hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling

Yiting Wan; Jiami Huang; Yanhua Song; Cancan Gu; Jueying Kong; Ling Zuo; Jing Chen

doi:10.1515/med-2022-0448

. 2022 Mar 17;17(1):566–576. doi: 10.1515/med-2022-0448

hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling

Yiting Wan ¹, Jiami Huang ¹, Yanhua Song ¹, Cancan Gu ¹, Jueying Kong ¹, Ling Zuo ¹, Jing Chen ^2,^✉

PMCID: PMC8932397 PMID: 35415247

Abstract

Increasing evidence has verified the indispensable effect of microRNAs (miRNAs) in the biological processes of human diseases, including endometriosis. hsa-miR-340-5p was reported to display a low level in patients with endometriosis, but the detailed function of miR-340-5p in endometriosis is unclarified. RT-qPCR was used for the assessment of RNA levels of miR-340-5p and its downstream target genes in endometrial stromal cells (ESCs). Western blotting and Transwell assays revealed that upregulation of miR-340-5p suppressed the migration, invasiveness, and epithelial–mesenchymal transition (EMT) in ESCs. Bioinformatics tools were used to predict miR-340-5p downstream genes. Luciferase reporter assay displayed that miR-340-5p could bind to messenger RNA mitogen-activated protein kinase kinase kinase 2 (MAP3K2). MAP3K2 was targeted by miR-349-5p and could reverse the influence of miR-340-5p. miR-340-5p exerted its impact on the invasive characters of ESCs by inactivating the MAP3K2-mediated MAPK/ERK signaling. In conclusion, miR-340-5p restrains cell migration, invasiveness, and EMT in ESCs by targeting MAP3K2 and inactivating MAPK/ERK signaling.

Keywords: endometriosis, hsa-miR-340-5p, MAP3K2, epithelial–mesenchymal transition, MAPK/ERK

1. Introduction

Endometriosis is a chronic gynecological disorder characterized by the abnormal location of endometrial tissue outside the uterus [1,2]. Endometriosis affects nearly 10% of women of reproductive age, which may result in infertility, pelvic scarring and pain [3,4]. Pharmacotherapy and surgery, mainly laparoscopy, are the typically adopted therapies for endometriosis [5]. Although endometriosis is a benign disease, patients with endometriosis living with pain or the threat of relapse suffer from the great depression and anxiety [6]. Hence, it is significant to figure out the mechanism underlying the progression of endometriosis.

Epithelial–mesenchymal transition (EMT) is a complicated process in which epithelial cells transdifferentiate into mesenchymal cells with migratory and invasive properties [7,8]. EMT is featured with expression decrease in epithelial markers, such as E-cadherin, and expression enhancement in mesenchymal markers, such as N-cadherin [9]. Many studies have elucidated that EMT is involved in the pathogenesis and development of endometriosis [10,11,12]. Alterations in EMT marker proteins have been examined in endometrial stromal cells (ESCs), leading to increased migration and invasiveness and considered as a prerequisite for endometriotic lesion development [13]. Oestrogen treatment can increase N- cadherin expression and decrease E-cadherin expression in endometriosis [14]. MTA1 facilitates the development of endometriosis by inducing EMT via ZEB2 [15].

MicroRNAs (miRNAs) are a group of endogenous RNAs with 18–25 nucleotides [16,17]. Although miRNAs do not encode proteins, they play a significant role in regulating gene expression at the posttranscriptional level [18,19]. The dysregulation of miRNAs has been indicated to implicate in the biological processes of various human diseases, including endometriosis. For example, hsa-miR-199a-3p suppresses the cell motility, contractility and invasiveness in endometriosis [20]. miR-143-3p represses the cell proliferative and invasive abilities in endometriosis by inactivating autophagy [21]. Importantly, miR-340-5p was reported to display a low level in patients with endometriosis [22]. However, the detailed function of miR-340-5p in EMT of ESCs remains unanswered.

Mitogen-activated protein kinase kinase kinase 2 (MAP3K2) encodes the serine/threonine protein kinase family, which preferentially activates other kinases implicated in the mitogen-activated protein kinase (MAPK, originally called ERK) signaling pathway [23]. The MAPK/ERK signaling activation is recognized to play an essential role in the growth and development of endometriotic cells in ectopic sites [24]. In the processes of migration, implantation and invasiveness into the pelvic structures, the aberrant activation of MAPK/ERK signaling leads to the formation of endometriosis and aggravates the condition of patients with endometriosis [25].

This study intended to figure out the detailed function of miR-340-5p in the EMT process, migration and invasion of ESCs. The findings might provide a new perspective for treating endometriosis.

2. Materials and methods

2.1. Cell culture and transfection

Endometrial stromal cells (ESCs) were purchased from Honsun Biological Technology (Shanghai, China), which were isolated from patients with endometriosis (with no other pathology). ESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM)/Ham’s F12 (Corning Inc., Corning, NY, USA) containing 10% fetal bovine serum (FBS, Corning) and penicillin (100 U/mL, RMBIO, Missoula, MT, USA)/streptomycin (100 µg/mL, RMBIO) at 37°C with 5% CO₂ in a humidified incubator. hsa-miR-340-5p mimics and negative control (NC mimics) were constructed by GenePharma (Shanghai, China) and transfected into ESCs to upregulate miR-340-5p. To overexpress MAP3K2, ESCs were transfected with pcDNA3.1/MAP3K2 or control pcDNA3.1 (GenePharma). Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was utilized for oligonucleotide or plasmid transfection. After 48 h, the transfection efficiency was evaluated by RT-qPCR.

2.2. Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated using TRIzol reagent (Invitrogen) from ESCs and was reverse transcribed into cDNA using a Bestar qPCR Reverse Transcription Kit (DBI^® Bioscience, Shanghai, China). RT-qPCR was implemented using SYBR Green qPCR Master Mix (DBI^® Bioscience) on an ABI7300 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The quantification of miRNA and mRNAs was achieved with the 2^−ΔΔCt method, normalized to U6 and GAPDH, respectively. Primer sequences are provided in Table 1.

Table 1.

Primer sequences used in RT-qPCR

Gene	Sequence (5′ → 3′)
hsa-miR-340-5p forward	CACTCCAGCTGGGTTATAAAGCAATGAGA
hsa-miR-340-5p reverse	TGGTGTCGTGGAGTCG
CYLD forward	CTCTTTACCATTCAGTCTCACC
CYLD reverse	CTCATCTTCCAGTTCCAGTCC
DMD forward	ACAGCTGGCATGGAAGATGAA
DMD reverse	ACGAGTTGATTGTCGGACCC
RPS6KA5 forward	TTGTGCTTGCCCTCGAACAT
RPS6KA5 reverse	CTGTAGGCAGACAAAACTTGCT
NFAT5 forward	TACCTCAGTCACCGACAGCAAG
NFAT5 reverse	CGACTGTTATCCAGCAAGTC
JPH1 forward	AATTAGGAAAGCCCCATCCG
JPH1 reverse	AAGGCAGCTGTTGACTTCCA
IPMK forward	GCACATGTACGGGAAGGACA
IPMK reverse	GGACAAGCTTTTGCCCACTG
SYDE2 forward	ACAGCCAATTCCCATGTCCA
SYDE2 reverse	TGTTGCAGTGTACCAGGACC
ESYT2 forward	CCGGGATCAGCGCGAG
ESYT2 reverse	GTGCTAAGGTGGGTGTTTGC
MAP3K2 forward	GCTTACGGTCTCCTGTGAGTT
MAP3K2 reverse	AGGATTGTCTATGTCACTTCCCC
GAPDH forward	GAGTCAACGGATTTGGTCGT
GAPDH reverse	TTGATTTTGGAGGGATCTCG
U6 forward	CTCGCTTCGGCAGCACA
U6 reverse	AACGCTTCACGAATTTGCGT

Open in a new tab

2.3. Western blotting

Total proteins were isolated from ESCs by RIPA buffer (Beyotime, Shanghai, China) and quantified with a BCA assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Proteins (20 µg) were separated by 10% SDS-PAGE gels and transferred to polyvinylidene difluoride (PVDF) membranes (Roche, Mannheim, Germany). The membranes were blocked with 5% defatted milk and incubated with the primary antibodies as follows: anti-E-cadherin (ab40772, 1:10,000), anti-N-cadherin (ab76011, 1:5,000), anti-GAPDH (ab9485, 1:2,500), anti-MAP3K2 (ab33918, 1:10,000), anti-p-Erk1/2 (ab223500, 1:400), anti-Erk1/2 (ab184699, 1:10,000), anti-p-JNK (ab124956, 1:5,000), anti-JNK (ab199380, 1:2,500), anti-p-p38 (ab178867, 1:1,000), and anti-p38 (ab170099, 1:5,000) (all from Abcam, Cambridge, MA, USA) at 4°C overnight, followed by incubation with the horseradish peroxidase-conjugated secondary antibody of goat anti-rabbit IgG H&L (Abcam, ab175781, 1:10,000) at room temperature for 2 h. The proteins were visualized using an ECL kit (Cwbiotech, Beijing, China) and quantified with the Amersham Imager 600 (GE Healthcare Life Sciences, Little Chalfont, UK).

2.4. Transwell assay

A Transwell chamber (Corning) was used for assessing ESC migration and invasion. After 48 h of incubation, ESCs were washed and incubated with serum-free DMEM for 12 h. Afterward, the suspension (100 µL, 5 × 10⁴ cells) was added into the upper chambers and DMEM (500 µL) containing 10% FBS was placed into the lower chambers. After treatment for 24 h, a cotton swab was utilized to gently remove the nonmigratory cells. The migratory cells were fixed in 4% formaldehyde, stained with 0.1% crystal violet solution and counted under an Eclipse Ti-s microscope (Olympus, Tokyo, Japan). Invasion assay was conducted similar to the above migration assay, except that Matrigel (Corning) was precoated for the chambers.

2.5. Luciferase reporter assay

The putative binding site between miR-340-5p and MAP3K2 was predicted by TargetScan (http://www.targetscan.org/vert_71/). Wild type (Wt) or mutant (Mut) 3′untranslated region (3′UTR) of MAP3K2 was inserted into pmirGLO vectors (Promega, Madison, WI, USA). These vectors were co-transfected with miR-340-5p mimics or NC mimics into ESCs using Lipofectamine 2000 (Invitrogen). Measurement of the luciferase activity was performed with a dual luciferase^® reporter assay system (Promega).

2.6. Statistical analysis

SPSS 20.0 software (IBM Corp, Armonk, NY, USA) was used for data analysis. Specific data are provided in supplementary Table 2. All numerical results are expressed as the mean ± standard deviation. Comparisons between two groups were evaluated by Student’s t-test, and those among more groups were assessed by analysis of variance (ANOVA) followed by Tukey’s post hoc test. Each experiment was performed at least three times. p < 0.05 was considered statistically significant.

Table 2.

Data from SPSS analysis

	Value 1	Value 2	Value 3	Average	SD	p value
Figure 1a
NC mimics	0.91	0.96	1.12	1	0.11	1.28 × 10⁻⁰⁴
miR-340-5p mimics	3.87	4.26	4.61	4.25	0.37	1.28 × 10⁻⁰⁴
Figure 1c
Migration
NC mimics	162.00	178.00	191.00	177	14.45	3.47 × 10⁻⁰⁴
miR-340-5p mimics	59.00	70.00	75.00	68	7.98	3.47 × 10⁻⁰⁴
Invasion
NC mimics	128.00	140.00	158.00	142	15.39	2.73 × 10⁻⁰⁴
miR-340-5p mimics	31.00	36.00	37.00	35	3.22	2.73 × 10⁻⁰⁴
Figure 1d
E-cadherin
NC mimics	0.89	0.97	1.14	1	0.13	0.006
miR-340-5p mimics	1.59	1.75	2.03	1.79	0.22	0.006
N-cadherin
NC mimics	0.90	0.98	1.12	1	0.11	3.24 × 10⁻⁰⁴
miR-340-5p mimics	0.23	0.24	0.27	0.25	0.021	3.24 × 10⁻⁰⁴
Figure 2b
CYLD
NC mimics	0.92	0.96	1.11	1	0.1	0.733
miR-340-5p mimics	0.92	1.04	1.12	1.03	0.1	0.733
DMD
NC mimics	0.90	0.98	1.12	1	0.11	0.819
miR-340-5p mimics	0.92	0.94	1.08	0.98	0.09	0.819
RPS6KA5
NC mimics	0.88	0.98	1.14	1	0.13	0.691
miR-340-5p mimics	0.87	0.95	1.06	0.96	0.098	0.691
NFAT5
NC mimics	0.91	1.01	1.09	1	0.09	0.946
miR-340-5p mimics	0.91	0.96	1.16	1.01	0.13	0.946
JPH1
NC mimics	0.95	1.00	1.05	1	0.05	1
miR-340-5p mimics	0.91	0.97	1.12	1	0.11	1
IPMK
NC mimics	0.93	0.96	1.11	1	0.1	0.903
miR-340-5p mimics	0.91	0.97	1.09	0.99	0.09	0.903
SYDE2
NC mimics	0.92	0.99	1.08	1	0.08	0.606
miR-340-5p mimics	0.92	1.05	1.16	1.04	0.12	0.606
ESYT2
NC mimics	0.94	0.99	1.08	1	0.07	0.824
miR-340-5p mimics	0.94	0.99	1.13	1.02	0.1	0.824
MAP3K2
NC mimics	0.89	0.97	1.14	1	0.13	0.002
miR-340-5p mimics	0.41	0.43	0.49	0.44	0.04	0.002
Figure 2d
NC mimics	0.92	1.00	1.08	1	0.08	0.001
miR-340-5p mimics	0.48	0.54	0.58	0.53	0.05	0.001
Figure 2f
Wt
NC mimics	0.92	0.98	1.10	1	0.09	3.70 × 10⁻⁰⁴
miR-340-5p mimics	0.35	0.38	0.41	0.38	0.032	3.70 × 10⁻⁰⁴
Mut
NC mimics	0.92	0.96	1.12	1	0.11	0.713
miR-340-5p mimics	0.86	0.98	1.06	0.97	0.1	0.713
Figure 3b
Empty	0.93	0.96	1.11	1	0.1	0.001
MAP3K2	2.52	2.94	3.12	2.86	0.31	0.001
Figure 3d
Migration
NC mimics	154.00	158.00	183.00	165	15.47
miR-340-5p mimics	53.00	62.00	65.00	60	5.93	5.79 × 10⁻⁰⁵
miR-340-5p mimics + MAP3K2	105.00	89.00	91.00	95	8.8	0.019
Invasion
NC mimics	114.00	118.00	133.00	122	10.02
miR-340-5p mimics	31.00	34.00	37.00	34	3.44	1.50 × 10⁻⁰⁵
miR-340-5p mimics + MAP3K2	71.00	82.00	84.00	79	7.45	0.001
Figure 3e
E-cadherin
NC mimics	0.88	0.98	1.14	1	0.13
miR-340-5p mimics	2.93	3.11	3.64	3.23	0.37	9.55 × 10⁻⁰⁵
miR-340-5p mimics + MAP3K2	1.69	1.86	2.09	1.88	0.2	0.002
N-cadherin
NC mimics	0.91	0.99	1.11	1	0.1
miR-340-5p mimics	0.17	0.20	0.20	0.19	0.02	1.38 × 10⁻⁰⁵
miR-340-5p mimics + MAP3K2	0.43	0.45	0.53	0.47	0.053	0.005
Figure 4b
p-Erk1/2/Erk1/2
NC mimics	0.93	0.98	1.09	1	0.08
miR-340-5p mimics	0.29	0.31	0.35	0.32	0.031	3.04 × 10⁻⁰⁵
miR-340-5p mimics + MAP3K2	0.52	0.55	0.65	0.57	0.07	0.006
p-JNK/JNK
NC mimics	0.92	0.95	1.13	1	0.11
miR-340-5p mimics	0.42	0.49	0.49	0.47	0.04	0.001
miR-340-5p mimics + MAP3K2	0.87	0.92	1.03	0.94	0.084	0.001
p-p38/p38
NC mimics	0.89	0.98	1.13	1	0.12
miR-340-5p mimics	0.37	0.39	0.44	0.4	0.037	1.89 × 10⁻⁰⁴
miR-340-5p mimics + MAP3K2	0.60	0.61	0.68	0.63	0.045	0.025

Open in a new tab

Ethical approval: Our study did not require an ethical board approval because it did not contain human or animal trials.

3. Results

3.1. miR-340-5p inhibits cell migration, invasiveness and EMT in ESCs

To determine the role of miR-340-5p in endometriosis, we first overexpressed miR-340-5p. As shown by RT-qPCR, the miR-340-5p level was significantly enhanced after transfection with miR-340-5p mimics (Figure 1a). Afterward, we performed Transwell assays, which displayed that overexpressing miR-340-5p restrained the migratory ability of ESCs as well as the invasive ability (Figure 1b and c). Moreover, western blotting suggested that miR-340-5p upregulation increased the protein level of E-cadherin but reduced that of N-cadherin (Figure 1d). This suggested that miR-340-5p restrains EMT process in ESCs.

miR-340-5p restrains cell migration, invasiveness and EMT in endometriosis. (a) RT-qPCR for the transfection efficiency of miR-340-5p mimics in ESCs. (b and c) Transwell assays for evaluating ESC migratory and invasive abilities after overexpressing miR-340-5p. (d) Western blotting for assessing protein levels of EMT-associated markers (E-cadherin and N-cadherin). **p < 0.01, ***p < 0.001.

3.2. miR-340-5p directly targets MAP3K2

To clarify how miR-340-5p exerts its impact on endometriosis progression, we used miRDB (http://mirdb.org/mirdb/index.html) for identifying the downstream targets of miR-340-5p and selected the top nine mRNAs with 100 binding scores (Figure 2a). Subsequently, we implemented RT-qPCR to detect the levels of these mRNAs in ESCs and the results indicated that only MAP3K2 level was markedly decreased by miR-340-5p mimics (Figure 2b). Additionally, the MAP3K2 protein level was reduced by miR-340-5p mimics, as revealed by western blotting (Figure 2c and d). Bioinformatics analysis with TargetScan elucidated the complementary site of miR-340-5p on MAP3K2 3′UTR (Figure 2e). To substantiate the relationship between MAP3K2 and miR-340-5p, the luciferase reporter assay was conducted. miR-340-5p mimics weakened the luciferase activity in the MAP3K2-Wt group, whereas it almost had no impact on the MAP3K2-Mut group (Figure 2f). Collectively, MAP3K2 is targeted by miR-340-5p in ESCs.

miR-340-5p targets MAP3K2. (a) MiRDB was used for screening the downstream targets of miR-340-5p. (b) RT-qPCR of the potential mRNA levels in ESCs transfected with miR-340-5p or NC mimics. (c and d) Western blotting of MAP3K2 protein expression in ESCs with above transfection. (e) Bioinformatics analysis of the potential complementary site of miR-340-5p on MAP3K2. (f) The luciferase reporter assay revealed luciferase activity of Wt/Mut pmirGLO-MAP3K2-3′UTR in ESCs after upregulating miR-340-5p. **p < 0.01, ***p < 0.001.

3.3. Upregulation of MAP3K2 abolishes miR-340-5p upregulation-mediated suppressive impact on the invasive behaviors of ESCs

Subsequently, we explored the detailed effects of MAP3K2 on miR-340-5p in ESCs. As displayed by western blotting, MAP3K2 protein expression was significantly increased after transfection of pcDNA3.1/MAP3K2 in ESCs (Figure 3a and b). Furthermore, Transwell assays demonstrated that overexpressing MAP3K2 abolished the suppressive influence on cell migration and invasiveness caused by miR-340-5p mimics (Figure 3c and d). The levels of EMT-associated markers were examined by western blotting, which suggested that E-cadherin expression enhanced by miR-340-5p mimics was downregulated after upregulating MAP3K2 (Figure 3e). Similarly, MAP3K2 upregulation reversed the level of N-cadherin that was reduced by miR-340-5p upregulation (Figure 3e). In summary, MAP3K2 restoration rescues the miR-340-5p overexpression-induced suppressive impact on the invasive characters of ESCs.

MAP3K2 overexpression abolishes miR-340-5p overexpression-mediated suppressive impact on the invasive behaviors of ESCs. (a and b) Western blotting of MAP3K2 protein level in ESCs after overexpressing MAP3K2. (c and d) Measurement of the migration and invasion by Transwell assays in ESCs transfected with NC mimics, miR-340-5p mimics or miR-340-5p mimics + pcDNA3.1/MAP3K2. (e) Western blotting of E-cadherin and N-cadherin protein levels in ESCs with the above transfection. *p < 0.05, **p < 0.01, ***p < 0.001.

3.4. miR-340-5p regulates the MAPK/ERK signaling pathway by targeting MAP3K2

MAP3K2 is able to activate other kinases involved in the MAPK/ERK signaling pathway [23]. Here, we detected MAPK/ERK signaling pathway-associated proteins in ESCs. As displayed by western blotting, overexpressing miR-340-5p reduced the ratios of p-Erk to total Erk, p-JNK to total JNK and p-p38 to p38, and this effect was then partially reversed by upregulating MAP3K2 (Figure 4a and b). Hence, miR-340-5p influences the progression of endometriosis by regulating MAP3K2-mediated MAPK/ERK signaling.

MiR-340-5p represses endometriosis progression by regulating MAP3K2-mediated MAPK/ERK pathway. (a and b) Western blotting of MAPK/ERK signaling pathway-related protein levels in ESCs. *p < 0.05, **p < 0.01, ***p < 0.001.

4. Discussion

Emerging evidence has indicated that endometriosis is a precancerous lesion, which exhibits cancer-like characterizations such as cell invasiveness and uncontrolled cell proliferation [26]. Patients with endometriosis, particularly ovarian endometriosis, have an increased risk of developing ovarian cancer [27]. Many factors are considered to be implicated in the pathogenesis of endometriosis, including environmental and genetic factors, immune response and hormonal effects [28,29]. Infiltration of immune cells and excessive secretion of proinflammatory cytokines are observed in the peritoneal cavity of women affected by endometriosis [30,31]. Moreover, previous studies have demonstrated that upregulation of genes related to cell adhesion and extracellular matrix precedes the formation of endometriotic lesions [32]. All the above factors are shown to contribute to the invasive behaviors of endometriotic cells including proliferation, invasion, adhesion and survival, which consequently leads to endometriosis [33].

MiRNAs have been increasingly indicated to be a crucial regulator in the development of diverse human diseases [34,35,36,37]. Numerous studies have confirmed that miR-340-5p exerts an indispensable impact on multiple diseases. For example, miR-340-5p upregulation improves spinal cord injury-induced apoptosis and neuroinflammation via regulating the p38/MAPK pathway [38]. miR-340-5p targets PDCD4 to protect from a brain injury after intracerebral hemorrhage [39]. Furthermore, a previous study has elucidated the decreased expression of miR-340-5p in patients with endometriosis [40]. EMT is considered as a key factor in a variety of pathological processes, including tumor metastasis and invasiveness [41]. Numerous studies have verified that EMT is a prerequisite for endometriosis since ectopic lesions in endometriosis display similar biological properties as cancer metastasis [13]. In the process of EMT, cells gain increased migratory and invasive properties, consequently contributing to the development of endometriotic cells in ectopic sites [42]. In the present study, we examined the specific function of miR-340-5p in ESCs. As revealed by the results, overexpressed-miR-340-5p had a suppressive impact on the migration, invasiveness and EMT of ESCs. This indicates that miR-340-5p might protect against the formation of endometriosis, which is in accord with the previous study.

MiRNAs are well-known to exert their regulatory impacts on gene expression by targeting mRNA 3′UTRs, subsequently causing either translational repression or mRNA degradation [43]. With the assistance of bioinformatics tools, MAP3K2 was identified as the target of miR-340-5p. MAP3K2 is implicated in diverse cellular processes, including cell differentiation, migration and proliferation [44]. Notably, in this study, overexpressing MAP3K2 attenuated the suppressive impact on the invasive characters of ESCs caused by miR-340-5p upregulation. Furthermore, MAP3K2 has been verified to participate in various pathways, including the MAPK/ERK signaling pathway [45]. MAP3K2 is able to activate several downstream kinases of the MAPK signaling pathway, including Erk1/2, JNK and p38 [46]. In this study, we analyzed the levels of these kinases in ESCs with indicated treatment. As anticipated, the phosphorylation of Erk, JNK and p38 was markedly reduced by miR-340-5p mimics and this effect was then rescued by overexpressing MAP3K2, revealing that miR-340-5p inactivates MAPK/ERK signaling by targeting MAP3K2 in ESCs.

5. Conclusion

In conclusion, we investigated the function and mechanism of miR-340-5p in ESCs. As indicated by the results, miR-340-5p inhibits the migration, invasiveness and EMT in ESCs, which can be reversed by its downstream target MAP3K2. miR-340-5p inactivates the MAP3K2-mediated MAPK/ERK signaling in ESCs. Our findings might provide a new perspective for the treatment of patients with endometriosis. However, there are still limitations in this study. To better understand the role of miR-340-5p in endometriosis, in vivo experiments are demanded in future studies. Additionally, further investigations are needed to have a better understanding of the pathogenesis of endometriosis.

Acknowledgements

Not applicable.

Footnotes

Funding information: This work were supported by the Shanghai Committee of Science and Technology, China (20Y21901400), the Shanghai Committee of Science and Technology, China (20Z21900400), the Shanghai innovation pilot construction project of TCM diagnosis and treatment model (No. ZY(2018-2020)-FWTX-6006), the Project of Shanghai Health Bureau (No. 201840163), the Shinkang phase II three year action plan major clinical research program (No. SHDC2020CR4056), the Youth Project of Traditional Chinese Medicine Research Project of Shanghai Health (2020LQ001) and the Traditional Chinese Medicine Research Project of Shanghai Health (2020LP001).

Author contributions: Yiting Wan and Jing Chen were the main designers of this study. All authors performed the experiments and analyzed the data. Jing Chen drafted the manuscript. All authors read and approved the final manuscript.

Conflict of interest: The authors have no conflicts of interest to declare.

Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request

References

[1].Ding Y, Zhu Q, He Y, Lu Y, Wang Y, Qi J, et al. Induction of autophagy by Beclin-1 in granulosa cells contributes to follicular progesterone elevation in ovarian endometriosis. Transl Res: J Lab Clin Med. 2021;227:15–29. [DOI] [PubMed]
[2].Wang Y, Nicholes K, Shih IJ. The origin and pathogenesis of endometriosis. Annu Rev Pathol. 2020;15:71–95. [DOI] [PMC free article] [PubMed]
[3].Méar L, Herr M, Fauconnier A, Pineau C, Vialard FJ. Polymorphisms and endometriosis: a systematic review and meta-analyses. Hum Reprod Update. 2020;26(1):73–102. [DOI] [PubMed]
[4].Vallvé-Juanico J, Houshdaran S, Giudice LJ. The endometrial immune environment of women with endometriosis. Hum Reprod Update. 2019;25(5):564–91. [DOI] [PMC free article] [PubMed]
[5].Greenbaum H, Galper B, Decter D, Eisenberg VJ. Endometriosis and autoimmunity: can autoantibodies be used as a non-invasive early diagnostic tool? Autoimmunity Rev. 2021;20(5):102795. [DOI] [PubMed]
[6].Bulun SE, Yilmaz BD, Sison C, Miyazaki K, Bernardi L, Liu S, et al. Endometriosis. Endocr Rev. 2019;40(4):1048–79. [DOI] [PMC free article] [PubMed]
[7].Bischoff J. Endothelial-to-mesenchymal transition. Circulation Res. 2019;124(8):1163–5. [DOI] [PMC free article] [PubMed]
[8].Chen T, You Y, Jiang H, Wang ZZ. Epithelial-mesenchymal transition (EMT): A biological process in the development, stem cell differentiation, and tumorigenesis. J Cell Physiol. 2017;232(12):3261–72. [DOI] [PMC free article] [PubMed]
[9].Serrano-Gomez SJ, Maziveyi M, Alahari SK. Regulation of epithelial-mesenchymal transition through epigenetic and post-translational modifications. Mol Cancer. 2016;15:18. [DOI] [PMC free article] [PubMed]
[10].Liu Y, Wang X, Wan L, Liu X, Yu H, Zhang D, et al. TIPE2 inhibits the migration and invasion of endometrial cells by targeting β-catenin to reverse epithelial-mesenchymal transition. Hum Reprod (Oxford, Engl). 2020;35(6):1377–90. [DOI] [PubMed]
[11].Wang D, Luo Y, Wang G, Yang Q. CircATRNL1 promotes epithelial-mesenchymal transition in endometriosis by upregulating Yes-associated protein 1 in vitro. Cell Death Dis. 2020;11(7):594. [DOI] [PMC free article] [PubMed]
[12].Xiong Y, Liu Y, Xiong W, Zhang L, Liu H, Du Y, et al. Hypoxia-inducible factor 1α-induced epithelial-mesenchymal transition of endometrial epithelial cells may contribute to the development of endometriosis. Hum Reprod (Oxford, Engl). 2016;31(6):1327–38. [DOI] [PubMed]
[13].Dong L, Zhang L, Liu H, Xie M, Gao J, Zhou X, et al. Circ_0007331 knock-down suppresses the progression of endometriosis via miR-200c-3p/HiF-1α axis. J Cell Mol Med. 2020;24(21):12656–66. [DOI] [PMC free article] [PubMed]
[14].He X, Liu N, Mu T, Lu D, Jia C, Wang S, et al. Oestrogen induces epithelial-mesenchymal transition in endometriosis via circ_0004712/miR-148a-3p sponge function. J Cell Mol Med. 2020;24(17):9658–66. [DOI] [PMC free article] [PubMed]
[15].Kong X, Xu X, Zhou L, Zhu M, Yao S, Ding Y, et al. MTA1, a target of resveratrol, promotes epithelial-mesenchymal transition of endometriosis via ZEB2. Mol Ther Methods Clin Dev. 2020;19:295–306. [DOI] [PMC free article] [PubMed]
[16].Correia de Sousa M, Gjorgjieva M, Dolicka D, Sobolewski C, Foti M. Deciphering miRNAs’ action through miRNA editing. Int J Mol Sci. 2019;20(24):6249. [DOI] [PMC free article] [PubMed]
[17].Tiwari A, Mukherjee B, Dixit M. MicroRNA key to angiogenesis regulation: MiRNA biology and therapy. Curr Cancer Drug Targets. 2018;18(3):266–77. [DOI] [PubMed]
[18].Yang Q, Yang F, Dai W, Meng X, Wei W, Cheng Y, et al. DNA logic circuits for multiple tumor cells identification using intracellular MicroRNA molecular bispecific recognition. Adv Healthc Mater. 2021;10:e2101130. [DOI] [PubMed]
[19].Li W, Guan X, Sun B, Sun LJ. A novel microRNA of japanese flounder regulates antimicrobial immunity involving a bacteria-binding CSF3. Front Immunol. 2021;12:723401. [DOI] [PMC free article] [PubMed]
[20].Zhu R, Nasu K, Hijiya N, Yoshihashi M, Hirakawa T, Aoyagi Y, et al. hsa-miR-199a-3p inhibits motility, invasiveness, and contractility of ovarian endometriotic stromal cells. Reprod Sci (Thousand Oaks, Calif). 2021;28:3498–507. [DOI] [PubMed]
[21].Yang H, Hu T, Hu P, Qi C, Qian L. miR-143-3p inhibits endometriotic stromal cell proliferation and invasion by inactivating autophagy in endometriosis. Mol Med Rep. 2021;23(5):356. [DOI] [PMC free article] [PubMed]
[22].Papari E, Noruzinia M, Kashani L, Foster WG. Identification of candidate microRNA markers of endometriosis with the use of next-generation sequencing and quantitative real-time polymerase chain reaction. Fertil Steril. 2020;113(6):1232–41. [DOI] [PubMed]
[23].Wu N, Sun H, Zhao X, Zhang Y, Tan J, Qi Y, et al. MAP3K2-regulated intestinal stromal cells define a distinct stem cell niche. Nature. 2021;592(7855):606–10. [DOI] [PubMed]
[24].Hung S, Zhang R, Tan Z, Chung J, Zhang T, Wang C. Pharmaceuticals targeting signaling pathways of endometriosis as potential new medical treatment: a review. Med Res Rev. 2021;41(4):2489–564. [DOI] [PMC free article] [PubMed]
[25].Bora G, Yaba A. The role of mitogen-activated protein kinase signaling pathway in endometriosis. The journal of obstetrics and gynaecology research. J Obstet Gynaecol Res. 2021;47(5):1610–23. [DOI] [PubMed]
[26].Filipchiuk C, Laganà AS, Beteli R, Ponce TG, Christofolini DM, Martins Trevisan C, et al. BIRC5/survivin expression as a non-invasive biomarker of endometriosis. Diagnostics (Basel, Switz). 2020;10(8):533. [DOI] [PMC free article] [PubMed]
[27].Králíčková M, Laganà AS, Ghezzi F, Vetvicka V. Endometriosis and risk of ovarian cancer: what do we know? Arch Gynecol Obstet. 2020;301(1):1–10. [DOI] [PubMed]
[28].Engels S, Nisolle M, Karampelas S. Pseudotumoral endometriotic nodule. J Minim Invasive Gynecol. 2021;28(12):1973–4. [DOI] [PubMed]
[29].Laganà AS, Salmeri FM, Vitale SG, Triolo O, Götte M. Stem cell trafficking during endometriosis: may epigenetics play a pivotal role? Reprod Sci (Thousand Oaks, Calif). 2018;25(7):978–9. [DOI] [PubMed]
[30].Laganà AS, Salmeri FM, Ban Frangež H, Ghezzi F, Vrtačnik-Bokal E, Granese R. Evaluation of M1 and M2 macrophages in ovarian endometriomas from women affected by endometriosis at different stages of the disease. Gynecol Endocrinol: Off J Int Soc Gynecol Endocrinol. 2020;36(5):441–4. [DOI] [PubMed]
[31].Laganà AS, Triolo O, Salmeri FM, Granese R, Palmara VI, Ban Frangež H, et al. Natural Killer T cell subsets in eutopic and ectopic endometrium: a fresh look to a busy corner. Arch Gynecol Obstet. 2016;293(5):941–9. [DOI] [PubMed]
[32].Umezawa M, Saito Y, Tanaka-Hattori N, Takeda K, Ihara T, Sugamata M. Expression profile of extracellular matrix and adhesion molecules in the development of endometriosis in a mouse model. Reprod Sci (Thousand Oaks, Calif). 2012;19(12):1365–72. [DOI] [PubMed]
[33].Luddi A, Marrocco C, Governini L, Semplici B, Pavone V, Luisi S, et al. Expression of matrix metalloproteinases and their inhibitors in endometrium: high levels in endometriotic lesions. Int J Mol Sci. 2020;21(8):2840. [DOI] [PMC free article] [PubMed]
[34].Ferrante M, Conti GO. Environment and neurodegenerative diseases: an update on miRNA role. MicroRNA (Shariqah, U Arab Emirates). 2017;6(3):157–65. [DOI] [PubMed]
[35].Rupaimoole R, Slack FJ. MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat Rev Drug Discovery. 2017;16(3):203–22. [DOI] [PubMed]
[36].Vanhie A, Peterse O D, Peterse D, Beckers AA, Cuéllar A, Fassbender A, et al. Plasma miRNAs as biomarkers for endometriosis. Hum Reprod (Oxford, Engl). 2019;34(9):1650–60. [DOI] [PMC free article] [PubMed]
[37].Vishnoi A, Rani S. MiRNA biogenesis and regulation of diseases: an overview. Methods Mol Biol (Clifton, NJ). 2017;1509:1–10. [DOI] [PubMed]
[38].Qian Z, Chang J, Jiang F, Ge D, Yang L, Li Y, et al. Excess administration of miR-340-5p ameliorates spinal cord injury-induced neuroinflammation and apoptosis by modulating the P38-MAPK signaling pathway. Brain, Behavior, Immun. 2020;87:531–42. [DOI] [PubMed]
[39].Zhou W, Huang G, Ye J, Jiang J, Xu QJ. Protective effect of miR-340-5p against Brain injury after intracerebral hemorrhage by targeting PDCD4. Cerebrovasc Dis (Basel, Switz). 2020;49(6):593–600. [DOI] [PubMed]
[40].Papari E, Noruzinia M, Kashani L, Foster WJF. Sterility. Identification of candidate microRNA markers of endometriosis with the use of next-generation sequencing and quantitative real-time polymerase chain reaction. Fertil Steril. 2020;113(6):1232–41. [DOI] [PubMed]
[41].Wang C, Zhang J, Fok KL, Tsang LL, Ye M, Liu J, et al. CD147 induces epithelial-to-mesenchymal transition by disassembling cellular apoptosis susceptibility protein/E-cadherin/β-catenin complex in human endometriosis. Am J Pathol. 2018;188(7):1597–607. [DOI] [PubMed]
[42].Chatterjee K, Jana S, DasMahapatra P, Swarnakar S. EGFR-mediated matrix metalloproteinase-7 up-regulation promotes epithelial-mesenchymal transition via ERK1-AP1 axis during ovarian endometriosis progression. FASEB J. 2018;32(8):4560–72. [DOI] [PubMed]
[43].Rekker K, Tasa T, Saare M, Samuel K, Kadastik Ü, Karro H, et al. Differentially-expressed miRNAs in ectopic stromal cells contribute to endometriosis development: the plausible role of miR-139-5p and miR-375. Int J Mol Sci. 2018;19(12):3789. [DOI] [PMC free article] [PubMed]
[44].Yu J, Tan Q, Deng B, Fang C, Qi D, Wang R. The microRNA-520a-3p inhibits proliferation, apoptosis and metastasis by targeting MAP3K2 in non-small cell lung cancer. Am J Cancer Res. 2015;5(2):802–11. [PMC free article] [PubMed]
[45].Chen X, Gao J, Yu Y, Zhao Z, Pan Y. LncRNA FOXD3-AS1 promotes proliferation, invasion and migration of cutaneous malignant melanoma via regulating miR-325/MAP3K2. Biomed Pharmacotherapy = Biomed Pharmacotherapie. 2019;120:109438. [DOI] [PubMed]
[46].Zhang X, Song H, Qiao S, Liu J, Xing T, Yan X, et al. MiR-17-5p and miR-20a promote chicken cell proliferation at least in part by upregulation of c-Myc via MAP3K2 targeting. Sci Rep. 2017;7(1):15852. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_001] [1].Ding Y, Zhu Q, He Y, Lu Y, Wang Y, Qi J, et al. Induction of autophagy by Beclin-1 in granulosa cells contributes to follicular progesterone elevation in ovarian endometriosis. Transl Res: J Lab Clin Med. 2021;227:15–29. [DOI] [PubMed]

[j_med-2022-0448_ref_002] [2].Wang Y, Nicholes K, Shih IJ. The origin and pathogenesis of endometriosis. Annu Rev Pathol. 2020;15:71–95. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_003] [3].Méar L, Herr M, Fauconnier A, Pineau C, Vialard FJ. Polymorphisms and endometriosis: a systematic review and meta-analyses. Hum Reprod Update. 2020;26(1):73–102. [DOI] [PubMed]

[j_med-2022-0448_ref_004] [4].Vallvé-Juanico J, Houshdaran S, Giudice LJ. The endometrial immune environment of women with endometriosis. Hum Reprod Update. 2019;25(5):564–91. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_005] [5].Greenbaum H, Galper B, Decter D, Eisenberg VJ. Endometriosis and autoimmunity: can autoantibodies be used as a non-invasive early diagnostic tool? Autoimmunity Rev. 2021;20(5):102795. [DOI] [PubMed]

[j_med-2022-0448_ref_006] [6].Bulun SE, Yilmaz BD, Sison C, Miyazaki K, Bernardi L, Liu S, et al. Endometriosis. Endocr Rev. 2019;40(4):1048–79. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_007] [7].Bischoff J. Endothelial-to-mesenchymal transition. Circulation Res. 2019;124(8):1163–5. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_008] [8].Chen T, You Y, Jiang H, Wang ZZ. Epithelial-mesenchymal transition (EMT): A biological process in the development, stem cell differentiation, and tumorigenesis. J Cell Physiol. 2017;232(12):3261–72. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_009] [9].Serrano-Gomez SJ, Maziveyi M, Alahari SK. Regulation of epithelial-mesenchymal transition through epigenetic and post-translational modifications. Mol Cancer. 2016;15:18. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_010] [10].Liu Y, Wang X, Wan L, Liu X, Yu H, Zhang D, et al. TIPE2 inhibits the migration and invasion of endometrial cells by targeting β-catenin to reverse epithelial-mesenchymal transition. Hum Reprod (Oxford, Engl). 2020;35(6):1377–90. [DOI] [PubMed]

[j_med-2022-0448_ref_011] [11].Wang D, Luo Y, Wang G, Yang Q. CircATRNL1 promotes epithelial-mesenchymal transition in endometriosis by upregulating Yes-associated protein 1 in vitro. Cell Death Dis. 2020;11(7):594. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_012] [12].Xiong Y, Liu Y, Xiong W, Zhang L, Liu H, Du Y, et al. Hypoxia-inducible factor 1α-induced epithelial-mesenchymal transition of endometrial epithelial cells may contribute to the development of endometriosis. Hum Reprod (Oxford, Engl). 2016;31(6):1327–38. [DOI] [PubMed]

[j_med-2022-0448_ref_013] [13].Dong L, Zhang L, Liu H, Xie M, Gao J, Zhou X, et al. Circ_0007331 knock-down suppresses the progression of endometriosis via miR-200c-3p/HiF-1α axis. J Cell Mol Med. 2020;24(21):12656–66. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_014] [14].He X, Liu N, Mu T, Lu D, Jia C, Wang S, et al. Oestrogen induces epithelial-mesenchymal transition in endometriosis via circ_0004712/miR-148a-3p sponge function. J Cell Mol Med. 2020;24(17):9658–66. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_015] [15].Kong X, Xu X, Zhou L, Zhu M, Yao S, Ding Y, et al. MTA1, a target of resveratrol, promotes epithelial-mesenchymal transition of endometriosis via ZEB2. Mol Ther Methods Clin Dev. 2020;19:295–306. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_016] [16].Correia de Sousa M, Gjorgjieva M, Dolicka D, Sobolewski C, Foti M. Deciphering miRNAs’ action through miRNA editing. Int J Mol Sci. 2019;20(24):6249. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_017] [17].Tiwari A, Mukherjee B, Dixit M. MicroRNA key to angiogenesis regulation: MiRNA biology and therapy. Curr Cancer Drug Targets. 2018;18(3):266–77. [DOI] [PubMed]

[j_med-2022-0448_ref_018] [18].Yang Q, Yang F, Dai W, Meng X, Wei W, Cheng Y, et al. DNA logic circuits for multiple tumor cells identification using intracellular MicroRNA molecular bispecific recognition. Adv Healthc Mater. 2021;10:e2101130. [DOI] [PubMed]

[j_med-2022-0448_ref_019] [19].Li W, Guan X, Sun B, Sun LJ. A novel microRNA of japanese flounder regulates antimicrobial immunity involving a bacteria-binding CSF3. Front Immunol. 2021;12:723401. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_020] [20].Zhu R, Nasu K, Hijiya N, Yoshihashi M, Hirakawa T, Aoyagi Y, et al. hsa-miR-199a-3p inhibits motility, invasiveness, and contractility of ovarian endometriotic stromal cells. Reprod Sci (Thousand Oaks, Calif). 2021;28:3498–507. [DOI] [PubMed]

[j_med-2022-0448_ref_021] [21].Yang H, Hu T, Hu P, Qi C, Qian L. miR-143-3p inhibits endometriotic stromal cell proliferation and invasion by inactivating autophagy in endometriosis. Mol Med Rep. 2021;23(5):356. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_022] [22].Papari E, Noruzinia M, Kashani L, Foster WG. Identification of candidate microRNA markers of endometriosis with the use of next-generation sequencing and quantitative real-time polymerase chain reaction. Fertil Steril. 2020;113(6):1232–41. [DOI] [PubMed]

[j_med-2022-0448_ref_023] [23].Wu N, Sun H, Zhao X, Zhang Y, Tan J, Qi Y, et al. MAP3K2-regulated intestinal stromal cells define a distinct stem cell niche. Nature. 2021;592(7855):606–10. [DOI] [PubMed]

[j_med-2022-0448_ref_024] [24].Hung S, Zhang R, Tan Z, Chung J, Zhang T, Wang C. Pharmaceuticals targeting signaling pathways of endometriosis as potential new medical treatment: a review. Med Res Rev. 2021;41(4):2489–564. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_025] [25].Bora G, Yaba A. The role of mitogen-activated protein kinase signaling pathway in endometriosis. The journal of obstetrics and gynaecology research. J Obstet Gynaecol Res. 2021;47(5):1610–23. [DOI] [PubMed]

[j_med-2022-0448_ref_026] [26].Filipchiuk C, Laganà AS, Beteli R, Ponce TG, Christofolini DM, Martins Trevisan C, et al. BIRC5/survivin expression as a non-invasive biomarker of endometriosis. Diagnostics (Basel, Switz). 2020;10(8):533. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_027] [27].Králíčková M, Laganà AS, Ghezzi F, Vetvicka V. Endometriosis and risk of ovarian cancer: what do we know? Arch Gynecol Obstet. 2020;301(1):1–10. [DOI] [PubMed]

[j_med-2022-0448_ref_028] [28].Engels S, Nisolle M, Karampelas S. Pseudotumoral endometriotic nodule. J Minim Invasive Gynecol. 2021;28(12):1973–4. [DOI] [PubMed]

[j_med-2022-0448_ref_029] [29].Laganà AS, Salmeri FM, Vitale SG, Triolo O, Götte M. Stem cell trafficking during endometriosis: may epigenetics play a pivotal role? Reprod Sci (Thousand Oaks, Calif). 2018;25(7):978–9. [DOI] [PubMed]

[j_med-2022-0448_ref_030] [30].Laganà AS, Salmeri FM, Ban Frangež H, Ghezzi F, Vrtačnik-Bokal E, Granese R. Evaluation of M1 and M2 macrophages in ovarian endometriomas from women affected by endometriosis at different stages of the disease. Gynecol Endocrinol: Off J Int Soc Gynecol Endocrinol. 2020;36(5):441–4. [DOI] [PubMed]

[j_med-2022-0448_ref_031] [31].Laganà AS, Triolo O, Salmeri FM, Granese R, Palmara VI, Ban Frangež H, et al. Natural Killer T cell subsets in eutopic and ectopic endometrium: a fresh look to a busy corner. Arch Gynecol Obstet. 2016;293(5):941–9. [DOI] [PubMed]

[j_med-2022-0448_ref_032] [32].Umezawa M, Saito Y, Tanaka-Hattori N, Takeda K, Ihara T, Sugamata M. Expression profile of extracellular matrix and adhesion molecules in the development of endometriosis in a mouse model. Reprod Sci (Thousand Oaks, Calif). 2012;19(12):1365–72. [DOI] [PubMed]

[j_med-2022-0448_ref_033] [33].Luddi A, Marrocco C, Governini L, Semplici B, Pavone V, Luisi S, et al. Expression of matrix metalloproteinases and their inhibitors in endometrium: high levels in endometriotic lesions. Int J Mol Sci. 2020;21(8):2840. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_034] [34].Ferrante M, Conti GO. Environment and neurodegenerative diseases: an update on miRNA role. MicroRNA (Shariqah, U Arab Emirates). 2017;6(3):157–65. [DOI] [PubMed]

[j_med-2022-0448_ref_035] [35].Rupaimoole R, Slack FJ. MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat Rev Drug Discovery. 2017;16(3):203–22. [DOI] [PubMed]

[j_med-2022-0448_ref_036] [36].Vanhie A, Peterse O D, Peterse D, Beckers AA, Cuéllar A, Fassbender A, et al. Plasma miRNAs as biomarkers for endometriosis. Hum Reprod (Oxford, Engl). 2019;34(9):1650–60. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_037] [37].Vishnoi A, Rani S. MiRNA biogenesis and regulation of diseases: an overview. Methods Mol Biol (Clifton, NJ). 2017;1509:1–10. [DOI] [PubMed]

[j_med-2022-0448_ref_038] [38].Qian Z, Chang J, Jiang F, Ge D, Yang L, Li Y, et al. Excess administration of miR-340-5p ameliorates spinal cord injury-induced neuroinflammation and apoptosis by modulating the P38-MAPK signaling pathway. Brain, Behavior, Immun. 2020;87:531–42. [DOI] [PubMed]

[j_med-2022-0448_ref_039] [39].Zhou W, Huang G, Ye J, Jiang J, Xu QJ. Protective effect of miR-340-5p against Brain injury after intracerebral hemorrhage by targeting PDCD4. Cerebrovasc Dis (Basel, Switz). 2020;49(6):593–600. [DOI] [PubMed]

[j_med-2022-0448_ref_040] [40].Papari E, Noruzinia M, Kashani L, Foster WJF. Sterility. Identification of candidate microRNA markers of endometriosis with the use of next-generation sequencing and quantitative real-time polymerase chain reaction. Fertil Steril. 2020;113(6):1232–41. [DOI] [PubMed]

[j_med-2022-0448_ref_041] [41].Wang C, Zhang J, Fok KL, Tsang LL, Ye M, Liu J, et al. CD147 induces epithelial-to-mesenchymal transition by disassembling cellular apoptosis susceptibility protein/E-cadherin/β-catenin complex in human endometriosis. Am J Pathol. 2018;188(7):1597–607. [DOI] [PubMed]

[j_med-2022-0448_ref_042] [42].Chatterjee K, Jana S, DasMahapatra P, Swarnakar S. EGFR-mediated matrix metalloproteinase-7 up-regulation promotes epithelial-mesenchymal transition via ERK1-AP1 axis during ovarian endometriosis progression. FASEB J. 2018;32(8):4560–72. [DOI] [PubMed]

[j_med-2022-0448_ref_043] [43].Rekker K, Tasa T, Saare M, Samuel K, Kadastik Ü, Karro H, et al. Differentially-expressed miRNAs in ectopic stromal cells contribute to endometriosis development: the plausible role of miR-139-5p and miR-375. Int J Mol Sci. 2018;19(12):3789. [DOI] [PMC free article] [PubMed]

[j_med-2022-0448_ref_044] [44].Yu J, Tan Q, Deng B, Fang C, Qi D, Wang R. The microRNA-520a-3p inhibits proliferation, apoptosis and metastasis by targeting MAP3K2 in non-small cell lung cancer. Am J Cancer Res. 2015;5(2):802–11. [PMC free article] [PubMed]

[j_med-2022-0448_ref_045] [45].Chen X, Gao J, Yu Y, Zhao Z, Pan Y. LncRNA FOXD3-AS1 promotes proliferation, invasion and migration of cutaneous malignant melanoma via regulating miR-325/MAP3K2. Biomed Pharmacotherapy = Biomed Pharmacotherapie. 2019;120:109438. [DOI] [PubMed]

[j_med-2022-0448_ref_046] [46].Zhang X, Song H, Qiao S, Liu J, Xing T, Yan X, et al. MiR-17-5p and miR-20a promote chicken cell proliferation at least in part by upregulation of c-Myc via MAP3K2 targeting. Sci Rep. 2017;7(1):15852. [DOI] [PMC free article] [PubMed]

PERMALINK

hsa-miR-340-5p inhibits epithelial–mesenchymal transition in endometriosis by targeting MAP3K2 and inactivating MAPK/ERK signaling

Yiting Wan

Jiami Huang

Yanhua Song

Cancan Gu

Jueying Kong

Ling Zuo

Jing Chen

Abstract

1. Introduction