody	Abcam	Ab68588
NBR1 Mouse monoclonal antibody	Santa Cruz	Sc-130380
VCP Rabbit polyclonal antibody	Cell Signaling Techonology	2648S
Tax1bp1 Mouse monoclonal antibody	Santa Cruz	Sc-393143
OPTN Rabbit polyclonal antibody	Abcam	Ab23666
BNIP3 Mouse monoclonal antibody	Santa Cruz	Sc-56167
PINK1 Mouse monoclonal antibody	Abcam	Ab75487
Parkin Rabbit polyclonal antibody	Abcam	Ab15954
Nix Mouse monoclonal antibody	Santa Cruz	Sc-166332
mtTFA (TFAM) (for detection in mouse) Rabbit monoclonal antibody	Abcam	Ab252432
TFAM (for detection in human) Rabbit polyclonal antibody	Abcam	Ab47517
GFP Chicken monoclonal antibody	Living color	632381
Vamp2 Rabbit monoclonal antibody	Cell Signaling Technology	13508
Synaptophysin Mouse monoclonal antibody	Enzo Life Sciences	VAM-8V011
Drp1 Mouse monoclonal antibody	Abcam	Ab56788
Fis1 Mouse monoclonal antibody	Santa Cruz	sc-376447
Mff Mouse monoclonal antibody	Santa Cruz	Sc-398617
Opa Mouse monoclonal antibody	Santa Cruz	Sc-393296
Mfn2 Mouse monoclonal antibody	Santa Cruz	Sc-515647
GFAP Mouse monoclonal antibody	Cell Signaling Technology	3670S
Lamp1 Rat antibody	RDI	MCD107A-D4B
CD63 Rabbit monoclonal antibody	Abcam	Ab217345
CHMP4b Rabbit polyclonal antibody	Proteintech	13683-1-AP
HGS Rabbit polyclonal antibody	Abcam	Ab155539
STAM Mouse monoclonal antibody	Santa Cruz	Sc-133093
Anti-Rabbit IgG-IRDye 800CW, Donkey Polyclonal	Licor	Cat# 926-32213; RRID:AB_621848
Anti-Rabbit IgG-IRDye 680RD, Donkey Polyclonal	Licor	Cat# 926-68073; RRID:AB_10954442
Anti-Mouse IgG-IRDye 800CW, Donkey Polyclonal	Licor	Cat# 926-32212; RRID:AB_621847
Anti-Mouse IgG-IRDye 680RD, Donkey Polyclonal	Licor	926-68072
Anti-Guinea Pig IgG-IRDye 680RD, Donkey Polyclonal	Licor	926-68077
Anti-Chicken IgG-IRDye 680RD, Donkey Polyclonal	Licor	926-68075
Anti-Sheep IgG AlexaFluor 680, Donkey Polyclonal	Invitrogen	2041656
Bacterial and virus strains
Not applicable
Biological samples
Not applicable
Chemicals, peptides, and recombinant proteins
Lipofectamine 2000	Thermo Fisher	Cat# 11668019
SNAP-Cell 647-SiR	New England Biosciences	Cat# S9102S
PLL (mol wt 70,000 – 150,000)	Sigma-Aldrich	Cat# P1274
2.5% Trypsin	Thermo Fisher	Cat# 15090-046
Minimum essential medium (MEM)	Thermo Fisher	Cat# 11095-072
Horse serum (heat inactivated)	Thermo Fisher	Cat# 16050-122
Sodium Pyruvate	Corning	Cat# 36017004
D-Glucose solution 45%	Sigma-Aldrich	Cat# G8769
GlutaMAX	Thermo Fisher	Cat# 35050061
B27 Supplement	Thermo Fisher	Cat# 17504-044
Neurobasal medium	Thermo Fisher	Cat# 21103-049
Penicillin-Streptomycin	Thermo Fisher	Cat# 15140-122
AraC	Sigma-Aldrich	Cat# C6645
Matrigel Growth Factor Reduced	Corning	Cat# 354230
Essential 8 Medium	Thermo Fisher	Cat# A1517001
ReLeSR	StemCell Technologies, Inc.	Cat# 05872
Accutase	StemCell Technologies, Inc.	Cat# 07920
ROCK Inhibitor Y-27632	Selleckchem	Cat# S1049
DMEM/F12, HEPES	Thermo Fisher	Cat# 11330032
N2 Supplement	Thermo Fisher	Cat# 17502048
Non-essential Amino Acids	Thermo Fisher	Cat# 11140050
Doxycycline	Sigma-Aldrich	Cat# D9891
Poly-L-ornithine	Sigma-Aldrich	Cat# P3655
BrainPhys Neuronal medium	StemCell Technologies, Inc.	Cat# 05790
Laminin	Corning	Cat# 354232
BDNF	PeproTech	Cat# 450-02
NT-3	PeproTech	Cat# 450-03
OptiMEM	Gibco	2192535
Hibernate A	BrainBits	HALF
Hibernate E	BrainBits	HELF
Halt Protease and Phosphatase Inhibitor Cocktail	Thermo Fisher	Cat# 78442
Bradford reagent	Sigma	B6916
SDS (for proteomics)	Bio-Rad	Cat#1610302
TCEP	Gold Biotechnology	51805-45-9
Formic Acid	Sigma-Aldrich	Cat# C0267
Trypsin (for proteomics)	Promega	Cat# V511C
Rapigest SF Surfactant	Glixx Laboratories	Cat#GLXC-07089
EPPS	Sigma-Aldrich	Cat#E9502
2-Choroacetamide	Sigma-Aldrich	Cat#C0267
Empore SPE Disks C18	3M-Sigma-Aldrich	Cat#66883-U
Immobilon-FL PVDF membranes	Millipore	IPFL00010
Li-Cor Revert Total Protein Stain	Licor	926-11021
TrueBlack WB Blocking Buffer	Biotium	20T1021
TrueBlack WB Antibody Diluent	Biotium	23013B
SYBR Gold	Invitrogen	S11494
CellMask Deep Red	Invitrogen	C10046
MitoTracker Deep Red	Thermo Fisher	M22426
LysoTracker Deep Red	Thermo Fisher	L12492
Percoll	Sigma	Cat#P1644
Proteinase K	Sigma	Cat#P2308
Gly-Phe-Beta-naphthylamide	Cayman Chemical	Cat#14636
Nycodenz	Cosmo Bio USA	Cat#1002424
Optiprep	Cosmo Bio USA	Cat#04-039392/01

Critical commercial assays
GFP-Trap Magnetic beads	ChromoTek	Gtd-10
Protein A dynabeads	Novex Life Technologies	10002D
Luna Universal qPCR master mix	New England Biolabs	M3003
Tandem Mass Tags	Thermo Fisher Scientific	Cat#90406
Bio-Rad Protein Assay Dye Reagent Concentrate	Bio-Rad	Cat#5000006

Deposited data

Experimental models: Cell lines
i³N iPSCs	Fernandopulle et al., Current protocols in Cell Biology, 2018	Gift from Dr. Michael Ward
Experimental models: Organisms/strains
B6Cg-Tg(CAG-EGFP/LC3)53Nmi/NmiRbrc)	Mizushima et al, Mol. Biol. Cell, 2004	RIKEN BioResource Center in Japan
Oligonucleotides
Primer: L1MdTf1 Forward: TTTGGGACACAATGAAAGCA Reverse: CTGCCGTCTACTCCTCTTGG	This paper
Primer: L1MdTf2 Forward: GCGAGGATGTGGAGAAAGAG Reverse: AGTTGGGGCTTCTTCTGGAT	This paper
Primer: ND2 Forward: ATCCTCCTGGCCATCGTACT Reverse: ATCAGAAGTGGAATGGGGCG	This paper
Primer: ND5 Forward: ACCCAATCAAACGCCTAGCA Reverse: AGGACTGGAATGCTGGTTGG	This paper
Primer: COXII Forward: AACCGAGTCGTTCTGCCAAT Reverse: CTAGGGAGGGGACTGCTCAT	This paper
Recombinant DNA
Plasmid: EGFP-LC3	Kabeya et al., EMBO J., 2000	Addgene 21073
Plasmid: mCherry-Synapsin	This paper
Plasmid: mCherry vector	This paper
Plasmid: mito-dsRed
Plasmid: Snap-TFAM	This paper
Plasmid: mCherry-LC3	This paper
Plasmid: Cox8a-BFP	This paper
Plasmid: pGFP-Drp1	This paper
Plasmid: pGFP-Drp1K38A	This paper
Software and algorithms
Enrichr	Xie et al., Current protocols, 2021	https://maayanlab.cloud/Enrichr/
SynGO	Koopmans et al., NeuroResource, 2019	https://syngoportal.org/
FIJI	NIH, USA	https://imagej.net/Fiji
Perseus	Tyanova et al., Nature Methods, 2016	https://maxquant.net/perseus/
ImageStudio	Li-Cor	https://www.licor.com/bio/image-studio-lite/
Volocity	PerkinElmer
Prism 9	GraphPad	https://www.graphpad.com/scientificsoftware/prism/
R	The R Foundation	https://www.rproject.org/
Mass spectrometry data analysis software	Huttlin et al., Cell, 2010	N/A
Comet	Eng et al., Proteomics, 2012	http://cometms.sourceforge.net/

Other
Biorender for model preparations	Biorender	https://biorender.com/
Sketch for figure preparation (v70.2)	Sketch	https://www.sketch.com/
Orbitrap Fusion Lumos Mass Spectrometer	ThermoFisher Scientific	Cat#IQLAAEGAAP FADBMBHQ
Easy-nLC 1200	ThermoFisher Scientific	LC140
Aeris™ 2.6 μm PEPTIDE XB-C18 100 Å 250 × 4.6 mm	Phenomenex	Cat#00G-4505-E0
Sep-Pak tC18 1cc Vac Cartridge, 50 mg	Waters	Cat#WAT054960
Empore™ SPE Disks C18	3M Bioanalytical Technologies	Cat# 2215

Open in a new tab

Highlights:

Proteomics identify cargos degraded by basal autophagy in brain and neurons
Synaptic and mitochondrial proteins are predominant cargos for autophagy in neurons
TFAM-positive mitochondrial nucleoids are enriched in autophagosomes
Nucleoid-enriched mitochondrial fragments are generated by Drp1-dependent fission

Acknowledgments

We thank Mariko Tokito for assistance in the cloning of plasmid constructs, Karen Wallace Jahn for assistance with animal models, and J.A. Paulo for proteomics support. This research was supported by National Institutes of Health grant NINDS R01s NS060698 (ELFH), NS083524 and NS110395 (JWH).

Footnotes

Declaration of Interests

J.W.H. is a consultant and founder of Caraway Therapeutics and is a founding board member of Interline Therapeutics. J.W.H. also receives compensation for editorial service at Elife and Science Advances. E.H. receives compensation for editorial service from Science Advances.

Inclusion and Diversity

We worked to ensure sex balance in the selection of non-human subjects. While citing references scientifically relevant for this work, we also actively worked to promote gender balance in our reference list.

Additional Files

Supplemental Information

Figures S1 – S6

Table S2: Meta-analysis of mtDNA associated proteins identified through autophagosome proteomics, Related to Figure 3

Table S1: Proteomic profiling of autophagosomes from mouse brain, Related to Figure 1

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

Ahier A, Dai C-Y, Kirmes I, Cummins N, Hung GCC, Götz J, & Zuryn S (2021). PINK1 and parkin shape the organism-wide distribution of a deleterious mitochondrial genome. Cell Reports, 35(9), 109203. 10.1016/j.celrep.2021.109203 [DOI] [PubMed] [Google Scholar]
An H, Ordureau A, Körner M, Paulo JA, & Harper JW (2020). Systematic quantitative analysis of ribosome inventory during nutrient stress. Nature, 583(7815), 303–309. 10.1038/s41586-020-2446-y [DOI] [PMC free article] [PubMed] [Google Scholar]
An H, Ordureau A, Paulo JA, Shoemaker CJ, Denic V, & Harper JW (2019). TEX264 Is an Endoplasmic Reticulum-Resident ATG8-Interacting Protein Critical for ER Remodeling during Nutrient Stress. Molecular Cell, 74(5), 891–908.e10. 10.1016/j.molcel.2019.03.034 [DOI] [PMC free article] [PubMed] [Google Scholar]
Anglade P, Vyas S, Javoy-Agid F, Herrero M, Michel P, Marquez J, Mouatt-Prigent A, Ruberg M, Hirsch E, & Agid Y (1997). Apoptosis and autophagy in nigral neurons of patients with Parkinson’s disease. Histology and Histopathology, 12(1), 25–31. [PubMed] [Google Scholar]
Behrends C, Sowa ME, Gygi SP, & Harper JW (2010). Network organization of the human autophagy system. Nature, 466(7302), 68–76. 10.1038/nature09204.Network [DOI] [PMC free article] [PubMed] [Google Scholar]
Boecker CA, Goldsmith J, Dou D, Cajka GG, & Holzbaur ELF (2021). Increased LRRK2 kinase activity alters neuronal autophagy by disrupting the axonal transport of autophagosomes. Current Biology, 31(10), 2140–2154.e6. 10.1016/j.cub.2021.02.061 [DOI] [PMC free article] [PubMed] [Google Scholar]
Borsche M, König IR, Delcambre S, Petrucci S, Balck A, Bruggemann N, Zimprich A, Wasner K, Pereira SL, Avenali M, Deuschle C, Badanjak K, Ghelfi J, Gasser T, Kasten M, Rosenstiel P, Lohmann K, Brockmann K, Valente EM, … Klein C (2020). Mitochondrial damage-associated inflammation highlights biomarkers in PRKN/PINK1 parkinsonism. Brain, 143(10), 3041–3051. 10.1093/brain/awaa246 [DOI] [PMC free article] [PubMed] [Google Scholar]
Calvo SE, Clauser KR, & Mootha VK (2016). MitoCarta2.0: An updated inventory of mammalian mitochondrial proteins. Nucleic Acids Research, 44(D1), D1251–D1257. 10.1093/nar/gkv1003 [DOI] [PMC free article] [PubMed] [Google Scholar]
Cason SE, Carman P, Van Duyne C, Goldsmith J, Dominguez R, & Holzbaur ELF (2021). Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathway. Journal of Cell Biology, 220(7). 10.1083/jcb.202010179 1of [DOI] [PMC free article] [PubMed] [Google Scholar]
Chen EY, Tan CM, Kou Y, Duan Q, Wang Z, Meirelles GV, Clark NR, & Ma’ayan A (2013). Enrichr: Interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinformatics, 14. 10.1186/1471-2105-14-128 [DOI] [PMC free article] [PubMed] [Google Scholar]
Compans B, Camus C, Kallergi E, Sposini S, Martineau M, Butler C, Kechkar A, Klaassen RV, Retailleau N, Sejnowski TJ, Smit AB, Sibarita JB, Bartol TM, Perrais D, Nikoletopoulou V, Choquet D, & Hosy E (2021). NMDAR-dependent long-term depression is associated with increased short term plasticity through autophagy mediated loss of PSD-95. Nature Communications, 12(1), 1–18. 10.1038/s41467-021-23133-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
Dengjel J, Høyer-Hansen M, Nielsen MO, Eisenberg T, Harder LM, Schandorff S, Farkas T, Kirkegaard T, Becker AC, Schroeder S, Vanselow K, Lundberg E, Nielsen MM, Kristensen AR, Akimov V, Bunkenborg J, Madeo F, Jäättelä M, & Andersen JS (2012). Identification of autophagosome-associated proteins and regulators by quantitative proteomic analysis and genetic screens. Molecular and Cellular Proteomics, 11(3), 1–17. 10.1074/mcp.M111.014035 [DOI] [PMC free article] [PubMed] [Google Scholar]
Eng JK, Jahan TA, & Hoopmann MR (2013). Comet: An open-source MS/MS sequence database search tool. Proteomics, 13(1), 22–24. 10.1002/pmic.201200439 [DOI] [PubMed] [Google Scholar]
Erickson BK, Mintseris J, Schweppe DK, Navarrete-Perea J, Erickson AR, Nusinow DP, Paulo JA, & Gygi SP (2019). Active Instrument Engagement Combined with a Real-Time Database Search for Improved Performance of Sample Multiplexing Workflows. Journal of Proteome Research, 18(3), 1299–1306. 10.1021/acs.jproteome.8b00899 [DOI] [PMC free article] [PubMed] [Google Scholar]
Evans CS, & Holzbaur EL (2020). Degradation of engulfed mitochondria is rate-limiting in Optineurin-mediated mitophagy in neurons. ELife, 9, 1–30. 10.7554/eLife.50260 [DOI] [PMC free article] [PubMed] [Google Scholar]
Fernandopulle MS, Prestil R, Grunseich C, Wang C, Gan L, & Ward ME (2018). Transcription-factor mediated differentiation of human iPSCs into neurons. Current Protocols in Cell Biology, 79(1). 10.1016/j.physbeh.2017.03.040 [DOI] [PMC free article] [PubMed] [Google Scholar]
Friedman JR, Lackner LL, West M, DiBenedetto JR, Nunnari J, & Voeltz GK (2011). ER tubules mark sites of mitochondrial division. Science, 334(6054), 358–362. 10.1126/science.1207385 [DOI] [PMC free article] [PubMed] [Google Scholar]
Gao W, Kang JH, Liao Y, Ding WX, Gambotto AA, Watkins SC, Liu YJ, Stolz DB, & Yin XM (2010). Biochemical isolation and characterization of the tubulovesicular LC3-positive autophagosomal compartment. Journal of Biological Chemistry, 285(2), 1371–1383. 10.1074/jbc.M109.054197 [DOI] [PMC free article] [PubMed] [Google Scholar]
Hara T, Nakamura K, Matsui M, Yamamoto A, Nakahara Y, Suzuki-Migishima R, Yokoyama M, Mishima K, Saito I, Okano H, & Mizushima N (2006). Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature, 441(7095), 885–889. 10.1038/nature04724 [DOI] [PubMed] [Google Scholar]
Harding O, Evans CS, Ye J, Cheung J, Maniatis T, & Holzbaur ELF (2021). ALS and FTD-associated missense mutations in TBK1 differentially disrupt mitophagy. [DOI] [PMC free article] [PubMed]
He J, Cooper HM, Reyes A, Di Re M, Sembongi H, Gao J, Neuman KC, Fearnley IM, Spinazzola A, Walker JE, & Holt IJ (2012). Mitochondrial nucleoid interacting proteins support mitochondrial protein synthesis. Nucleic Acids Research, 40(13), 6109–6121. 10.1093/nar/gks266 [DOI] [PMC free article] [PubMed] [Google Scholar]
Hill SE, & Colón-Ramos DA (2020). The Journey of the Synaptic Autophagosome: A Cell Biological Perspective. Neuron, 105(6), 961–973. 10.1016/j.neuron.2020.01.018 [DOI] [PubMed] [Google Scholar]
Hoffmann-Conaway S, Brockmann MM, Schneider K, Annamneedi A, Rahman KA, Bruns C, Textoris-Taube K, Trimbuch T, Smalla KH, Rosenmund C, Gundelfinger ED, Garner CC, & Montenegro-Venegas C (2020). Parkin contributes to synaptic vesicle autophagy in bassoon-deficient mice. ELife, 9, 1–30. 10.7554/eLife.56590 [DOI] [PMC free article] [PubMed] [Google Scholar]
Hoffmann S, Orlando M, Andrzejak E, Bruns C, Trimbuch T, Rosenmund C, Garner CC, & Ackermann F (2019). Light-activated ROS production induces synaptic autophagy. Journal of Neuroscience, 39(12), 2163–2183. 10.1523/JNEUROSCI.1317-18.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
Hung V, Lam SS, Udeshi ND, Svinkina T, Guzman G, Mootha VK, Carr SA, & Ting AY (2017). Proteomic mapping of cytosol-facing outer mitochondrial and ER membranes in living human cells by proximity biotinylation. ELife, 6, 1–39. 10.7554/eLife.24463 [DOI] [PMC free article] [PubMed] [Google Scholar]
Huttlin EL, Jedrychowski MP, Elias JE, Goswami T, Rad R, Beausoleil SA, Villén J, Haas W, Sowa ME, & Gygi SP (2010). A tissue-specific atlas of mouse protein phosphorylation and expression. Cell, 143(7), 1174–1189. 10.1016/j.cell.2010.12.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
Kleele T, Rey T, Winter J, Zaganelli S, Mahecic D, Perreten Lambert H, Ruberto FP, Nemir M, Wai T, Pedrazzini T, & Manley S (2021). Distinct fission signatures predict mitochondrial degradation or biogenesis. Nature, 593(November 2019). 10.1038/s41586-021-03510-6 [DOI] [PubMed] [Google Scholar]
Komatsu M, Waguri S, Chiba T, Murata S, Iwata J, Tanida I, Ueno T, Koike M, Uchiyama Y, Kominami E, & Tanaka K (2006). Loss of autophagy in the central nervous system causes neurodegeneration in mice. Nature, 441(7095), 880–884. 10.1038/nature04723 [DOI] [PubMed] [Google Scholar]
Koopmans F, van Nierop P, Andres-Alonso M, Byrnes A, Cijsouw T, Coba MP, Cornelisse LN, Farrell RJ, Goldschmidt HL, Howrigan DP, Hussain NK, Imig C, de Jong APH, Jung H, Kohansalnodehi M, Kramarz B, Lipstein N, Lovering RC, MacGillavry H, … Verhage M (2019). SynGO: An Evidence-Based, Expert-Curated Knowledge Base for the Synapse. Neuron, 103(2), 217–234.e4. 10.1016/j.neuron.2019.05.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
Kuchitsu Y, Homma Y, Fujita N, & Fukuda M (2018). Rab7 knockout unveils regulated autolysosome maturation induced by glutamine starvation. Journal of Cell Science, 131(7). 10.1242/jcs.215442 [DOI] [PubMed] [Google Scholar]
Kuijpers M, Kochlamazashvili G, Stumpf A, Puchkov D, Swaminathan A, Lucht MT, Krause E, Maritzen T, Schmitz D, & Haucke V (2021). Neuronal Autophagy Regulates Presynaptic Neurotransmission by Controlling the Axonal Endoplasmic Reticulum. Neuron, 109(2), 299–313.e9. 10.1016/j.neuron.2020.10.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan Q, Wang Z, Koplev S, Jenkins SL, Jagodnik KM, Lachmann A, McDermott MG, Monteiro CD, Gundersen GW, & Ma’ayan A (2016). Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Research, 44(W1), W90–W97. 10.1093/nar/gkw377 [DOI] [PMC free article] [PubMed] [Google Scholar]
Le Guerroué F, Eck F, Jung J, Starzetz T, Mittelbronn M, Kaulich M, & Behrends C (2017). Autophagosomal Content Profiling Reveals an LC3C-Dependent Piecemeal Mitophagy Pathway. Molecular Cell, 68(4), 786–796. 10.1016/j.molcel.2017.10.029 [DOI] [PubMed] [Google Scholar]
Lee H, Fenster RJ, Pineda SS, Gibbs WS, Mohammadi S, Davila-Velderrain J, Garcia FJ, Therrien M, Novis HS, Gao F, Wilkinson H, Vogt T, Kellis M, LaVoie MJ, & Heiman M (2020). Cell Type-Specific Transcriptomics Reveals that Mutant Huntingtin Leads to Mitochondrial RNA Release and Neuronal Innate Immune Activation. Neuron, 107(5), 891–908.e8. 10.1016/j.neuron.2020.06.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
Lewis SC, Uchiyama LF, & Nunnari J (2016). ER-mitochondria contacts couple mtDNA synthesis with Mitochondrial division in human cells. Science, 353(6296). 10.1126/science.aaf5549 [DOI] [PMC free article] [PubMed] [Google Scholar]
Maday S, & Holzbaur ELF (2014). Autophagosome biogenesis in primary neurons follows an ordered and spatially regulated pathway. Developmental Cell, 30(1), 71–85. 10.1016/j.devcel.2014.06.001.Autophagosome [DOI] [PMC free article] [PubMed] [Google Scholar]
Maday S, Wallace KE, & Holzbaur ELF (2012). Autophagosomes initiate distally and mature during transport toward the cell soma in primary neurons. Journal of Cell Biology, 196(4), 407–417. 10.1083/jcb.201106120 [DOI] [PMC free article] [PubMed] [Google Scholar]
Mancias JD, Wang X, Gygi SP, Harper JW, & Kimmelman AC (2014). Quantitative proteomics identifies NCOA4 as the cargo receptor mediating ferritinophagy. Nature, 509(7498), 105–109. 10.1038/nature13148 [DOI] [PMC free article] [PubMed] [Google Scholar]
Mathew R, Khor S, Hackett S, Rabinowitz J, Perlman D, & White E (2014). Functional Role of Autophagy-Mediated Proteome Remodeling in Cell Survival Signaling and Innate Immunity. Molecular Cell, 55(6), 916–930. 10.1016/j.molcel.2014.07.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
McAlister GC, Nusinow DP, Jedrychowski MP, Wühr M, Huttlin EL, Erickson BK, Rad R, Haas W, & Gygi SP (2014). MultiNotch MS3 enables accurate, sensitive, and multiplexed detection of differential expression across cancer cell line proteomes. Analytical Chemistry, 86(14), 7150–7158. 10.1021/ac502040v [DOI] [PMC free article] [PubMed] [Google Scholar]
McWilliams TG, Prescott AR, Montava-Garriga L, Ball G, Singh F, Barini E, Muqit MMK, Brooks SP, & Ganley IG (2018). Basal Mitophagy Occurs Independently of PINK1 in Mouse Tissues of High Metabolic Demand. Cell Metabolism, 27(2), 439–449.e5. 10.1016/j.cmet.2017.12.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
Moltedo O, Remondelli P, & Amodio G (2019). The mitochondria–endoplasmic reticulum contacts and their critical role in aging and age-associated diseases. Frontiers in Cell and Developmental Biology, 7(August), 1–13. 10.3389/fcell.2019.00172 [DOI] [PMC free article] [PubMed] [Google Scholar]
Nikoletopoulou V, Sidiropoulou K, Kallergi E, Dalezios Y, & Tavernarakis N (2017). Modulation of Autophagy by BDNF Underlies Synaptic Plasticity. Cell Metabolism, 26(1), 230–242.e5. 10.1016/j.cmet.2017.06.005 [DOI] [PubMed] [Google Scholar]
Nixon R. a, Wegiel J, Kumar A, Huang Yu W, Peterhoff C, Cataldo A, & Cuervo AM (2005). Extensive involvement of autophagy in Alzheimer’s disease: an immuno-electron microscopy study. J Neuropathol Exp Neurol, 64(2), 113–122. [DOI] [PubMed] [Google Scholar]
Ordureau A, Kraus F, Zhang J, An H, Park S, Ahfeldt T, Paulo JA, & Harper JW (2021). Temporal proteomics during neurogenesis reveals large-scale proteome and organelle remodeling via selective autophagy. Molecular Cell, 81. 10.1016/j.molcel.2021.10.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
Øverbye A, Fengsrud M, & Seglen PO (2007). Proteomic analysis of membrane-associated proteins from rat liver autophagosomes. Autophagy, 3(4), 300–322. 10.4161/auto.3910 [DOI] [PubMed] [Google Scholar]
Paulo JA, O’Connell JD, & Gygi SP (2016). A triple knockout (TKO) proteomics standard for diagnosing ion interference in isobaric labeling experiments. J Am Soc Mass Spectrom, 27(10), 1620–1625. 10.1007/s13361-016-1434-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
Rad R, Li J, Mintseris J, O’Connell J, Gygi SP, & Schweppe DK (2021). Improved Monoisotopic Mass Estimation for Deeper Proteome Coverage. Journal of Proteome Research, 20(1), 591–598. 10.1021/acs.jproteome.0c00563 [DOI] [PMC free article] [PubMed] [Google Scholar]
Savitski MM, Wilhelm M, Hahne H, Kuster B, & Bantscheff M (2015). A scalable approach for protein false discovery rate estimation in large proteomic data sets. Molecular and Cellular Proteomics, 14(9), 2394–2404. 10.1074/mcp.M114.046995 [DOI] [PMC free article] [PubMed] [Google Scholar]
Schmitt D, Bozkurt S, Henning-domres P, & Kern A (2021). Protein content and lipid profiling of isolated native autophagosomes. BioRxiv Biochemistry http://biorxiv.org/cgi/content/short/2021.04.16.440117v1?rss=1&utm_source=researcher_app&utm_medium=referral&utm_campaign=RESR_MRKT_Researcher_inbound [Google Scholar]
Schulz S, Lichtmannegger J, Schmitt S, Leitzinger C, Eberhagen C, Einer C, Kerth J, Aichler M, & Zischka H (2015). A protocol for the parallel isolation of intact mitochondria from rat liver, kidney, heart and brain. In Posch A (Ed.), In: Posch A (eds) Proteomic Profiling. Methods in Molecular Biology (Vol. 1295). 10.1007/978-1-4939-2550-6_7 [DOI] [PubMed] [Google Scholar]
Schweppe DK, Eng JK, Yu Q, Bailey D, Rad R, Navarrete-Perea J, Huttlin EL, Erickson BK, Paulo JA, & Gygi SP (2020). Full-Featured, Real-Time Database Searching Platform Enables Fast and Accurate Multiplexed Quantitative Proteomics. Journal of Proteome Research, 19(5), 2026–2034. 10.1021/acs.jproteome.9b00860 [DOI] [PMC free article] [PubMed] [Google Scholar]
Shehata M, Matsumura H, Okubo-Suzuki R, Ohkawa N, & Inokuchi K (2012). Neuronal stimulation induces autophagy in hippocampal neurons that is involved in AMPA receptor degradation after chemical long-term depression. Journal of Neuroscience, 32(30), 10413–10422. 10.1523/JNEUROSCI.4533-11.2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
Soubannier V, Rippstein P, Kaufman BA, Shoubridge EA, & McBride HM (2012). Reconstitution of Mitochondria Derived Vesicle Formation Demonstrates Selective Enrichment of Oxidized Cargo. PLoS ONE, 7(12). 10.1371/journal.pone.0052830 [DOI] [PMC free article] [PubMed] [Google Scholar]
Stavoe AK, Gopal PP, Gubas A, Tooze SA, & Holzbaur EL (2019). Expression of WIPI2B counteracts age-related decline in autophagosome biogenesis in neurons. ELife, 8, 1–36. 10.7554/elife.44219 [DOI] [PMC free article] [PubMed] [Google Scholar]
Strømhaug PE, Berg TO, Fengsrud M, & Seglen PO (1998). Purification and characterization of autophagosomes from rat hepatocytes. Biochemical Journal, 335(2), 217–224. 10.1042/bj3350217 [DOI] [PMC free article] [PubMed] [Google Scholar]
Sugiura A, McLelland G, Fon EA, & McBride HM (2014). A new pathway for mitochondrial quality control: mitochondrial-derived vesicles. The EMBO Journal, 33(19), 2142–2156. 10.15252/embj.201488104 [DOI] [PMC free article] [PubMed] [Google Scholar]
Szatmari Z, Kis V, Lippai M, Hegedus K, Farago T, Lorincz P, Tanaka T, Juhasz G, & Sass M (2014). Rab11 facilitates cross-talk between autophagy and endosomal pathway through regulation of Hook localization. Molecular Biology of the Cell, 25(4), 522–531. 10.1091/mbc.E13-10-0574 [DOI] [PMC free article] [PubMed] [Google Scholar]
Tellez-Nagel I, Johnson AB, & Terry RD (1974). Studies on brain biopsies of patients with Huntington’s Chorea. J Neuropathol Exp Neurol, 33(2), 308–332. doi: 10.1097/00005072-197404000-00008 [DOI] [PubMed] [Google Scholar]
Truckenbrodt S, Viplav A, Jähne S, Vogts A, Denker A, Wildhagen H, Fornasiero EF, & Rizzoli SO (2018). Newly produced synaptic vesicle proteins are preferentially used in synaptic transmission. The EMBO Journal, 37(15), 1–24. 10.15252/embj.201798044 [DOI] [PMC free article] [PubMed] [Google Scholar]
Tyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, Mann M, & Cox J (2016). The Perseus computational platform for comprehensive analysis of (prote)omics data. Nature Methods, 13(9), 731–740. 10.1038/nmeth.3901 [DOI] [PubMed] [Google Scholar]
van Beek N, Klionsky DJ, & Reggiori F (2018). Genetic aberrations in macroautophagy genes leading to diseases. Biochimica et Biophysica Acta - Molecular Cell Research, 1865(5), 803–816. 10.1016/j.bbamcr.2018.03.002 [DOI] [PubMed] [Google Scholar]
Vincow ES, Thomas RE, Merrihew GE, Shulman NJ, Bammler TK, MacDonald JW, MacCoss MJ, & Pallanck LJ (2019). Autophagy accounts for approximately one-third of mitochondrial protein turnover and is protein selective. Autophagy, 15(9), 1592–1605. 10.1080/15548627.2019.1586258 [DOI] [PMC free article] [PubMed] [Google Scholar]
Wong YC, & Holzbaur ELF (2014). The regulation of autophagosome dynamics by huntingtin and HAP1 is disrupted by expression of mutant huntingtin, leading to defective cargo degradation. Journal of Neuroscience, 34(4), 1293–1305. 10.1523/JNEUROSCI.1870-13.2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
Xie Z, Bailey A, Kuleshov MV, Clarke DJB, Evangelista JE, Jenkins SL, Lachmann A, Wojciechowicz ML, Kropiwnicki E, Jagodnik KM, Jeon M, & Ma’ayan A (2021). Gene Set Knowledge Discovery with Enrichr. Current Protocols, 1(3), 1–51. 10.1002/cpz1.90 [DOI] [PMC free article] [PubMed] [Google Scholar]
Yu CH, Davidson S, Harapas CR, Hilton JB, Mlodzianoski MJ, Laohamonthonkul P, Louis C, Low RRJ, Moecking J, De Nardo D, Balka KR, Calleja DJ, Moghaddas F, Ni E, McLean CA, Samson AL, Tyebji S, Tonkin CJ, Bye CR, … Masters SL (2020). TDP-43 Triggers Mitochondrial DNA Release via mPTP to Activate cGAS/STING in ALS. Cell, 183(3), 636–649.e18. 10.1016/j.cell.2020.09.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
Zellner S, Schifferer M, & Behrends C (2021). Systematically defining selective autophagy receptor-specific cargo using autophagosome content profiling. Molecular Cell, 81(6), 1337–1354.e8. 10.1016/j.molcel.2021.01.009 [DOI] [PubMed] [Google Scholar]
Zhang T, Shen S, Qu J, & Ghaemmaghami S (2016). Global Analysis of Cellular Protein Flux Quantifies the Selectivity of Basal Autophagy. Cell Reports, 14(10), 2426–2439. 10.1016/j.celrep.2016.02.040 [DOI] [PMC free article] [PubMed] [Google Scholar]
Zhang X, Wang T, Ji J, Wang H, Zhu X, Du P, Zhu Y, Huang Y, & Chen W (2020). The distinct spatiotemporal distribution and effect of feed restriction on mtDNA copy number in broilers. Scientific Reports, 10(1), 1–11. 10.1038/s41598-020-60123-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

NIHMS1772846-supplement-1.pdf^{(9.7MB, pdf)}

NIHMS1772846-supplement-2.xlsx^{(4MB, xlsx)}

Data Availability Statement

The full proteomic data sets reported here are included in the supplement (Table S1). All other data are available from the lead contact upon request.
No original code was generated in the course of this study.
Any additional data or information required to reanalyze the data reported in this paper is available from the lead contact upon request.

[R1] Ahier A, Dai C-Y, Kirmes I, Cummins N, Hung GCC, Götz J, & Zuryn S (2021). PINK1 and parkin shape the organism-wide distribution of a deleterious mitochondrial genome. Cell Reports, 35(9), 109203. 10.1016/j.celrep.2021.109203 [DOI] [PubMed] [Google Scholar]

[R2] An H, Ordureau A, Körner M, Paulo JA, & Harper JW (2020). Systematic quantitative analysis of ribosome inventory during nutrient stress. Nature, 583(7815), 303–309. 10.1038/s41586-020-2446-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[R3] An H, Ordureau A, Paulo JA, Shoemaker CJ, Denic V, & Harper JW (2019). TEX264 Is an Endoplasmic Reticulum-Resident ATG8-Interacting Protein Critical for ER Remodeling during Nutrient Stress. Molecular Cell, 74(5), 891–908.e10. 10.1016/j.molcel.2019.03.034 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R4] Anglade P, Vyas S, Javoy-Agid F, Herrero M, Michel P, Marquez J, Mouatt-Prigent A, Ruberg M, Hirsch E, & Agid Y (1997). Apoptosis and autophagy in nigral neurons of patients with Parkinson’s disease. Histology and Histopathology, 12(1), 25–31. [PubMed] [Google Scholar]

[R5] Behrends C, Sowa ME, Gygi SP, & Harper JW (2010). Network organization of the human autophagy system. Nature, 466(7302), 68–76. 10.1038/nature09204.Network [DOI] [PMC free article] [PubMed] [Google Scholar]

[R6] Boecker CA, Goldsmith J, Dou D, Cajka GG, & Holzbaur ELF (2021). Increased LRRK2 kinase activity alters neuronal autophagy by disrupting the axonal transport of autophagosomes. Current Biology, 31(10), 2140–2154.e6. 10.1016/j.cub.2021.02.061 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R7] Borsche M, König IR, Delcambre S, Petrucci S, Balck A, Bruggemann N, Zimprich A, Wasner K, Pereira SL, Avenali M, Deuschle C, Badanjak K, Ghelfi J, Gasser T, Kasten M, Rosenstiel P, Lohmann K, Brockmann K, Valente EM, … Klein C (2020). Mitochondrial damage-associated inflammation highlights biomarkers in PRKN/PINK1 parkinsonism. Brain, 143(10), 3041–3051. 10.1093/brain/awaa246 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R8] Calvo SE, Clauser KR, & Mootha VK (2016). MitoCarta2.0: An updated inventory of mammalian mitochondrial proteins. Nucleic Acids Research, 44(D1), D1251–D1257. 10.1093/nar/gkv1003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R9] Cason SE, Carman P, Van Duyne C, Goldsmith J, Dominguez R, & Holzbaur ELF (2021). Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathway. Journal of Cell Biology, 220(7). 10.1083/jcb.202010179 1of [DOI] [PMC free article] [PubMed] [Google Scholar]

[R10] Chen EY, Tan CM, Kou Y, Duan Q, Wang Z, Meirelles GV, Clark NR, & Ma’ayan A (2013). Enrichr: Interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinformatics, 14. 10.1186/1471-2105-14-128 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R11] Compans B, Camus C, Kallergi E, Sposini S, Martineau M, Butler C, Kechkar A, Klaassen RV, Retailleau N, Sejnowski TJ, Smit AB, Sibarita JB, Bartol TM, Perrais D, Nikoletopoulou V, Choquet D, & Hosy E (2021). NMDAR-dependent long-term depression is associated with increased short term plasticity through autophagy mediated loss of PSD-95. Nature Communications, 12(1), 1–18. 10.1038/s41467-021-23133-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R12] Dengjel J, Høyer-Hansen M, Nielsen MO, Eisenberg T, Harder LM, Schandorff S, Farkas T, Kirkegaard T, Becker AC, Schroeder S, Vanselow K, Lundberg E, Nielsen MM, Kristensen AR, Akimov V, Bunkenborg J, Madeo F, Jäättelä M, & Andersen JS (2012). Identification of autophagosome-associated proteins and regulators by quantitative proteomic analysis and genetic screens. Molecular and Cellular Proteomics, 11(3), 1–17. 10.1074/mcp.M111.014035 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R13] Eng JK, Jahan TA, & Hoopmann MR (2013). Comet: An open-source MS/MS sequence database search tool. Proteomics, 13(1), 22–24. 10.1002/pmic.201200439 [DOI] [PubMed] [Google Scholar]

[R14] Erickson BK, Mintseris J, Schweppe DK, Navarrete-Perea J, Erickson AR, Nusinow DP, Paulo JA, & Gygi SP (2019). Active Instrument Engagement Combined with a Real-Time Database Search for Improved Performance of Sample Multiplexing Workflows. Journal of Proteome Research, 18(3), 1299–1306. 10.1021/acs.jproteome.8b00899 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R15] Evans CS, & Holzbaur EL (2020). Degradation of engulfed mitochondria is rate-limiting in Optineurin-mediated mitophagy in neurons. ELife, 9, 1–30. 10.7554/eLife.50260 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R16] Fernandopulle MS, Prestil R, Grunseich C, Wang C, Gan L, & Ward ME (2018). Transcription-factor mediated differentiation of human iPSCs into neurons. Current Protocols in Cell Biology, 79(1). 10.1016/j.physbeh.2017.03.040 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R17] Friedman JR, Lackner LL, West M, DiBenedetto JR, Nunnari J, & Voeltz GK (2011). ER tubules mark sites of mitochondrial division. Science, 334(6054), 358–362. 10.1126/science.1207385 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R18] Gao W, Kang JH, Liao Y, Ding WX, Gambotto AA, Watkins SC, Liu YJ, Stolz DB, & Yin XM (2010). Biochemical isolation and characterization of the tubulovesicular LC3-positive autophagosomal compartment. Journal of Biological Chemistry, 285(2), 1371–1383. 10.1074/jbc.M109.054197 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R19] Hara T, Nakamura K, Matsui M, Yamamoto A, Nakahara Y, Suzuki-Migishima R, Yokoyama M, Mishima K, Saito I, Okano H, & Mizushima N (2006). Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature, 441(7095), 885–889. 10.1038/nature04724 [DOI] [PubMed] [Google Scholar]

[R20] Harding O, Evans CS, Ye J, Cheung J, Maniatis T, & Holzbaur ELF (2021). ALS and FTD-associated missense mutations in TBK1 differentially disrupt mitophagy. [DOI] [PMC free article] [PubMed]

[R21] He J, Cooper HM, Reyes A, Di Re M, Sembongi H, Gao J, Neuman KC, Fearnley IM, Spinazzola A, Walker JE, & Holt IJ (2012). Mitochondrial nucleoid interacting proteins support mitochondrial protein synthesis. Nucleic Acids Research, 40(13), 6109–6121. 10.1093/nar/gks266 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R22] Hill SE, & Colón-Ramos DA (2020). The Journey of the Synaptic Autophagosome: A Cell Biological Perspective. Neuron, 105(6), 961–973. 10.1016/j.neuron.2020.01.018 [DOI] [PubMed] [Google Scholar]

[R23] Hoffmann-Conaway S, Brockmann MM, Schneider K, Annamneedi A, Rahman KA, Bruns C, Textoris-Taube K, Trimbuch T, Smalla KH, Rosenmund C, Gundelfinger ED, Garner CC, & Montenegro-Venegas C (2020). Parkin contributes to synaptic vesicle autophagy in bassoon-deficient mice. ELife, 9, 1–30. 10.7554/eLife.56590 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R24] Hoffmann S, Orlando M, Andrzejak E, Bruns C, Trimbuch T, Rosenmund C, Garner CC, & Ackermann F (2019). Light-activated ROS production induces synaptic autophagy. Journal of Neuroscience, 39(12), 2163–2183. 10.1523/JNEUROSCI.1317-18.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R25] Hung V, Lam SS, Udeshi ND, Svinkina T, Guzman G, Mootha VK, Carr SA, & Ting AY (2017). Proteomic mapping of cytosol-facing outer mitochondrial and ER membranes in living human cells by proximity biotinylation. ELife, 6, 1–39. 10.7554/eLife.24463 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R26] Huttlin EL, Jedrychowski MP, Elias JE, Goswami T, Rad R, Beausoleil SA, Villén J, Haas W, Sowa ME, & Gygi SP (2010). A tissue-specific atlas of mouse protein phosphorylation and expression. Cell, 143(7), 1174–1189. 10.1016/j.cell.2010.12.001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R27] Kleele T, Rey T, Winter J, Zaganelli S, Mahecic D, Perreten Lambert H, Ruberto FP, Nemir M, Wai T, Pedrazzini T, & Manley S (2021). Distinct fission signatures predict mitochondrial degradation or biogenesis. Nature, 593(November 2019). 10.1038/s41586-021-03510-6 [DOI] [PubMed] [Google Scholar]

[R28] Komatsu M, Waguri S, Chiba T, Murata S, Iwata J, Tanida I, Ueno T, Koike M, Uchiyama Y, Kominami E, & Tanaka K (2006). Loss of autophagy in the central nervous system causes neurodegeneration in mice. Nature, 441(7095), 880–884. 10.1038/nature04723 [DOI] [PubMed] [Google Scholar]

[R29] Koopmans F, van Nierop P, Andres-Alonso M, Byrnes A, Cijsouw T, Coba MP, Cornelisse LN, Farrell RJ, Goldschmidt HL, Howrigan DP, Hussain NK, Imig C, de Jong APH, Jung H, Kohansalnodehi M, Kramarz B, Lipstein N, Lovering RC, MacGillavry H, … Verhage M (2019). SynGO: An Evidence-Based, Expert-Curated Knowledge Base for the Synapse. Neuron, 103(2), 217–234.e4. 10.1016/j.neuron.2019.05.002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R30] Kuchitsu Y, Homma Y, Fujita N, & Fukuda M (2018). Rab7 knockout unveils regulated autolysosome maturation induced by glutamine starvation. Journal of Cell Science, 131(7). 10.1242/jcs.215442 [DOI] [PubMed] [Google Scholar]

[R31] Kuijpers M, Kochlamazashvili G, Stumpf A, Puchkov D, Swaminathan A, Lucht MT, Krause E, Maritzen T, Schmitz D, & Haucke V (2021). Neuronal Autophagy Regulates Presynaptic Neurotransmission by Controlling the Axonal Endoplasmic Reticulum. Neuron, 109(2), 299–313.e9. 10.1016/j.neuron.2020.10.005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R32] Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan Q, Wang Z, Koplev S, Jenkins SL, Jagodnik KM, Lachmann A, McDermott MG, Monteiro CD, Gundersen GW, & Ma’ayan A (2016). Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Research, 44(W1), W90–W97. 10.1093/nar/gkw377 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R33] Le Guerroué F, Eck F, Jung J, Starzetz T, Mittelbronn M, Kaulich M, & Behrends C (2017). Autophagosomal Content Profiling Reveals an LC3C-Dependent Piecemeal Mitophagy Pathway. Molecular Cell, 68(4), 786–796. 10.1016/j.molcel.2017.10.029 [DOI] [PubMed] [Google Scholar]

[R34] Lee H, Fenster RJ, Pineda SS, Gibbs WS, Mohammadi S, Davila-Velderrain J, Garcia FJ, Therrien M, Novis HS, Gao F, Wilkinson H, Vogt T, Kellis M, LaVoie MJ, & Heiman M (2020). Cell Type-Specific Transcriptomics Reveals that Mutant Huntingtin Leads to Mitochondrial RNA Release and Neuronal Innate Immune Activation. Neuron, 107(5), 891–908.e8. 10.1016/j.neuron.2020.06.021 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R35] Lewis SC, Uchiyama LF, & Nunnari J (2016). ER-mitochondria contacts couple mtDNA synthesis with Mitochondrial division in human cells. Science, 353(6296). 10.1126/science.aaf5549 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R36] Maday S, & Holzbaur ELF (2014). Autophagosome biogenesis in primary neurons follows an ordered and spatially regulated pathway. Developmental Cell, 30(1), 71–85. 10.1016/j.devcel.2014.06.001.Autophagosome [DOI] [PMC free article] [PubMed] [Google Scholar]

[R37] Maday S, Wallace KE, & Holzbaur ELF (2012). Autophagosomes initiate distally and mature during transport toward the cell soma in primary neurons. Journal of Cell Biology, 196(4), 407–417. 10.1083/jcb.201106120 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R38] Mancias JD, Wang X, Gygi SP, Harper JW, & Kimmelman AC (2014). Quantitative proteomics identifies NCOA4 as the cargo receptor mediating ferritinophagy. Nature, 509(7498), 105–109. 10.1038/nature13148 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R39] Mathew R, Khor S, Hackett S, Rabinowitz J, Perlman D, & White E (2014). Functional Role of Autophagy-Mediated Proteome Remodeling in Cell Survival Signaling and Innate Immunity. Molecular Cell, 55(6), 916–930. 10.1016/j.molcel.2014.07.019 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R40] McAlister GC, Nusinow DP, Jedrychowski MP, Wühr M, Huttlin EL, Erickson BK, Rad R, Haas W, & Gygi SP (2014). MultiNotch MS3 enables accurate, sensitive, and multiplexed detection of differential expression across cancer cell line proteomes. Analytical Chemistry, 86(14), 7150–7158. 10.1021/ac502040v [DOI] [PMC free article] [PubMed] [Google Scholar]

[R41] McWilliams TG, Prescott AR, Montava-Garriga L, Ball G, Singh F, Barini E, Muqit MMK, Brooks SP, & Ganley IG (2018). Basal Mitophagy Occurs Independently of PINK1 in Mouse Tissues of High Metabolic Demand. Cell Metabolism, 27(2), 439–449.e5. 10.1016/j.cmet.2017.12.008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R42] Moltedo O, Remondelli P, & Amodio G (2019). The mitochondria–endoplasmic reticulum contacts and their critical role in aging and age-associated diseases. Frontiers in Cell and Developmental Biology, 7(August), 1–13. 10.3389/fcell.2019.00172 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R43] Nikoletopoulou V, Sidiropoulou K, Kallergi E, Dalezios Y, & Tavernarakis N (2017). Modulation of Autophagy by BDNF Underlies Synaptic Plasticity. Cell Metabolism, 26(1), 230–242.e5. 10.1016/j.cmet.2017.06.005 [DOI] [PubMed] [Google Scholar]

[R44] Nixon R. a, Wegiel J, Kumar A, Huang Yu W, Peterhoff C, Cataldo A, & Cuervo AM (2005). Extensive involvement of autophagy in Alzheimer’s disease: an immuno-electron microscopy study. J Neuropathol Exp Neurol, 64(2), 113–122. [DOI] [PubMed] [Google Scholar]

[R45] Ordureau A, Kraus F, Zhang J, An H, Park S, Ahfeldt T, Paulo JA, & Harper JW (2021). Temporal proteomics during neurogenesis reveals large-scale proteome and organelle remodeling via selective autophagy. Molecular Cell, 81. 10.1016/j.molcel.2021.10.001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R46] Øverbye A, Fengsrud M, & Seglen PO (2007). Proteomic analysis of membrane-associated proteins from rat liver autophagosomes. Autophagy, 3(4), 300–322. 10.4161/auto.3910 [DOI] [PubMed] [Google Scholar]

[R47] Paulo JA, O’Connell JD, & Gygi SP (2016). A triple knockout (TKO) proteomics standard for diagnosing ion interference in isobaric labeling experiments. J Am Soc Mass Spectrom, 27(10), 1620–1625. 10.1007/s13361-016-1434-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R48] Rad R, Li J, Mintseris J, O’Connell J, Gygi SP, & Schweppe DK (2021). Improved Monoisotopic Mass Estimation for Deeper Proteome Coverage. Journal of Proteome Research, 20(1), 591–598. 10.1021/acs.jproteome.0c00563 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R49] Savitski MM, Wilhelm M, Hahne H, Kuster B, & Bantscheff M (2015). A scalable approach for protein false discovery rate estimation in large proteomic data sets. Molecular and Cellular Proteomics, 14(9), 2394–2404. 10.1074/mcp.M114.046995 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R50] Schmitt D, Bozkurt S, Henning-domres P, & Kern A (2021). Protein content and lipid profiling of isolated native autophagosomes. BioRxiv Biochemistry http://biorxiv.org/cgi/content/short/2021.04.16.440117v1?rss=1&utm_source=researcher_app&utm_medium=referral&utm_campaign=RESR_MRKT_Researcher_inbound [Google Scholar]

[R51] Schulz S, Lichtmannegger J, Schmitt S, Leitzinger C, Eberhagen C, Einer C, Kerth J, Aichler M, & Zischka H (2015). A protocol for the parallel isolation of intact mitochondria from rat liver, kidney, heart and brain. In Posch A (Ed.), In: Posch A (eds) Proteomic Profiling. Methods in Molecular Biology (Vol. 1295). 10.1007/978-1-4939-2550-6_7 [DOI] [PubMed] [Google Scholar]

[R52] Schweppe DK, Eng JK, Yu Q, Bailey D, Rad R, Navarrete-Perea J, Huttlin EL, Erickson BK, Paulo JA, & Gygi SP (2020). Full-Featured, Real-Time Database Searching Platform Enables Fast and Accurate Multiplexed Quantitative Proteomics. Journal of Proteome Research, 19(5), 2026–2034. 10.1021/acs.jproteome.9b00860 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R53] Shehata M, Matsumura H, Okubo-Suzuki R, Ohkawa N, & Inokuchi K (2012). Neuronal stimulation induces autophagy in hippocampal neurons that is involved in AMPA receptor degradation after chemical long-term depression. Journal of Neuroscience, 32(30), 10413–10422. 10.1523/JNEUROSCI.4533-11.2012 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R54] Soubannier V, Rippstein P, Kaufman BA, Shoubridge EA, & McBride HM (2012). Reconstitution of Mitochondria Derived Vesicle Formation Demonstrates Selective Enrichment of Oxidized Cargo. PLoS ONE, 7(12). 10.1371/journal.pone.0052830 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R55] Stavoe AK, Gopal PP, Gubas A, Tooze SA, & Holzbaur EL (2019). Expression of WIPI2B counteracts age-related decline in autophagosome biogenesis in neurons. ELife, 8, 1–36. 10.7554/elife.44219 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R56] Strømhaug PE, Berg TO, Fengsrud M, & Seglen PO (1998). Purification and characterization of autophagosomes from rat hepatocytes. Biochemical Journal, 335(2), 217–224. 10.1042/bj3350217 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R57] Sugiura A, McLelland G, Fon EA, & McBride HM (2014). A new pathway for mitochondrial quality control: mitochondrial-derived vesicles. The EMBO Journal, 33(19), 2142–2156. 10.15252/embj.201488104 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R58] Szatmari Z, Kis V, Lippai M, Hegedus K, Farago T, Lorincz P, Tanaka T, Juhasz G, & Sass M (2014). Rab11 facilitates cross-talk between autophagy and endosomal pathway through regulation of Hook localization. Molecular Biology of the Cell, 25(4), 522–531. 10.1091/mbc.E13-10-0574 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R59] Tellez-Nagel I, Johnson AB, & Terry RD (1974). Studies on brain biopsies of patients with Huntington’s Chorea. J Neuropathol Exp Neurol, 33(2), 308–332. doi: 10.1097/00005072-197404000-00008 [DOI] [PubMed] [Google Scholar]

[R60] Truckenbrodt S, Viplav A, Jähne S, Vogts A, Denker A, Wildhagen H, Fornasiero EF, & Rizzoli SO (2018). Newly produced synaptic vesicle proteins are preferentially used in synaptic transmission. The EMBO Journal, 37(15), 1–24. 10.15252/embj.201798044 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R61] Tyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, Mann M, & Cox J (2016). The Perseus computational platform for comprehensive analysis of (prote)omics data. Nature Methods, 13(9), 731–740. 10.1038/nmeth.3901 [DOI] [PubMed] [Google Scholar]

[R62] van Beek N, Klionsky DJ, & Reggiori F (2018). Genetic aberrations in macroautophagy genes leading to diseases. Biochimica et Biophysica Acta - Molecular Cell Research, 1865(5), 803–816. 10.1016/j.bbamcr.2018.03.002 [DOI] [PubMed] [Google Scholar]

[R63] Vincow ES, Thomas RE, Merrihew GE, Shulman NJ, Bammler TK, MacDonald JW, MacCoss MJ, & Pallanck LJ (2019). Autophagy accounts for approximately one-third of mitochondrial protein turnover and is protein selective. Autophagy, 15(9), 1592–1605. 10.1080/15548627.2019.1586258 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R64] Wong YC, & Holzbaur ELF (2014). The regulation of autophagosome dynamics by huntingtin and HAP1 is disrupted by expression of mutant huntingtin, leading to defective cargo degradation. Journal of Neuroscience, 34(4), 1293–1305. 10.1523/JNEUROSCI.1870-13.2014 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R65] Xie Z, Bailey A, Kuleshov MV, Clarke DJB, Evangelista JE, Jenkins SL, Lachmann A, Wojciechowicz ML, Kropiwnicki E, Jagodnik KM, Jeon M, & Ma’ayan A (2021). Gene Set Knowledge Discovery with Enrichr. Current Protocols, 1(3), 1–51. 10.1002/cpz1.90 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R66] Yu CH, Davidson S, Harapas CR, Hilton JB, Mlodzianoski MJ, Laohamonthonkul P, Louis C, Low RRJ, Moecking J, De Nardo D, Balka KR, Calleja DJ, Moghaddas F, Ni E, McLean CA, Samson AL, Tyebji S, Tonkin CJ, Bye CR, … Masters SL (2020). TDP-43 Triggers Mitochondrial DNA Release via mPTP to Activate cGAS/STING in ALS. Cell, 183(3), 636–649.e18. 10.1016/j.cell.2020.09.020 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R67] Zellner S, Schifferer M, & Behrends C (2021). Systematically defining selective autophagy receptor-specific cargo using autophagosome content profiling. Molecular Cell, 81(6), 1337–1354.e8. 10.1016/j.molcel.2021.01.009 [DOI] [PubMed] [Google Scholar]

[R68] Zhang T, Shen S, Qu J, & Ghaemmaghami S (2016). Global Analysis of Cellular Protein Flux Quantifies the Selectivity of Basal Autophagy. Cell Reports, 14(10), 2426–2439. 10.1016/j.celrep.2016.02.040 [DOI] [PMC free article] [PubMed] [Google Scholar]

[R69] Zhang X, Wang T, Ji J, Wang H, Zhu X, Du P, Zhu Y, Huang Y, & Chen W (2020). The distinct spatiotemporal distribution and effect of feed restriction on mtDNA copy number in broilers. Scientific Reports, 10(1), 1–11. 10.1038/s41598-020-60123-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Brain-derived autophagosome profiling reveals the engulfment of nucleoid-enriched mitochondrial fragments by basal autophagy in neurons

Juliet Goldsmith

Alban Ordureau

J Wade Harper

Erika L F Holzbaur

Summary

eTOC

Graphical Abstract

Introduction

Results and Discussion

Figure 1: Proteomic profiling of isolated AVs identifies synaptic proteins as an abundant autophagic cargo.

Proteomics identify cargos of basal autophagy in the brain

Mitochondrial fragments are engulfed by basal autophagy in neurons

Figure 2: Basal brain-derived autophagic vesicles are enriched for mitochondrial fragments but not autophagy adaptors or mitophagy proteins.

Mitochondrial nucleoids are enriched in neuronal AVs

Figure 3: Nucleoid-enriched mitochondrial fragments containing TFAM and mtDNA are cargo in brain-derived and neuron-derived autophagic vesicles.

Nucleoid-enriched mitochondrial fragment engulfment by axonal autophagy requires Drp1-dependent mitochondrial fission

Figure 4: Drp1 is required for nucleoid-enriched mitochondrial fragment engulfment by autophagosomes in neurons.

STAR Methods

RESOURCE AVAILABILITY

Lead contact

Materials availability

Data and code availability

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Animal models

Cell lines, primary cultures

METHOD DETAILS

Isolation of autophagic vesicles by differential centrifugation

Crude mitochondrial fraction enrichment

Proteomics- sample preparation and digestion

Proteomics - Off-line basic pH reversed-phase (BPRP) fractionation

Proteomics – Liquid chromatography and tandem mass spectrometry

Proteomics - Data analysis

Immunoblotting

GFP immunoprecipitation

Transfection for live imaging

Electron microscopy

Immunofluorescence of AVs

qPCR

QUANTIFICATION AND STATISTICAL ANALYSIS

Supplementary Material

KEY RESOURCES TABLE.

Highlights:

Acknowledgments

Footnotes

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases