Skip to main content
NCBI home page
Journal of Anatomy logoLink to Journal of Anatomy
. 2021 Oct 31;240(4):688–699. doi: 10.1111/joa.13583

Morphology and chemical characteristics of taste buds associated with P2X3‐immunoreactive afferent nerve endings in the rat incisive papilla

Motoi Ito 1, Takuya Yokoyama 2,✉, Masato Hirakawa 2, Yoshio Yamamoto 3, Wakana Sakanoue 1, Kenichi Sato 1, Tomoyuki Saino 2
PMCID: PMC8930809  PMID: 34719779

Abstract

The present study investigated the cellular components and afferent innervations of taste buds in the rat incisive papilla by immunohistochemistry using confocal scanning laser microscopy. Taste buds containing guanine nucleotide‐binding protein G(t), subunit α3 (GNAT3)‐imunoreactive cells were densely distributed in the lateral wall of incisive papilla forming the opening of nasoincisor ducts. GNAT3‐immunoreactive cells in the taste buds were slender in shape and the tips of apical processes gathered at one point at the surface of the epithelium. The number of taste buds was 56.8 ± 4.5 in the incisive papilla. The incisive taste buds also contained ectonucleoside triphosphate diphosphohydrolase 2‐immunoreactive cells and synaptotagmin‐1‐immunoreactive cells in addition to GNAT3‐immunoreactive cells. Furthermore, GNAT3‐immunoreactive cells were immunoreactive to taste transduction molecules such as phospholipase C, β2‐subunit, and inositol 1,4,5‐trisphosphate receptor, type 3. P2X3‐immunoreactive subepithelial nerve fibers intruded into the taste buds and terminated with hederiform or calix‐like nerve endings attached to GNAT3‐immunoreactive cells and synaptosomal‐associated protein, 25 kDa‐immunoreactive cells. Some P2X3‐immunoreactive endings were also weakly immunoreactive for P2X2. Furthermore, a retrograde tracing method using fast blue dye indicated that most of the P2X3‐immunoreactive nerve endings originated from the geniculate ganglia (GG) of the facial nerve. These results suggest that incisive taste buds are morphologically and cellularly homologous to lingual taste buds and are innervated by P2X3‐immunoreactive nerve endings derived from the GG. The incisive papilla may be the palatal taste papilla that transmits chemosensory information in the oral cavity to the GG via P2X3‐immunoreactive afferent nerve endings.

Keywords: geniculate ganglia, GNAT3, incisive papilla, P2X purinoceptor, taste buds

Taste buds containing guanine nucleotide‐binding protein G(t), subunit α3 (GNAT3)‐immunoreactive cells were distributed in the walls of the incisive papilla composing the orifice of the nasoincisor ducts. Incisive taste buds also contained ectonucleoside triphosphate diphosphohydrolase 2 (ENTPD2)‐ and synaptotagmin‐1 (Syt1)‐immunoreactive cells, and innervated by P2X3‐immunoreactive afferent nerve endings originated from the geniculate ganglia (GG). The incisive papilla may be the palatal taste papilla that transmits chemosensory information to the GG via P2X3‐immunoreactive afferent nerve endings.

graphic file with name JOA-240-688-g007.jpg

1. INTRODUCTION

Taste buds are cell clusters of slender taste cells that detect chemical substances and are distributed in the lingual, palatal, and pharyngeal epithelia. In lingual taste buds, taste cells have been classified into three subtypes: type I cells (sustentacular cells), type II cells (receptor cells), and type III cells (presynaptic cells). Type I cells have lamellar cytoplasmic extensions that ensheath other taste cells. Immunohistochemically, type II cells express G protein‐coupled receptors detecting sweet, bitter, or umami tastes (DeFazio et al., 2006; Zhang et al., 2003). They also contain taste transduction molecules such as guanine nucleotide‐binding protein G(t), subunit α3 (GNAT3 or α‐gustducin), phospholipase C, β2‐subunit (PLCβ2), inositol 1,4,5‐trisphosphate receptor type 3 (IP3R3), and transient receptor potential cation channel subfamily M member 5 (TRPM5; Clapp et al., 2001; Pérez et al., 2002; Rössler et al., 1998; Ruiz‐Avila et al., 1995). Type III cells form synaptic contacts with gustatory afferent nerve fibers and have been shown to express molecules associated with vesicular exocytoses such as synaptosomal‐associated protein, 25 kDa (SNAP25), and synaptotagmin‐1 (Syt1; Kohno et al., 2005; Yang et al., 2000).

The palatal taste buds are distributed in three regions: soft palate, geschmachsstreifen (palatal taste stripe), and incisive papilla associated with nasoincisor ducts connecting the nasal and oral cavities in the rear of the upper incisors (Miller & Spangler, 1982). Although the exact function of incisive taste buds remains unknown, electrophysiologic studies suggest that the incisive papilla near the opening of nasoincisor ducts plays a role in sweet taste transduction (Travers & Norgren, 1991; Travers et al., 1986). Previous immunohistochemical studies have revealed that taste buds of the rat incisive papilla contain GNAT3‐immunoreactive cells and SNAP25‐immunoreactive cells (El‐Sharaby et al., 2001; Pumplin & Getschman, 2000). However, the morphological characteristics and cellular components of taste buds in the incisive papilla have not yet been elucidated in detail.

In lingual taste buds, adenosine 5′‐triphosphate (ATP) functions as the major excitatory transmitter in taste transduction. Nerve endings immunoreactive for P2X2/P2X3 purinoceptors were distributed in rat lingual taste buds (Kataoka et al., 2006; Yang et al., 2012). Type II cells in lingual taste buds released ATP in response to tastant stimulation, and the released ATP then activated afferent fibers via P2X2/P2X3 purinoceptors (see reviews, Kinnamon & Finger, 2013; Roper, 2013). On the other hand, type I cells in lingual taste buds express ectonucleoside triphosphate diphosphohydrolase 2 (ENTPD2 or ecto‐ATPase) and therefore may be involved in degrading ATP (Bartel et al., 2006; Vandenbeuch et al., 2013). However, it currently remains unknown whether P2X purinoceptor‐expressing afferent nerve endings innervate taste buds in the rat incisive papilla. Investigation of taste bud regeneration in the rat incisive papilla following greater superficial petrosal nerve (GSP) transection has indicated taste buds to be innervated by GSP projections from the geniculate ganglia (GG; St. John et al., 2003). Moreover, immunoreactivities for P2X2 and P2X3 purinoceptors have been detected in sensory neurons of the rat and mouse GG (Ishida et al., 2009). These findings suggest that taste buds in the incisive papilla are innervated by P2X purinoceptors‐containing afferent nerve endings originating in the GG.

In the present study, we examined the cellular components and afferent innervations of taste buds in the rat incisive papilla using immunohistochemistry with confocal laser scanning microscopy. Various immunohistochemical markers were used for multilabeling immunofluorescence in order to identify taste cells and elucidate the morphological relationship between these cells and P2X3‐immunoreactive afferent nerve endings in incisive taste buds. Furthermore, we also performed retrograde neurotracing using fast blue (FB) dye to identify the origin of P2X3‐immunoreactive nerve endings innervating taste buds of the incisive papilla.

2. MATERIALS AND METHODS

2.1. Animal procedures

All animal experiments in the present study were approved by and conducted under the authority of the Iwate Medical University Institutional Animal Care and Use Committee (accession number 30‐026). Male Wistar rats (8–10 weeks old; totally, n = 40) were purchased from Japan SLC, Inc. (Slc: Wistar; Japan SLC). The animal room was maintained at a room temperature of 24 ± 0.5°C and relative humidity of 50 ± 10% with a regular light‐dark cycle (12 h of light and 10 h of darkness per day). A commercial diet (MF; Oriental Yeast Co.) and ultrafiltrated water were given ad libitum.

2.2. Immunohistochemistry

Details of the antibodies used in the present study and their combinations are shown in Tables 1, 2, 3.

TABLE 1.

Primary antibodies used in the present study

No. Antibody against Immunogen Manufacturer; host; catalog number; RRID Dilution
1 Guanine nucleotide‐binding protein G(t), subunit α3 (GNAT3) Synthetic peptide (KNQFLDLNLKKEDKE), 304–318 amino acid sequence of human GNAT3 Abcam; goat polyclonal; ab113664; AB_10866449 1:1000
2 Guanine nucleotide‐binding protein G(t), subunit α3 (GNAT3) Peptide fragment containing 93–113 amino acid sequence of rat GNAT3 Santa Cruz Biotechnology; sc‐395; rabbit polyclonal; AB_673678 1:500
3 Ectonucleoside triphosphate diphosphohydrolase 2 (ENTPD2) 26–462 amino acid sequence of CHO‐derived recombinant mouse CD39L1/ENTPD2 R&D Systems; sheep polyclonal; AF5797; AB_10572702 1:200
4 Synaptotagmin‐1 (Syt1) Rat brain synaptic plasma membranes R&D Systems; mouse monoclonal; MAB4364; AB_2199304 1:1000
5 Phospholipase C, β2‐subunit (PLCβ2) Synthetic peptide (QDPLIAKADAQ), 1170–1181 amino acid sequence of human PLCβ2 Santa Cruz Biotechnology; rabbit polyclonal; sc‐206; AB_632197 1:500
6 Inositol 1,4,5‐trisphosphate receptor, type 3 (IP3R3) Synthetic peptide, 22–230 amino acid sequence of human IP3R3 BD Biosciences; mouse monoclonal; 610312; AB_397704 1:100
7 P2X3 purinoceptor (P2X3) Synthetic peptide (VEKQSTDGAYSIGH), 383–397 amino acid sequence of rat P2X3 Neuromics; rabbit polyclonal; RA10109; AB_2157930 1:500
8 Synaptosomal‐associated protein, 25 kDa (SNAP25) Crude human synaptic immunoprecipitated, (characterized by Honer et al., 1993) Bio‐Rad; mouse monoclonal; MCA1308; AB_322417 1:1000
9 P2X2 purinoceptor (P2X2) Synthetic peptide (DSTSTDPKGLAQL), 460–472 amino acid sequence of rat P2X2 Neuromics; guinea pig polyclonal; GP14106; AB_2299063 1:5000
Open in a new tab

The antibody numbers in this table are also used in Table 3.

TABLE 2.

Secondary antibodies used in the present study

Letter Antibody against Host Catalog number RRID Dilution
a Alexa Fluor 488‐labeled anti‐goat IgG Donkey 705‐545‐147 AB_2336933 1:200
b Alexa Flour 488‐labeled anti‐rabbit IgG Donkey 711‐545‐152 AB_2313584 1:200
c Cy3‐labeled anti‐sheep IgG Donkey 713‐165‐147 AB_2315778 1:200
d Cy3‐labeled anti‐rabbit IgG Donkey 711‐165‐152 AB_2307443 1:200
e Cy3‐labeled anti‐mouse IgG Donkey 715‐165‐151 AB_2315777 1:200
f Cy3‐labeled anti‐goat IgG Donkey 705‐165‐147 AB_2307351 1:200
g Cy3‐labeled anti‐guinea pig IgG Donkey 706‐165‐148 AB_2340460 1:200
h Alexa Flour 647‐labeled anti‐mouse IgG Donkey 715‐605‐151 AB_2340863 1:200
i Alexa Flour 647‐labeled anti‐rabbit IgG Donkey 711‐605‐152 AB_2492288 1:200
Open in a new tab

The antibody letters in this table are also used in Table 3.

All antibodies are supplied by Jackson ImmunoResearch.

TABLE 3.

Combinations of antibodies for immunofluorescence

Combination Primary antibody 1 Secondary antibody 1 Primary antibody 2 Secondary antibody 2 Primary antibody 3 Secondary antibody 3
GNAT3 1 a – – – – Figure 1
GNAT3/ENTPD2/Syt1 2 b 3 c 4 h Figure 2
GNAT3/PLCβ2 1 a 5 d – – Figure 3a–c
GNAT3/IP3R3 1 a 6 e – – Figure 3d–f
GNAT3/IP3R3/PLCβ2 1 a 6 e 5 i Figure 3g–i
P2X3/GNAT3/SNAP25 7 b 1 f 8 i Figure 5
P2X3/P2X2 7 b 9 g – – Figure 6
P2X3 7 b – – – – Figure 7
Open in a new tab

Numbers and letters are shown in Tables 1 and 2.

Regarding cryostat sections, rats (n = 18) were transcardially perfused with Ringer's solution (200 ml) under deep anesthesia by an intraperitoneal pentobarbital injection (150 mg/kg). The incisive papillae were dissected out and then fixed in 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) at 4°C for 12–18 h. After washing with phosphate‐buffered saline (PBS; pH 7.4), tissues were soaked in PBS containing 30% sucrose, frozen at −80°C with compound medium (Tissue‐Tek O.C.T. compound; Sakura Finetech), and then sectioned in transverse planes at a thickness of 10 µm. These sections were mounted on glass slides with chrome alum‐gelatin and dried. Sections were incubated with nonimmune donkey serum (1:50 dilution, S30; Millipore) diluted with PBS containing 0.5% Triton X‐100 (PBS‐T, pH 7.4) at room temperature for 30 min. After incubation with normal donkey serum, sections were then incubated with primary antibodies at 4°C for 12 h. To penetrate antibodies, PBS‐T was used as a diluent. An antibody against GNAT3 was used as a marker for type II cells (Boughter et al., 1997), against ENTPD2 as a marker for type I cells (Bartel et al., 2006), and against Syt1 and SNAP25 as markers for type III cells in lingual taste buds (Kohno et al., 2005; Yang et al., 2000). Sections were subsequently incubated with secondary antibodies at room temperature for 2 h after rinsing with PBS. Sections were then incubated with 4′,6‐diamidino‐2‐phenylindole (DAPI) solution (1 µg/ml; Dojindo) for nuclear staining. Finally, sections were coverslipped with an aqueous mounting medium (Fluoromount; Diagnostic Biosystems).

Regarding whole‐mount preparations, rats (n = 12) were anesthetized by pentobarbital and transcardially perfused with Ringer's solution (200 ml) followed by 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4, 200 ml). The incisive papillae were dissected out and further fixed at 4°C for 12–18 h. After washing with PBS, the incisive papillae were cut longitudinally in the middle, and the submucosal tissues were removed using fine scissors under a binocular dissecting microscope to obtain whole‐mount preparations of the incisive papillary mucosa. After incubation with normal donkey serum (1:50 dilution) diluted with PBS‐T at room temperature for 2 h, whole‐mount preparations were incubated with primary antibodies at 4°C for at least 5 days. They were then incubated with secondary antibodies at 4°C for 24 h, followed by incubation with DAPI solution for nuclear staining. Preparations were mounted on glass slides coated with chrome alum‐gelatin and coverslipped with an aqueous mounting medium.

2.3. Observations

Preparations were examined with a confocal scanning laser microscope (A1R HD25; Nikon). Projection images were made from z‐stacks of confocal images (4–55 series at 0.5–5 µm intervals) using computer software (NIS‐Elements; Nikon). Other images were reconstructed in three‐dimensional views by the alpha‐blending method from intact confocal images of the z‐stack series. All digital images were analyzed with the use of Photoshop CC (Adobe Systems) in addition to NIS‐Elements. NIS‐Elements software was also used for the analyses of the distribution and numbers of taste buds and taste cells in the incisive papilla. Values are shown as the mean ± SE.

2.4. Reverse transcriptase‐polymerase chain reaction

Reverse transcriptase‐polymerase chain reaction (RT‐PCR) analysis was performed to confirm the mRNA expression of markers for taste cells in the incisive papilla. Rats (n = 6) were euthanized by inhalation of carbon dioxide gas. Incisive papillae were immediately removed, placed in HEPES‐buffered Ringer's solution (HR) containing 100 U/ml purified collagenase (Elastin Products) and 5 mg/ml dispase (Roche Applied Science), and incubated for 40–60 min at 37°C. HR contained 118 mM NaCl, 4.7 mM KCl, 1.13 mM MgCl2, 1.25 mM CaCl2, 1 mM NaH2PO4, 5.5 mM glucose, 10 mM HEPES, and MEM amino acid solution (GIBCO) and was adjusted to pH 7.4 with NaOH. The epithelial sheet of the incisive papilla was then peeled from subepithelial connective tissue, and the area in which taste buds were distributed was excised and frozen in liquid nitrogen. Total RNA from the taste buds in the incisive papilla was extracted using a magnetic bead method (MagExtractor; TOYOBO). RT‐PCR was performed using a QIAGEN One‐Step RT‐PCR Kit (Qiagen) with gene‐specific primers for ENTPD2, GNAT3, PLCβ2, IP3R3, TRPM5, Syt1, SNAP25, and β‐actin as an internal control. Details of the primers used in this study are shown in Table 4. All primer pairs were designed to anchor in exons that span introns to exclude genomic DNA contamination. Reverse transcription was performed for 30 min at 50°C, and the initial PCR activation was incubated for 15 min at 95°C. Following reverse transcription, PCR amplification was performed 35 times as follows: 30 s at 94°C for denaturation, 30 s at 60°C for annealing, and 1 min at 72°C for an extension. After PCR amplification, a final extension was performed for 10 min at 72°C. PCR end products were visualized on 2% agarose gels using ethidium bromide. The mRNA templates were omitted for negative controls.

TABLE 4.

Primers for reverse transcriptase‐polymerase chain reaction

mRNA Primer sequences Position Exon number Product length (bp)
(accession number)
ENTPD2 5′‐GGGCTCTTCACACACATCCA‐3′ (sense) 139–158 2 393
(NM_172030) 5′‐AGCAGGTAGTTGGCAGTCAC‐3′ (antisense) 512–531 4
GNAT3 5′‐AGAACTGGAGAAGAAGCTTCAGG ‐3′ (sense) 164–186 1 372
(NM_173139) 5′‐TCGAAGCAGGCTTGAATTCCT‐3′ (antisense) 515–535 4
PLCβ2 5′‐CTGTCCTGTTGCCCCCTAAG‐3′ (sense) 115–134 1 203
(NM_053478) 5′‐GGCAAACTTCCCAAAGCGAG‐3′ (antisense) 298–317 3
IP3R3 5′‐CGAGGTGGAAACCTTCGTGA‐3′ (sense) 1974–1993 16 458
(NM_013138) 5′‐CCGCCATGCATAGGAAAAGC‐3′ (antisense) 2412–2431 19
TRPM5 5′‐CACAAGCAGCTGGGTCCTAA‐3′ (sense) 2557–2576 17 240
(NM_001191896) 5′‐AAGAGAGCAGTTCACACGGG‐3′ (antisense) 2777–2796 19
Syt1 5′‐AGCCATAGTTGCGGTCCTTTTA‐3′ (sense) 531–552 5 201
(NM_001033680) 5′‐CCATCAGTCAGTCCGGTTTCA‐3′ (antisense) 711–731 6
SNAP25 5′‐GGGCAATAATCAGGATGGAGTAGT‐3′ (sense) 524–547 6 264
(NM_001270575) 5′‐TCAATTCTGGTTTTGTTGGAGTCAG‐3′ (antisense) 763–787 8
β‐actin 5′‐TACAACCTTCTTGCAGCTCCTC‐3′ (sense) 25–46 1 276
(NM_031144) 5′‐GCCGTGTTCAATGGGGTACT‐3′ (antisense) 281–300 3
Open in a new tab

2.5. Retrograde labeling

Rats (n = 4) were anesthetized by intraperitoneal injection of medetomidine hydrochloride (0.15 mg/kg), midazolam (2 mg/kg), and butorphanol tartrate (2.5 mg/kg) and were placed in a supine position to expose the incisive papilla. A retrograde tracer (0.4 µl of 2.5% FB in 10% dimethyl sulfoxide [FB; Polysciences]) was injected bilaterally into subepithelial tissue through mucosal epithelia of the incisive papilla near the orifice of nasoincisor ducts at three points using a glass micropipette (inner diameter of ~50 µm at the tip) connected to a Hamilton microsyringe (Hamilton Syringe Company). The injection site of FB was selected using the area at which incisive taste buds were observed in Section 2.2. After surviving for 7 days, animals were fixed by transcardial perfusion with 4% paraformaldehyde, as described above, and the GG was bilaterally dissected. Incisive papillae were also collected to confirm dye injection sites. Serial cryostat sections at a thickness of 20 µm were stained by immunofluorescence for P2X3. Epifluorescence microscopy (BX50; Olympus) was used to count FB‐labeled neurons in all sections. Some sections containing FB‐labeled neurons were photographed using a confocal scanning laser microscope.

3. RESULTS

3.1. Morphologic and chemical characteristics of taste buds in the incisive papilla

A lower magnification view of the transverse section of the rat incisive papilla immunolabeled with GNAT3 is shown in Figure 1a. The incisive papilla was a large dome‐shaped structure (1.2–1.4 mm in diameter) and formed the medial wall of the orifices of nasoincisor ducts. The nasoincisor ducts connected the nasal and oral cavities, and the orifices were observed as narrow clefts bilateral to the incisive papilla. GNAT3‐immunoreactive taste buds were observed on both sides of the lateral wall of the incisive papilla, but not in the subsequent ductal epithelium of nasoincisor ducts. The range of the area in which taste buds were distributed was approximately 500 µm from the palatal surface. The taste buds consisted of slender GNAT3‐immunoreactive cell clusters in the stratified squamous epithelium covering incisive papilla (Figure 1b). At a higher magnification, slender GNAT3‐immunoreactive cells were found to be accumulated within taste buds in the epithelial layer (Figure 1c). GNAT3‐immunoreactive cells consisted of a perinuclear region with an oval nucleus and slender apical processes. The apical processes of these cells gathered at one spot and faced the oral cavity. Whole‐mount preparations revealed the elliptical distribution of taste buds containing GNAT3‐immunoreactive cells in the lateral wall of the incisive papilla (Figure 1d). The range of the area in which taste buds were distributed was 400–600 µm in the major axis and 200–300 µm in the minor axis, and the distribution area was 0.16 ± 0.01 mm2 in the incisive papillary mucosa (n = 5 whole‐mount preparations). The numbers of taste buds with GNAT3 immunoreactivity were 56.8 ± 4.5 in the incisive papilla.

FIGURE 1.

FIGURE 1

Open in a new tab

Distribution of taste buds containing GNAT3‐immunoreactive cells in the rat incisive papilla (IP). Confocal projection images are made from 8 images at 2 µm intervals in (a), 24 images at 1 µm intervals in (b), nine images at 1 µm intervals in (c), and five images at 5 µm intervals in (d). (a–c) Cryostat sections of the IP stained by GNAT3. (a) The IP contains GNAT3‐immunoreactive taste buds (arrowheads) in bilateral wall composing the opening of nasoincisor ducts but not in the subsequent ductal epithelium (asterisks). (b) Taste buds containing GNAT3‐immunoreactive cells within the stratified squamous epithelium covering the IP near the opening of the nasoincisor duct (arrow). (c) Higher magnification shows spindle GNAT3‐immunoreactive cells collect together to form a taste bud in the epithelial layer. (d) Whole‐mount preparation of the incisive papillary mucosa reveals the dense distribution of taste buds containing GNAT3‐immunoreactive cells. Nuclei are labeled by 4′,6‐diamidino‐2‐phenylindole (blue)

Triple immunolabeling for GNAT3, ENTPD2, and Syt1 revealed that slender GNAT3‐immunoreactive cells were arranged with ENTPD2‐immunoreactive cells and Syt1‐immunoreactive cells to form taste buds (Figure 2a–f). The ENTPD2 immunoreactivity appeared to be outlined cells, indicating the plasma membrane localization of the enzyme. Syt1‐immunoreactive cells were spindle or pyriform in shape and appeared to be localized in the margin within taste buds. Horizontal sectional views of whole‐mount preparations revealed the filamentous cytoplasmic processes of ENTPD2‐immunoreactive cells in gaps between GNAT3‐immunoreactive cells and Syt1‐immunoreactive cells within taste buds (Figure 2g). Three‐dimensional reconstruction views revealed that ENTPD2‐immunoreactive cells almost completely enveloped GNAT3‐immunoreactive cells and a few Syt1‐immunoreactive cells (Figure 2h,i). The tips of apical processes of individual cells are gathered at one point on the surface of the epithelium. Certain nerve fibers were also immunoreactive for Syt1 around and within taste buds (Figure 2c,e,f,i). The numbers of GNAT3‐, ENTPD2‐, and Syt1‐immunoreactive cells in taste buds were 12.8 ± 0.9, 30.0 ± 1.5, and 2.6 ± 0.2, respectively (34 taste buds). As a result, taste buds in the incisive papilla contained 45.4 ± 2.3 cells. The ratios of GNAT3‐, ENTPD2‐, and Syt1‐immunoreactive cells in taste buds were 28.1%, 66.1%, and 5.8%, respectively.

FIGURE 2.

FIGURE 2

Open in a new tab

Triple immunolabeling for GNAT3 (Alexa488, green), ENTPD2 (Cy3, red), and Syt1 (Alexa647, white). Confocal projection images and three‐dimensional views are made from 12 images and 55 images at 1 µm intervals in (a–f) and (h, i), respectively. (a–f) Taste buds containing GNAT3‐immunoreactive cells, ENTPD2‐immunoreactive cells (asterisks in b, d, f), and a few Syt1‐immunoreactive cells (arrowheads in c, e, f) in a cryostat section. (g) A horizontal section of cell clusters selected from a z‐stack series in a whole‐mount preparation. ENTPD2‐immunoreactive cells fill the gap between GNAT3‐immunoreactive cells and Syt1‐immunoreactive cells with lamellar cytoplasmic processes in taste buds. (h, i) Three‐dimensional reconstruction views of whole‐mount preparations. ENTPD2‐immunoreactive cells wrap around the taste bud composed of GNAT3‐immunoreactive cells and Syt1‐immunoreactive cells (arrowheads in i) in a dome‐like fashion. The taste bud contains 20 GNAT3‐immunoreactive cells, 41 ENTPD2‐immunoreactive cells, and 4 Syt1‐immunoreactive cells, respectively. In (a–c) and (g), nuclei are labeled by 4′,6‐diamidino‐2‐phenylindole (blue)

In sections stained by double immunofluorescence for GNAT3 and PLCβ2 or IP3R3, GNAT3‐immunoreactive cells were also immunoreactive for PLCβ2 and IP3R3 in taste buds of the incisive papilla (Figure 3a–f). Triple immunolabeling confirmed that slender GNAT3‐immunoreactive cells were immunoreactive for both PLCβ2 and IP3R3 (Figure 3g–i).

FIGURE 3.

FIGURE 3

Open in a new tab

Double or triple immunofluorescence for GNAT3 with PLCβ2 and/or IP3R3. Projection images are made from 8, 9, and 12 images at 1 μm intervals in (a–c), (d–f), and (g–i), respectively. (a–c) GNAT3‐immunoreactive cells (Alexa488, green) in the cell cluster are immunoreactive for PLCβ2 (Cy3, red). (d–f) GNAT3‐immunoreactive cells (Alexa488, green) in the cluster are also immunoreactive for IP3R3 (Cy3, red). (g–i) GNAT3‐immunoreactive cells (Alexa488, green) in the cell cluster are immunoreactive for both IP3R3 (Cy3, red) and PLCβ2 (Alexa647, white). Nuclei are labeled by 4′,6‐diamidino‐2‐phenylindole (blue)

3.2. Expression of mRNAs for taste cell markers in taste buds of the incisive papilla

Reverse transcriptase‐polymerase chain reaction detected mRNA amplification products for ENTPD2, GNAT3, PLCβ2, IP3R3, TRPM5, Syt1, and SNAP25 in extracts of the area in which taste buds were distributed in the incisive papilla (Figure 4). PCR‐amplified products for β‐actin as an internal control were also detected. No PCR products were detected in samples without mRNA.

FIGURE 4.

FIGURE 4

Open in a new tab

Reverse transcriptase‐polymerase chain reaction (RT‐PCR) analysis of mRNA markers for taste cells in the incisive papilla. PCR‐amplified products for ENTPD2 (marker for type I cells), GNAT3, PLCβ2, IP3R3, TRPM5 (markers for type II cells), Syt1, and SNAP25 (markers for type III cells) are detected in the extracts of the distribution area for incisive taste buds. PCR‐amplified products are not detected in the negative controls. The expected band sizes (bp) of the PCR products are as follows: ENTPD2 (393), β‐actin (276), GNAT3 (372), PLCβ2 (203), IP3R3 (458), TRPM5 (240), Syt1 (201), and SNAP25 (264)

3.3. P2X2‐ and P2X3‐immunoreactive nerve endings in taste buds of the incisive papilla

In sections stained by triple immunolabeling for P2X3, GNAT3, and SNAP25, subepithelial P2X3‐immunoreactive nerve fibers intruded into taste buds and branched and terminated in hederiform nerve endings associated with GNAT3‐immunoreactive chemosensory cells and SNAP25‐immunoreactive cells (Figure 5a–d). Higher magnification views showed that calyx‐like axon terminals containing P2X3‐immunoreactive punctate products surrounded basal perinuclear regions and cytoplasmic processes of some SNAP25‐immunoreactive cells (Figure 5e–h). P2X3‐immunoreactive nerve endings were also immunoreactive for SNAP25 in taste buds of the incisive papilla. In whole‐mount preparations, P2X3‐immunoreactive hederiform nerve endings were attached to perinuclear regions and elongated cytoplasmic processes of GNAT3‐immunoreactive cells and those of SNAP25‐immunoreactive cells (Figure 5i–l).

FIGURE 5.

FIGURE 5

Open in a new tab

Triple immunolabeling for P2X3 (Alexa488, green), GNAT3 (Cy3, red), and SNAP25 (Alexa647, white). Confocal projection images and three‐dimensional views are made from 20 images at 0.5 µm intervals and 54 images at 1 µm intervals in (a–h) and (k, l), respectively. (a–d) P2X3‐immunoreactive hederiform nerve endings are in close contact with GNAT3‐immunoreactive cells and SNAP25‐immunoreactive cells in taste buds. (e–h) High power views of the arrowheads in (a–d) show P2X3‐ and SNAP25‐imunoreactive calyx‐like axon terminals surrounding SNAP25‐immunoreactive cells. (i, j) Taste buds in whole‐mount preparations of the incisive papilla. A horizontal section (i) of taste buds selected from a z‐stack series, and the sectional view (j) at the dotted line indicated in (i). P2X3‐immunoreactive nerve endings are distributed between GNAT3‐immunoreactive cells and SNAP25‐immunoreactive cells. (k, l) Three‐dimensional reconstruction views of whole‐mount preparations. P2X3‐immunoreactive nerve endings are attached to GNAT3‐immunoreactive cells (arrows) and SNAP25‐immunoreactive cells (arrowheads) in taste buds. In (d, h) and (i, j), nuclei are labeled by 4′,6‐diamidino‐2‐phenylindole (blue)

In sections stained by double immunofluorescence for P2X3 and P2X2, weak P2X2 immunoreactivity was observed in P2X3‐immunoreactive nerve endings within taste buds (Figure 6a–c). Punctate P2X2 immunoreactivity was weak or not observed in spherical endings immunoreactive for P2X3.

FIGURE 6.

FIGURE 6

Open in a new tab

Double immunofluorescence for P2X3 and P2X2. Confocal projection images are made from 18 images at 0.5 µm intervals. (a–c) P2X3‐immunoreactive spherical nerve terminals innervating incisive taste buds are also immunoreactive for P2X2 (arrows), whereas some terminals are not (arrowheads). In (c), nuclei are labeled by 4′,6‐diamidino‐2‐phenylindole (blue)

3.4. Retrograde tracer study

After the injection of FB retrograde tracer into incisive papillae with taste buds containing GNAT3‐immunoreactive cells, FB‐labeled neurons were observed in the GG (Figure 7). In sections of the incisive papilla including the FB injected site, most of the injected dye was observed within the epithelial layer, and a small amount had diffused to the submucosa (figure not shown). Most FB‐labeled neurons in the GG were also immunoreactive for P2X3 (Figure 7a–c). FB‐labeled neurons with P2X3 immunoreactivity were small or medium in size (14–39 µm in diameter, Figure 7d–f). Based on experiments on four rats, a total of 17 neurons were labeled with FB in the GG. Of these FB‐labeled neurons, 15/17 (88.2%) were immunoreactive for P2X3.

FIGURE 7.

FIGURE 7

Open in a new tab

Fast blue (FB)‐labeled neurons in the geniculate ganglia (GG) after its injection into the incisive papillary mucosa. (a–c) Most FB‐labeled neurons in the GG are immunoreactive for P2X3 (arrows). VII and GSP indicate the facial nerve and greater superficial petrosal nerve, respectively. (d–f) Higher magnifications show that FB‐labeled neurons in the GG are immunoreactive for P2X3 (arrow), whereas the other neurons are not (arrowhead)

4. DISCUSSION

4.1. Cellular component of incisive taste buds

The present results showed that taste buds containing GNAT3‐immunoreactive cells were distributed in the bilateral walls of the incisive papilla composing the orifice of the nasoincisor ducts and that the distribution was consistent with previous histologic observations in rats (Boughter et al., 1997; El‐Sharaby et al., 2001). GNAT3‐immunoreactive cells were closely arranged in taste buds and projected apical cytoplasmic processes reaching the lumen of the oral cavity. The morphology of these cells appeared to resemble GNAT3‐immunoreactive type II cells in rat lingual taste buds (Boughter et al., 1997; Pumplin & Getschman, 2000). Furthermore, RT‐PCR detected the expression of PLCβ2, IP3R3, and TRPM5 in incisive taste buds, and GNAT3‐immunoreactive cells composing taste buds were immunoreactive for PLCβ2 and IP3R3. Because PLCβ2, IP3R3, and TRPM5 are important taste‐signaling molecules of type II cells in lingual taste buds (Clapp et al., 2001; Qian et al., 2018; Rössler et al., 1998), GNAT3‐immunoreactive cells in incisive taste buds may be gustatory receptor cells activated by chemical stimuli in the oral cavity, similar to type II cells. In addition to GNAT3‐immunoreactive cells, incisive taste buds also contained ENTPD2‐immunoreactive cells and Syt1‐ or SNAP25‐immunoreactive cells, and apical cytoplasmic processes of these cells appeared to gather at one point. In lingual taste buds, ENTPD2 has been identified as an immunohistochemical marker for type I cells (Bartel et al., 2006), whereas Syt1 and SNAP25 have been identified as markers for type III cells (Kohno et al., 2005; Yang et al., 2000). Thus, ENTPD2‐immunoreactive cells and Syt1‐immunoreactive cells observed in incisive taste buds may be identical to type I cells and type III cells in lingual taste buds, respectively. The ratios of GNAT3‐, ENTPD2‐, and Syt1‐immunoreactive cells in incisive taste buds were similar to those of taste cells in lingual taste buds (Roper & Chandhari, 2017; Yang et al., 2020). However, incisive taste buds appeared to be smaller in cell number than lingual taste buds, which contain 50–100 cells (Chaudhari & Roper, 2010; Roper, 2013). We concluded that the morphological and cellular components of incisive taste buds are fundamentally the same as those of lingual taste buds, although it is unknown whether they are involved in the cognition of chemical substances or not.

4.2. P2X3‐immunoreactive afferent nerve endings in incisive taste buds

The present study revealed that incisive taste buds received afferent innervation from P2X3‐immunoreactive hederiform nerve endings. Physiological experiments using ATP‐biosensor cells revealed that type II cells of lingual taste buds released ATP through pannexin‐1 hemichannels after taste stimuli (Huang et al., 2007). The close appositions between GNAT3‐immunoreactive cells and P2X3‐immunoreactive nerve endings suggest that the activation of these cells induces the release of ATP in order to transmit afferent nerve endings. Since P2X3‐immunoreactive nerve endings showed some immunoreactivity for P2X2 alongside P2X3‐immunoreactive puncta, GNAT3‐immunoreactive cells may activate nerve endings via P2X3 homomeric as well as potentially P2X2/P2X3 heteromeric channels. In lingual taste buds, type I cells expressed the plasma membrane‐bound nucleotidase, ENTPD2, that hydrolyzed extracellular ATP to adenosine diphosphate in order to remove the excess transmitter from the extracellular space (Bartel et al., 2006; Vandenbeuch et al., 2013). These findings suggest that ENTPD2‐immunoreactive cells regulate the chemosensory transmission from GNAT3‐immunoreactive cells to P2X3‐immunoreactive nerve endings by degrading extracellular ATP. Furthermore, the close relationship between SNAP25‐immunoreactive cells and the calyx‐like terminals of P2X3‐immunoreactive nerves suggests that ATP also plays a role in sensory transmission between the two. Previous studies have reported that type III cells release serotonin, but not ATP, in lingual taste buds (Huang et al., 2005, 2007), while Kinnamon and Finger (2013) suggested the possibility of corelease of ATP with serotonin and GABA. Further studies on ATP‐mediated transmission between SNAP25‐immunoreactive cells and P2X3‐immunoreactive nerve endings in incisive taste buds are needed. On the other hand, P2X3‐immunoreactive nerve endings with SNAP25 immunoreactivity may have an efferent role in addition to a sensory role. In the mouse circumvallate papilla, immunoreactivity for the vesicular glutamate transporter 1 (VGLUT1) and VGLUT2, vesicle loading proteins for the exocytosis of glutamate, were localized in gustatory nerve fibers innervating taste buds, and glutamate increased intracellular calcium in type III cells but not in type II cells (Vandenbeuch et al., 2010). Although it remains unknown whether VGLUTs are expressed in P2X3‐immunoreactive nerve endings innervating incisive taste buds, the secretions of SNAP25‐immunoreactive cells may be modulated by glutamate released from these nerve endings.

The results of retrograde tracing with FB suggest that P2X3‐immunoreactive nerve endings innervating incisive taste buds are derived from the GG. Previous studies using rats have reported that incisive taste buds are remarkably decreased or abolished after bilateral transection of GSP projecting from the GG (Jiang et al., 2008; St. John et al., 2003). These findings suggest that chemosensory information generated by incisive taste buds is transmitted to the GG via the GSP. On the other hand, FB‐labeled GG neurons without P2X3 immunoreactivity appear to express other chemicals; for example, transient receptor potential ankyrin 1 and vanilloid 1, AMPA receptor subunits GluR2/3, and tyrosine kinase receptors trkB and trkC, as reported by immunohistochemistry in the rat GG (Caicedo et al., 2004; Cho & Farbman, 1999; Katsura et al., 2006).

4.3. Functional considerations

The shape of the incisive papilla containing taste buds on bilateral walls histologically resembled that of the circumvallate papilla of the tongue. The incisive papilla may be the taste papilla of the hard palate, similar to the circumvallate papilla. As the incisive papilla was situated in the most anterior field of the rat palate, incisive taste buds may be suitable for detecting chemical substances in the oral cavity immediately after ingestion. On the other hand, the nasoincisor ducts connected nasal and oral cavities and opened bilateral to the incisive papilla. Chemical substances that stimulate incisive taste buds may be washed away by the mucus that flows from the nasal cavity through the nasoincisor ducts, similar to saliva secreted from von Ebner's glands into the clefts of the circumvallate taste buds. Electrophysiological studies reported that sweet taste stimulation in the rat incisive papilla near the opening of the nasoincisor ducts induced an increase of neuronal responses in the nucleus of the solitary tract (Travers & Norgren, 1991; Travers et al., 1986). Travers et al. (1986) also compared the differences in the neuronal responses to sweet, salty, sour, and bitter: sucrose evoked the greatest neuronal activity followed by NaCl, HCl, and quinine hydrochloride. Because type II cells in lingual taste buds were activated by sweet stimuli such as sucrose (DeFazio et al., 2006), incisive taste buds containing GNAT3‐immunoreactive cells may be activated primarily by sweet stimuli and transmit chemosensory signals to the central nervous system via P2X3‐immunoreactive afferent nerve endings derived from the GG. Further studies on the electrophysiological and pharmacological properties of cellular components and P2X3‐immunoreactive nerve endings are needed in order to clarify the precise functions of taste buds in the rat incisive papilla.

CONFLICT OF INTEREST

The authors declare that they have no conflict of interest.

AUTHOR CONTRIBUTIONS

All authors had full access to all the data in the study and take responsibility for its integrity and the accuracy of the data analysis. Takuya Yokoyama: Study concept and design. Motoi Ito, Takuya Yokoyama, Masato Hirakawa, Yoshio Yamamoto, and Wakana Sakanoue: Acquisition of data. Motoi Ito, Takuya Yokoyama, Masato Hirakawa, Yoshio Yamamoto, Kenichi Sato, and Tomoyuki Saino: Analysis and interpretation of data. Motoi Ito: Drafting of the manuscript. Takuya Yokoyama: Critical revision of the manuscript and approval of the article.

ACKNOWLEDGMENTS

The authors are grateful to Ms. Sawa Takita, a medical student at Iwate Medical University, for her technical support with immunohistochemistry. This work was supported by Grants‐in‐Aid from the Japan Society for the Promotion of Science to Takuya Yokoyama (JP19K16482).

Ito, M. , Yokoyama, T. , Hirakawa, M. , Yamamoto, Y. , Sakanoue, W. , Sato, K. et al. (2022) Morphology and chemical characteristics of taste buds associated with P2X3‐immunoreactive afferent nerve endings in the rat incisive papilla. Journal of Anatomy, 240, 688–699. 10.1111/joa.13583

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Bartel, D.L. , Sullivan, S.L. , Lavoie, E.G. , Sevigny, J. & Finger, T.E. (2006) Nucleoside triphosphate diphosphohydrolase‐2 is the ecto‐ATPase of type I cells in taste buds. The Journal of Comparative Neurology, 497, 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Boughter Jr., J.D. , Pumplin, D.W. , Yu, C. , Christy, R.C. & Smith, D.V. (1997) Differential expression of alpha‐gustducin in taste bud populations of the rat and hamster. The Journal of Neuroscience, 17, 2852–2858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Caicedo, A. , Zucchi, B. , Pereira, E. & Roper, S.D. (2004) Rat gustatory neurons in the geniculate ganglion express glutamate receptor subunits. Chemical Senses, 29, 463–471. [DOI] [PubMed] [Google Scholar]
  4. Chaudhari, N. & Roper, S.D. (2010) The cell biology of taste. The Journal of Cell Biology, 190, 285–296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cho, T.T. & Farbman, A.I. (1999) Neurotrophin receptors in the geniculate ganglion. Brain Research. Molecular Brain Research, 68, 1–13. [DOI] [PubMed] [Google Scholar]
  6. Clapp, T.R. , Stone, L.M. , Margolskee, R.F. & Kinnamon, S.C. (2001) Immunocytochemical evidence for co‐expression of Type III IP3 receptor with signaling components of bitter taste transduction. BMC Neuroscience, 2, 6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. DeFazio, R.A. , Dvoryanchikov, G. , Maruyama, Y. , Kim, J.W. , Pereira, E. , Roper, S.D. et al. (2006) Separate populations of receptor cells and presynaptic cells in mouse taste buds. The Journal of Neuroscience, 26, 3971–3980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. El‐Sharaby, A. , Ueda, K. , Kurisu, K. & Wakisaka, S. (2001) Development and maturation of taste buds of the palatal epithelium of the rat: histological and immunohistochemical study. The Anatomical Record, 263, 260–268. [DOI] [PubMed] [Google Scholar]
  9. Honer, W.G. , Hu, L. & Davies, P. (1993) Human synaptic proteins with a heterogeneous distribution in cerebellum and visual cortex. Brain Research, 609, 9–20. [DOI] [PubMed] [Google Scholar]
  10. Huang, L.‐C. , Greenwood, D. , Thorne, P.R. & Housley, G.D. (2005) Developmental regulation of neuron specific P2X3 receptor expression in the rat cochlea. The Journal of Comparative Neurology, 484, 133–143. [DOI] [PubMed] [Google Scholar]
  11. Huang, Y.J. , Maruyama, Y. , Dvoryanchikov, G. , Pereira, E. , Chaudhari, N. & Roper, S.D. (2007) The role of pannexin 1 hemichannels in ATP release and cell‐cell communication in mouse taste buds. Proceedings of the National Academy of Sciences of the United States of America, 104, 6436–6441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Ishida, Y. , Ugawa, S. , Ueda, T. , Yamada, T. , Shibata, Y. , Hondoh, A. et al. (2009) P2X2‐ and P2X3‐positive fibers in fungiform papillae originate from the chorda tympani but not the trigeminal nerve in rats and mice. The Journal of Comparative Neurology, 514, 131–144. [DOI] [PubMed] [Google Scholar]
  13. Jiang, E. , Blonde, G. , Garcea, M. & Spector, A.C. (2008) Greater superficial petrosal nerve transection in rats does not change unconditioned licking responses to putatively sweet taste stimuli. Chemical Senses, 33, 709–723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kataoka, S. , Toyono, T. , Seta, Y. & Toyoshima, K. (2006) Expression of ATP‐gated P2X3 receptors in rat gustatory papillae and taste buds. Archives of Histology and Cytology, 69, 281–288. [DOI] [PubMed] [Google Scholar]
  15. Katsura, H. , Tsuzuki, K. , Noguchi, K. & Sakagami, M. (2006) Differential expression of capsaicin‐, menthol‐, and mustard oil‐sensitive receptors in naive rat geniculate ganglion neurons. Chemical Senses, 31, 681–688. [DOI] [PubMed] [Google Scholar]
  16. Kinnamon, S.C. & Finger, T.E. (2013) A taste for ATP: neurotransmission in taste buds. Frontiers in Cellular Neuroscience, 7, 264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kohno, R. , Toyono, T. , Seta, Y. , Kataoka, S. , Yamaguchi, K. & Toyoshima, K. (2005) Expression of synaptotagmin 1 in the taste buds of rat gustatory papillae. Archives of Histology and Cytology, 68, 235–241. [DOI] [PubMed] [Google Scholar]
  18. Miller, I.J. Jr & Spangler, K.M. (1982) Taste bud distribution and innervation on the palate of the rat. Chemical Senses, 7, 99–108. [Google Scholar]
  19. Pérez, C.A. , Huang, L. , Rong, M. , Kozak, J.A. , Preuss, A.K. , Zhang, H. et al. (2002) A transient receptor potential channel expressed in taste receptor cells. Nature Neuroscience, 5, 1169–1176. [DOI] [PubMed] [Google Scholar]
  20. Pumplin, D.W. & Getschman, E. (2000) Synaptic proteins in rat taste bud cells: appearance in the Golgi apparatus and relationship to alpha‐gustducin and the Lewisb and A antigens. The Journal of Comparative Neurology, 427, 171–184. [DOI] [PubMed] [Google Scholar]
  21. Qian, J. , Mummalaneni, S. , Grider, J.R. , Damaj, M.I. & Lyall, V. (2018) Nicotinic acetylcholine receptors (nAChRs) are expressed in Trpm5 positive taste receptor cells (TRCs). PLoS One, 13, e0190465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Roper, S.D. (2013) Taste buds as peripheral chemosensory processors. Seminars in Cell & Developmental Biology, 24, 71–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Roper, S.D. & Chaudhari, N. (2017) Taste buds: cells, signals and synapses. Nature Reviews. Neuroscience, 18, 485–497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Rössler, P. , Kroner, C. , Freitag, J. , Noè, J. & Breer, H. (1998) Identification of a phospholipase C β subtype in rat taste cells. European Journal of Cell Biology, 77, 253–261. [DOI] [PubMed] [Google Scholar]
  25. Ruiz‐Avila, L. , McLaughlin, S.K. , Wildman, D. , McKinnon, P.J. , Robichon, A. , Spickofsky, N. et al. (1995) Coupling of bitter receptor to phosphodiesterase through transducin in taste receptor cells. Nature, 376, 80–85. [DOI] [PubMed] [Google Scholar]
  26. St John, S.J. , Garcea, M. & Spector, A.C. (2003) The time course of taste bud regeneration after glossopharyngeal or greater superficial petrosal nerve transection in rats. Chemical Senses, 28, 33–43. [DOI] [PubMed] [Google Scholar]
  27. Travers, S.P. & Norgren, R. (1991) Coding the sweet taste in the nucleus of the solitary tract: differential roles for anterior tongue and nasoincisor duct gustatory receptors in the rat. Journal of Neurophysiology, 65, 1372–1380. [DOI] [PubMed] [Google Scholar]
  28. Travers, S.P. , Pfaffmann, C. & Norgren, R. (1986) Convergence of lingual and palatal gustatory neural activity in the nucleus of the solitary tract. Brain Research, 365, 305–320. [DOI] [PubMed] [Google Scholar]
  29. Vandenbeuch, A. , Anderson, C.B. , Parnes, J. , Enjyoji, K. , Robson, S.C. , Finger, T.E. et al. (2013) Role of the ectonucleotidase NTPDase2 in taste bud function. Proceedings of the National Academy of Sciences of the United States of America, 110, 14789–14794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Vandenbeuch, A. , Tizzano, M. , Anderson, C.B. , Stone, L.M. , Goldberg, D. & Kinnamon, S.C. (2010) Evidence for a role of glutamate as an efferent transmitter in taste buds. BMC Neuroscience, 11, 77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Yang, R. , Crowley, H.H. , Rock, M.E. & Kinnamon, J.C. (2000) Taste cells with synapses in rat circumvallate papillae display SNAP‐25‐like immunoreactivity. The Journal of Comparative Neurology, 424, 205–215. [DOI] [PubMed] [Google Scholar]
  32. Yang, R. , Dzowo, Y.K. , Wilson, C.E. , Russell, R.L. , Kidd, G.J. , Salcedo, E. et al. (2020) Three‐dimensional reconstructions of mouse circumvallate taste buds using serial blockface scanning electron microscopy: I. Cell types and the apical region of the taste bud. The Journal of Comparative Neurology, 528, 756–771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Yang, R. , Montoya, A. , Bond, A. , Walton, J. & Kinnamon, J.C. (2012) Immunocytochemical analysis of P2X2 in rat circumvallate taste buds. BMC Neuroscience, 13, 51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Zhang, Y. , Hoon, M.A. , Chandrashekar, J. , Mueller, K.L. , Cook, B. , Wu, D. et al. (2003) Coding of sweet, bitter, and umami tastes: different receptor cells sharing similar signaling pathways. Cell, 112, 293–301. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Journal of Anatomy are provided here courtesy of Anatomical Society of Great Britain and Ireland

RESOURCES