A FBXO7/EYA2-SCFFBXW7 Axis Promotes AXL-mediated Maintenance of Mesenchymal and Immune Evasion Phenotypes of Cancer Cells

Jia Z Shen; Zhixin Qiu; Qiulian Wu; Guoxin Zhang; Rebecca Harris; Dahui Sun; Juha Rantala; William D Barshop; Linjie Zhao; Deguan Lv; Kwang-Ai Won; James Wohlschlegel; Olle Sangfelt; Heike Laman; Jeremy N Rich; Charles Spruck

doi:10.1016/j.molcel.2022.01.022

This article has been retracted.

Retraction in: Mol Cell. 2024 May 31 See also: PMC Retraction Policy

. Author manuscript; available in PMC: 2023 Mar 17.

Published in final edited form as: Mol Cell. 2022 Feb 18;82(6):1123–1139.e8. doi: 10.1016/j.molcel.2022.01.022

A FBXO7/EYA2-SCF^FBXW7 Axis Promotes AXL-mediated Maintenance of Mesenchymal and Immune Evasion Phenotypes of Cancer Cells

Jia Z Shen ¹, Zhixin Qiu ², Qiulian Wu ², Guoxin Zhang ³, Rebecca Harris ⁴, Dahui Sun ¹, Juha Rantala ⁵, William D Barshop ⁶, Linjie Zhao ², Deguan Lv ², Kwang-Ai Won ⁷, James Wohlschlegel ⁶, Olle Sangfelt ⁸, Heike Laman ⁴, Jeremy N Rich ^2,^3,^9,^*, Charles Spruck ^1,^10,^*

PMCID: PMC8934274 NIHMSID: NIHMS1777914 PMID: 35182481

SUMMARY

A mesenchymal tumor phenotype associates with immunotherapy resistance, although the mechanism is unclear. Here, we identified FBXO7 as a maintenance regulator of mesenchymal and immune evasion phenotypes of cancer cells. FBXO7 bound and stabilized SIX1 co-transcriptional regulator EYA2, stimulating mesenchymal gene expression and suppressing IFNα/β, chemokines CXCL9/10, and antigen presentation machinery, driven by AXL extracellular ligand GAS6. Ubiquitin ligase SCF^FBXW7 antagonized this pathway by promoting EYA2 degradation. Targeting EYA2 Tyr phosphatase activity decreased mesenchymal phenotypes and enhanced cancer cell immunogenicity, resulting in attenuated tumor growth and metastasis, increased infiltration of cytotoxic T and NK cells, and enhanced anti-PD-1 therapy response in mouse tumor models. FBXO7 expression correlated with mesenchymal and immune-suppressive signatures in cancer patients. An FBXO7-immune gene signature predicted immunotherapy responses. Collectively, the FBXO7/EYA2-SCF^FBXW7 axis maintains mesenchymal and immune evasion phenotypes of cancer cells, providing rationale to evaluate FBXO7/EYA2 inhibitors in combination with immune-based therapies to enhance onco-immunotherapy responses.

eTOC Blurb:

In this article, Shen et al. identify a novel regulatory pathway, FBXO7/EYA2-SCF^FBXW7, that maintains mesenchymal and immune evasion phenotypes of cancer cells by stimulating GAS6-AXL signaling. Targeting FBXO7/EYA2 decreased mesenchymal phenotypes and cancer stem cells and enhanced immunogenicity, leading to stand-alone antitumor activity and augmented immunotherapy response.

INTRODUCTION

Immune checkpoint blockade (ICB) therapy activates anergic tumor-specific T cells within the tumor and periphery, reversing an immune suppressive tumor microenvironment by stimulating antitumor immune responses (Wei et al., 2018). ICB therapy has demonstrated durable responses in several major cancer types (Sharma et al., 2017; Zou et al., 2016). However, many tumors fail to respond or acquire resistance through tumor cell intrinsic and extrinsic resistance mechanisms.

A mesenchymal tumor phenotype associates with immune evasion and may contribute to immunotherapy resistance (Brooks et al., 2015; Dongre et al., 2017; Hugo et al., 2016; Mak et al., 2016; Soundararajan et al., 2019). In mesenchymal tumors, TGFβ and some mesenchymal-associated transcription factors stimulate expression of suppressive immune checkpoint proteins PD-L1 and PD-1 on tumor and immune cells (Chen et al., 2014; David et al., 2017; Park et al., 2016). TGFβ and IL-8 released from tumor and stromal cells promote recruitment of suppressive regulatory T cells (T_regs) and polymorphonuclear myeloid-derived suppressor cells (MDSCs) that inhibit effector T (T_eff) and natural killer (NK) cells, thus establishing an immunosuppressive microenvironment (Geis-Asteggiante et al., 2018; Hanson et al., 2009; Serafini et al., 2008). Nonetheless, there are currently no effective treatments in clinical practice that target the mesenchymal phenotype to alter tumor response to immunotherapy.

A tumor mesenchymal phenotype can be acquired by epithelial-to-mesenchymal transition (EMT), which is crucial for tumor growth, invasion, and metastasis (Brabletz et al., 2018; Lu and Kang, 2019). EMT can be stimulated in cancer cells by expression of oncogenic drivers or microenvironmental stimuli, such as inflammation, the extracellular matrix (ECM), and hypoxia. EMT can also enhance the cancer stem cell (CSC) population and CSCs exhibit an EMT-like transcriptional program (Lu and Kang, 2019; May et al., 2011).

A crucial EMT regulator is AXL, a member of the TAM (TYRO3/AXL/MERTK) family of receptor tyrosine kinases (Aguilera and Giaccia, 2017; Antony and Huang, 2017; Paolino and Penninger, 2016). Canonical AXL signaling requires binding of secreted autocrine/paracrine growth arrest-specific 6 (GAS6) and phospholipid phosphatidylserine, which stimulate receptor dimerization and auto-/trans-phosphorylation of Tyr residues on its cytoplasmic tail. This event triggers recruitment of SH2 domain-containing effector molecules and adaptor proteins that promote activation of various signaling networks, including RAS/RAF/MEK/ERK, PI3K/AKT-mTOR, NF-kB, and JAK/STAT, among others (Antony and Huang, 2017; Braunger et al., 1997; Fridell et al., 1996; Sasaki et al., 2006). AXL is frequently overexpressed in triple-negative breast cancers (TNBCs) and associates with acquisition of mesenchymal features (D'Alfonso et al., 2014; Wilson et al., 2014), increased metastasis (Gjerdrum et al., 2010; Goyette et al., 2018), immune evasion (Aguilera et al., 2016; Hong et al., 2008; Terry et al., 2019; Tsukita et al., 2019), and poor patient outcome (Jin et al., 2017; Tanaka et al., 2016; Wu et al., 2015). However, genetic amplifications and activating mutations of Axl are rare (< 3%), indicating other factors must contribute to AXL dysregulation in cancer. Upstream regulatory mechanisms of AXL signaling are also largely unexplored.

Based on this background, we undertook a loss-of-function screen to identify factors that maintain mesenchymal phenotypes of cancer cells that could be targeted to overcome resistance and enhance clinical responses to immunotherapy.

RESULTS

FBXO7 maintains cancer cell mesenchymal and immune evasion phenotypes

To identify mesenchymal maintenance regulators in cancer cells, we performed an RNA interference (RNAi) screen for genes whose knockdown (KD) decreased mesenchymal markers and increased epithelial markers in TNBC cell lines that displayed enhanced mesenchymal and CSC characteristics (Figure 1A) (Rantala et al., 2011). The screen focused on ubiquitin ligases since their role in regulating mesenchymal phenotypes was largely unexplored. FBXO7 was identified as a top hit (Figure 1B). FBXO7 is a member of the F-box protein family, the members of which function as substrate recognition factors for the SKP1-Cullin-F-box (SCF) E3 ubiquitin ligase (Nelson et al., 2013). Immunofluorescence (IF) and immunoblotting confirmed FBXO7 KD in mesenchymal cancer cells reduced mesenchymal and increased epithelial markers (Figure 1C–1E). FBXO7 KD induced a flat, cuboidal morphology, consistent with cells undergoing a mesenchymal-to-epithelial (MET) transition (Figures 1F and S1A).

Figure 1. — **(A)** Schematic of mesenchymal maintenance regulator screen.

**(B)** Results of BT-20 cell screen plotted as gene rank for change in E-cadherin vs. KRT14 levels. FBXO7, positive (CDC2), and negative (non-targeting siRNA) controls are highlighted (left panel). Representative IF images of control and FBXO7 KD cells (right panels). Scale bar, 10 μm.

**(C and D)** Representative IF images of E-cadherin (C) and Vimentin (D) in control and FBXO7 KD MDA-MB-231 cells (top panels). DNA stained with DAPI (blue). Scale bar, 10 μm. Relative intensities (bottom panels).

**(E)** Immunoblots of indicated proteins in control and FBXO7 KD cancer cells. GAPDH, loading control.

**(F)** Representative images of control and FBXO7 KD BT-549 cells (left panels). Scale bar, 10 μm. Immunoblots and cell aspect ratio (right panels). GAPDH, loading control.

**(G)** Volcano plot of differentially expressed genes in control and FBXO7 KD MDA-MB-231 cells. Significantly upregulated (red) and downregulated (blue) genes in FBXO7 KD cells are indicated.

**(H)** Heatmap of mesenchymal and immune response genes from RNA-seq for control and FBXO7 KD MDA-MB-231 cells.

**(I)** RT-qPCR analysis of mesenchymal and immune response genes in control and FBXO7 KD MDA-MB-231 cells (n = 3). FBXO44, control. Inset, immunoblot of FBXO7. GAPDH, loading control.

**(J)** ELISA quantification of IFNβ and CXCL10 secreted from control and FBXO7 KD MDA-MB-231 cells (n = 3).

**(K)** Flow cytometry analysis of HLA-A/B/C surface expression on control and FBXO7 KD MDA-MB-231 cells.

**(L)** Significantly enriched gene sets in GSEA for FBXO7 KD RNA-seq. Gene sets increased (red) and decreased (blue) in FBXO7 KD cells are indicated.

**(M)** GSEA enrichment plots for select gene sets by RNA-seq (FBXO7 KD vs. control KD). NES and p values shown.

Data represent mean ± SEM. ns, not significant; nd, not detected; *p < 0.05, **p < 0.01, ****p < 0.0001 by one-way ANOVA followed by Tukey’s multiple comparisons test (C, D, and F), and two-way ANOVA followed by Dunnett’s multiple comparisons test (I). For C, D, and F, 6 cells from 3 different fields (2 for each) were randomly chosen and quantified (n = 6).

See also Figure S1.

RNA-sequencing (RNA-seq) revealed that FBXO7 KD decreased the expression of EMT-associated genes (e.g., JUN, MYC, ZEB1, TUBA1C, CDK6, AKT3, and GAS6) and increased immune-stimulatory genes (e.g., IFNGR1, CXCL5, and MICA/MICB (MHC class I chains)) (Figures 1G and 1H). Quantitative RT-PCR (RT-qPCR) analysis confirmed FBXO7 KD downregulated various mesenchymal markers, including EMT transcription factors ZEB1, ZEB2, and TWIST, and upregulated immune-stimulatory IFNα and IFNβ, chemokines CXCL9 and CXCL10, and HLA-A and HLA-B (Figure 1I). ELISA and flow cytometry verified increased IFNβ and CXCL10 secretion and enhanced HLA-A/B/C surface expression on FBXO7 KD cells, respectively (Figures 1J and 1K). Gene set enrichment analysis (GSEA) of FBXO7 KD RNA-seq showed pathways associated with cell movement, stem cell maintenance, and cell division were downregulated, while immune-stimulatory pathways, including IFNβ, antigen processing and presentation, cytokine secretion, and acute inflammatory response, were upregulated (Figures 1L, 1M, S1B, and S1C). Collectively, these data identify FBXO7 as a mesenchymal maintenance regulator in cancer cells and demonstrate its targeting induces immune-stimulatory phenotypes that may promote susceptibility to adaptive immunity.

FBXO7 binds and stabilizes SIX1 co-transcriptional regulator EYA2

To gain insight into how FBXO7 maintains mesenchymal phenotypes and immune evasion of cancer cells, we conducted protein mass spectrometry to identify putative interacting proteins (Figure 2A). Eyes Absent Homolog 2 (EYA2), a co-activator of the SIX family of homeobox transcription factors with Tyr phosphatase activity (Blevins et al., 2015; Kingsbury et al., 2019), was one of the most abundant FBXO7-interacting proteins (Figure 2B; Table S1). Immunoprecipitation (IP) and in vitro pull-down assays confirmed that FBXO7 interacted with EYA2, but not directly with co-transcriptional partner SIX1 (Figures 2C and 2D). EYA2’s transactivation domain (AD, aa1–252) but not EYA domain (ED, aa253–538), which interacts with SIX proteins (Patrick et al, 2013), was required for FBXO7 interaction (Figure 2E). FBXO7’s F-box motif was dispensable for EYA2 interaction (Figure 2F). Further, treatment of cells with NEDDylation inhibitor MLN4924 did not disrupt FBXO7-EYA2 binding (Figure S2A), indicating SCF activity was not required.

EYA2 KD induced a flat, cuboidal morphology, decreased mesenchymal gene expression, and induced immune-stimulatory genes (Figures 2G–2I), phenocopying FBXO7 KD. Similar effects were observed for SIX1 KD cells (Figure S2B). Treatment with EYA2 Tyr phosphatase inhibitor, MLS000544460 (hereafter, “EYA2i”) (Krueger et al., 2014), induced similar effects on gene expression and cell morphology (Figure S2C). Expression of WT EYA2, but not Tyr phosphatase mutant EYA2^D274N or SIX binding mutant EYA2^A532R, largely rescued the decreased mesenchymal and increased immune-stimulatory genes in FBXO7 KD cells (Figure S2D).

FBXO7 expression increased EYA2 steady-state levels (Figure 2J). Cell fractionation and IF revealed FBXO7 predominantly localized to the nucleus and FBXO7 expression increased nuclear EYA2 (Figures 2K and 2L). FBXO7 expression stabilized EYA2 in epithelial MCF7 breast cancer cells with cycloheximide (CHX) treatment (Figure 2M). Conversely, FBXO7 KD destabilized EYA2 in mesenchymal MDA-MB-231 breast cancer cells (Figure 2N). FBXO7 KD had no effect on EYA2 transcription (Figure S2E). Together, these data indicate that FBXO7 binds, stabilizes, and promotes nuclear accumulation of EYA2 in cancer cells.

FBXO7 protects EYA2 from SCF^FBXW7-dependent degradation

EYA2 increased with 26S proteasome inhibitor treatment, indicating regulation by ubiquitin-dependent proteolysis (Figure S3A). In vivo ubiquitylation reactions showed EYA2 was efficiently polyubiquitylated in cells, which was attenuated by FBXO7 expression (Figure 3A). Expression of F-box-deleted FBXO7 (ΔF-FBXO7), that did not bind SCF component CUL1 (Figure S3B), increased EYA2 stability and decreased polyubiquitylation (Figures 3A and S3C), suggesting FBXO7 might interfere with EYA2 polyubiquitylation via an SCF-independent mechanism. In support, FBXO7 or ΔF-FBXO7 expression rescued the decreased mesenchymal and increased immune-stimulatory phenotypes in FBXO7 KD cells (Figures S3D and S3E). Additionally, in vitro ubiquitylation reactions failed to show EYA2 was a substrate of SCF^FBXO7 ubiquitylation activity (Figure S3F).

Figure 3. — **(A)** Immunoblot of polyubiquitylated (pUb) Flag-EYA2 in HEK293T cells transfected with the indicated vectors. Input proteins are shown. *, IgG heavy chain.

**(B)** Co-IP of endogenous EYA2 with the indicated F-box proteins. *, IgG heavy chain.

**(C)** Putative EYA2 CPD motif across species and compared with other SCF^FBXW7 substrates. GSK3β phosphorylated residues are highlighted.

**(D)** Immunoblot of pUb Flag-EYA2 in HEK293T cells transfected with the indicated vectors and treated with GSK3βi. Input proteins are shown. *, IgG heavy chain.

**(E)** Co-IP of WT and CPD mutant Flag-EYA2–2A with GST-FBXW7.

**(F and G)** WT and Flag-EYA2–2A stability in MDA-MB-231 cells (F) and endogenous EYA2 in WT and *Fbxw7* KO HCT116 cells (G) (top panels). GAPDH, control. Relative signal intensities (bottom panels) (n = 3).

**(H)** Immunoblot of pUb Flag-EYA2 in WT and *Fbxw7* KO HCT116 cells. Input shown.

**(I)** *In vitro* binding of SCF^FBXW7 with un-phosphorylated (A) or phosphorylated (B) EYA2 CPD peptide.

**(J)** *In vitro* ubiquitylation reactions of SCF^FBXW7 with EYA2 with/without FBXO7. Cyclin E1, positive control.

**(K)** Flag-EYA2 stability in MDA-MB-231 cells treated with vehicle (DMSO) or GSK3βi (top panel). GAPDH, control. Relative signal intensities (bottom panel) (n = 3).

**(L)** Co-IP of Flag-FBXW7 with endogenous EYA2 in MDA-MB-231 cells transfected with the indicated FBXO7 vectors.

**(M)** Immunoblot of pUb Flag-EYA2 in HEK293T cells transfected with the indicated vectors. Input proteins shown.

**(N)** RT-qPCR analysis of indicated genes in WT and *Fbxw7* KO HCT116 cells (n = 3).

**(O)** Model of FBXO7 inhibition of GSK3β-SCF^FBXW7-mediated degradation of EYA2.

Data represent mean ± SEM. ns, not significant; ***p < 0.001; ****p < 0.0001 by two-way ANOVA followed by Sidak’s multiple comparisons test (F), and Sidak’s multiple comparisons test (G, K, and N).

See also Figure S3.

MLN4924 treatment increased EYA2 levels, indicating regulation by a Cullin-RING E3 ubiquitin ligase (Figure S3G). IP showed that EYA2 selectively interacted with FBXW7 in a panel of randomly selected F-box proteins (Figure 3B). Analysis of EYA2 revealed that it harbored a conserved CDC4 phosphodegron (CPD) (Figure 3C), the substrate recognition motif for the SCF^FBXW7 ubiquitin ligase (Davis et al., 2014; Tan et al., 2008). FBXW7 expression enhanced EYA2 K48-linked but not K63-linked polyubiquitylation (Figures 3D and S3H), indicating SCF^FBXW7 regulated EYA2 degradation. IP confirmed EYA2’s CPD was required for FBXW7 binding (Figure 3E). In contrast, FBXO7-EYA2 binding was independent of EYA2’s CPD (Figure S3I). Further, FBXO7 did not bind SCF^FBXW7 substrates MYC, MCL-1, or Cyclin E1 or influence their steady-state levels (Figure S3J and S3K). CHX experiments showed that CPD mutant EYA2 (designated EYA2–2A) was stabilized compared to WT EYA2 (Figure 3F). EYA2–2A also displayed decreased polyubiquitylation in vivo (Figure S3L). In isogenic WT and Fbxw7 knockout (KO) cell lines, the steady-state level and stability of EYA2 increased and polyubiquitylation decreased in the absence of Fbxw7 (Figures 3G, 3H, and S3M).

SCF^FBXW7 substrate recognition is generally triggered by GSK3β-mediated phosphorylation of the substrate CPD (Davis et al., 2014; Tan et al., 2008). Recombinant SCF^FBXW7 bound a synthetic peptide corresponding to phosphorylated EYA2 CPD (Figure 3I). Further, in vitro kinase assays showed GSK3β phosphorylated the EYA2 CPD (Figure S3N). To determine if EYA2 degradation was regulated by GSK3β, we first confirmed endogenous GSK3β interacted with EYA2 in vivo by IP (Figure S3O). Treatment with GSK3β inhibitor (GSK3βi) disrupted FBXW7-EYA2 binding (Figure S3P), but not FBXO7-EYA2 binding (Figure S3Q). GSK3β stimulated SCF^FBXW7-mediated polyubiquitylation of EYA2 in in vitro ubiquitylation reactions (Figure 3J). Consistently, GSK3βi stabilized EYA2 and inhibited its polyubiquitylation in vivo (Figures 3D, 3K, and S3R). Therefore, EYA2 is degraded by SCF^FBXW7 in a GSK3β-dependent manner.

To understand how FBXO7 protects EYA2 from SCF^FBXW7-mediated degradation, we examined if FBXO7 influenced FBXW7’s recognition of EYA2. IP showed FBXO7 or ΔF-FBXO7 expression diminished FBXW7-EYA2 binding (Figure 3L). Conversely, FBXO7 KD enhanced FBXW7-EYA2 binding (Figure S3S). Expression of FBXO7 or ΔF-FBXO7 decreased EYA2 polyubiquitylation by SCF^FBXW7 (Figure 3M). Corroborating these data, Fbxw7 KO cells expressed increased mesenchymal and decreased immune-stimulatory genes compared to WT counterparts (Figure 3N). Further, FBXW7 KD largely rescued the decreased mesenchymal and increased immune-stimulatory genes expressed in FBXO7 KD cells (Figure S3T). Collectively, these data indicate that FBXO7 blocks FBXW7 recognition of EYA2, thus antagonizing GSK3β-SCF^FBXW7-mediated degradation (Figure 3O).

FBXO7 promotes EYA2/SIX1-mediated induction of AXL ligand GAS6

To determine how the FBXO7/EYA2-SCF^FBXW7 axis maintains mesenchymal and immune evasion phenotypes of cancer cells, we compared chromatin IP sequencing (ChIP-seq) profiles of EYA2 binding in control and FBXO7 KD cells (Figures 4A and 4B). FBXO7 KD decreased EYA2 binding at various genomic regions, including promoters, exons, and introns (Figure S4A). Gene ontology (GO) analysis revealed that genes with reduced EYA2 binding upon FBXO7 KD were enriched in cell migration and motility, cytoskeleton organization, and projection assembly and organization, among others (Figure 4C; Table S2), consistent with a proposed role for FBXO7 in maintaining cancer cell mesenchymal signatures. Among the top-ranked genes that bound EYA2 at the promoter, displayed decreased EYA2 binding and expression upon FBXO7 KD, and had defined roles in EMT were ubiquitin-conjugating enzyme UBE2T, histone methyltransferase PRDM2, and AXL autocrine/paracrine GAS6 (Figure 4D). GAS6 was chosen for further analysis because of the link between AXL and mesenchymal phenotypes in TNBC cells (D'Alfonso et al., 2014; Wilson et al., 2014). ChIP confirmed that EYA2 and SIX1 bound the Gas6 promoter and binding was diminished by KD of FBXO7 or co-transcriptional counterpart (Figures 4E and 4F). EYA2–2A also bound the Gas6 promoter (Figure S4B), indicating independence of CPD phosphorylation. Further, FBXO7 bound the Gas6 promoter and FBXO7 or ΔF-FBXO7 expression stimulated EYA2 binding (Figures S4C and S4D). RT-qPCR analysis showed expression of EYA2 + SIX1 or FBXO7 promoted GAS6 expression in epithelial MCF7 cells (Figure 4G). Expression of EYA2–2A + SIX1 or ΔF-FBXO7 also induced GAS6 expression (Figures S4E and S4F). Conversely, KD of FBXO7, EYA2, or SIX1, or EYA2i treatment decreased GAS6 expression in mesenchymal MDA-MB-231 cells (Figures 4H and 4I). Consistently, FBXO7 KD or EYA2i treatment decreased total and secreted GAS6 protein (Figures 4J and 4K). GAS6 expression largely rescued the decreased mesenchymal and increased immune-stimulatory genes in FBXO7 KD cells (Figure 4L).

Figure 4. — **(A)** Heatmaps of EYA2 ChIP-seq signals in control and FBXO7 KD MDA-MB-231 cells. Signals +/− 2 kb of EYA2 peaks.

**(B)** ChIP-seq enrichment profiles of EYA2 peaks in control and FBXO7 KD MDA-MB-231 cells.

**(C)** Pathway enrichment map of significantly enriched gene sets in GSEA differentially bound by EYA2 in FBXO7 KD ChIP-seq.

**(D)** EYA2 binding *Gas6* promoter (highlight) in control and FBXO7 KD MDA-MB-231 cells.

**(E and F)** ChIP analysis of Flag-EYA2 (E) and Flag-SIX1 (F) binding *Gas6* promoter in MDA-MB-231 cells transfected with the indicated siRNAs (n = 3). GAPDH, control. ChIP performed with anti-Flag antibody. IgG, IP control.

**(G to I)** GAS6 expression in MCF7 cells transfected with indicated vectors (G) and MDA-MB-231 cells expressing indicated shRNAs (H) or treated with vehicle or EYA2i (I) (n = 3).

**(J and K)** Immunoblots of AXL signaling proteins in MDA-MB-231 cells transfected with control or FBXO7 siRNA (J) or treated with vehicle or EYA2i (K). GAPDH, loading control.

**(L)** RT-qPCR analysis of indicated genes in control, FBXO7 KD, and FBXO7 KD + GAS6 MDA-MB-231 cells (left panel). Immunoblots of indicated proteins (right panels). GAPDH, loading control.

**(M)** Representative IF images of AXL in control and FBXO7 KD MDA-MB-231 cells (left panels). DNA stained with DAPI (blue). Scale bar, 10 μm. Quantification of AXL (bottom, right panel). Six cells from 3 different fields (2 for each) were randomly chosen and quantified with ImageJ (n = 6). AXL expression (top, right panel) (n = 3).

**(N)** RT-qPCR analysis of indicated genes in control and AXL KD MDA-MB-231 cells (left panel) (n = 3). Immunoblots of indicated proteins (right panel). GAPDH, loading control.

**(O)** RT-qPCR analysis of indicated genes in control, FBXO7 KD, and FBXO7 KD + Flag-SOCS1 MDA-MB-231 cells (left panel) (n = 3). FBXO44, control. Error bars, SEM of n = 3. GAPDH, loading control.

Data represent mean ± SEM. ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001 by one-way ANOVA followed by Dunnett’s multiple comparisons test (G to I), Tukey’s multiple comparisons test (M, bottom, left panel), two-way ANOVA followed by Tukey’s multiple comparisons test (E, F, L, N, and O), and Sidak’s multiple comparisons test (M, top, right panel).

See also Figure S4 and Table S2.

In line with the role of GAS6 as an AXL ligand, FBXO7 KD decreased total AXL and phospho-AXL^Tyr702 and decreased AXL surface expression (Figures 4J and 4M), indicating inhibition of AXL signaling (Linger et al., 2008). FBXO7 KD also decreased phospho-p38^{Thr180/Tyr182}, phospho-AKT^T308, and SOCS1 and SOCS3, downstream effectors of AXL signaling (Figure 4J). EYA2i treatment also suppressed AXL signaling (Figure 4K). GAS6 expression rescued the decreased total and phospho-AXL^Tyr702 in FBXO7 KD cells (Figure 4L). Consistent with a role of SCF^FBXW7 in antagonizing FBXO7 functions, FBXW7 KD rescued the decreased GAS6 and attenuated AXL signaling in FBXO7 KD cells (Figure S4G). RT-qPCR showed that AXL KD phenocopied FBXO7/EYA2 KD in suppressing mesenchymal and promoting immune-stimulatory genes (Figure 4N). Expression of proinflammatory cytokine suppressor and AXL signaling effector SOCS1 partially rescued the increased IFNα/β, CXCL9/10, and HLA-A/B induced by FBXO7 KD (Figure 4O). Further, GAS6 expression rescued the increased HLA-A/B/C surface expression on FBXO7 KD cells (Figure S4H). Collectively, these data indicate that FBXO7 promotes mesenchymal and immune evasion phenotypes in cancer cells, at least in part, by stimulating EYA2/SIX1-GAS6 mediated activation of AXL signaling.

Targeting FBXO7 suppresses mesenchymal phenotypes of cancer cells

FBXO7 KD diminished mesenchymal cancer cell migration and invasion in in vitro assays (Figures S5A–S5D). These FBXO7 KD effects were largely rescued by GAS6 expression (Figures 5A–5D). FBXO7 KD also decreased the frequency and self-renewal capacity of CSCs in extreme limiting dilution assays (ELDA) (Figure S5E) and reduced tumorsphere formation in vitro (Figure S5F). Again, these phenotypes were largely rescued by GAS6 expression (Figures 5E and 5F). FBXO7 KD or EYA2i treatment sensitized cancer cells to doxorubicin treatment (Figures S5G and S5H), partially rescued by GAS6 expression (Figures 5G and 5H). Consistent with an antagonistic role of SCF^FBXW7, FBXW7 KD partially rescued the reduced migration of FBXO7 KD cells and enhanced EYA2i sensitivity (Figures S5I and S5J). Together, these data show that targeting FBXO7/EYA2 suppressed mesenchymal phenotypes of cancer cells largely dependent on reduced GAS6 expression.

Figure 5. — **(A and B)** Gap closure assay of control, FBXO7 KD, and FBXO7 KD + GAS6 MDA-MB-231 (A) and BT-549 (B) cells (left panels). Quantification of migration (right panels). Five different fields were randomly chosen and quantified (n = 5).

**(C and D)** Migration (C) and invasion (D) of indicated control, FBXO7 KD, and FBXO7 KD + GAS6 cells (left panels). Quantification of data (right panels). Three different fields were randomly chosen and quantified (n = 3).

**(E)** ELDA for indicated control, FBXO7 KD, and FBXO7 KD + GAS6 cells (n = 3).

**(F)** Representative images (left panels) and quantification (right panel) of tumorspheres of indicated control, FBXO7 KD, and FBXO7 KD + GAS6 cells (n = 3). Scale bar, 50 μm.

**(G and H)** Viabilities of indicated control, FBXO7 KD, or FBXO7 KD + GAS6 (G) or vehicle or EYA2i treated (H) cells upon doxorubicin treatment (n = 3).

Data represent mean ± SEM. ***p < 0.001; ****p < 0.0001 by one-way ANOVA followed by Tukey’s multiple comparisons test (A and B), two-way ANOVA followed by Sidak’s multiple comparisons test (C and D), Tukey’s multiple comparisons test (F, G, and H), and χ2 test for pair-wise differences (E).

See also Figure S5.

FBXO7/EYA2 inhibition attenuates tumor growth, boosts antitumor immunity, and enhances ICB therapy response

FBXO7 KD restricted MDA-MB-231 orthotopic breast tumor growth in immunocompromised mice, which was partially rescued by GAS6 expression (Figures 6A and 6B). FBXO7 KD tumors displayed decreased mesenchymal and increased immune-stimulatory gene expression and reduced CSC markers, which were partially rescued by GAS6 expression (Figure 6C). Mice bearing FBXO7 KD breast tumors displayed reduced lung metastases (Figure 6D). FBXO7 KD decreased the metastatic seeding capability of MDA-MB-231-luc cells in immunodeficient mice (Figures S6A and S6B).

Figure 6. — **(A and B)** Growth curves (A, bottom panel) and images (B) of control, FBXO7 KD, and FBXO7 KD + GAS6 MDA-MB-231 breast tumors in immunocompromised mice (n = 5, except n = 4 for shCtrl group). Treatment schema (A, top panel).

**(C)** RT-qPCR analysis of indicated genes in tumors in (B). Whole tumor RNA used for analysis (n = 3).

**(D)** Representative images of lung metastases (arrows, inset) in mice in (A) (left panels). Scale bar, 1 mm; inset scale bar, 100 μm. Quantification of metastases (right panel) (n = 5, except n = 4 for shCtrl group).

**(E and F)** Growth curves (E, bottom panel) and images (F) of control and GAS6-expressing MDA-MB-231-*luc* breast tumors in immunocompromised mice treated with vehicle or EYA2i (n = 5). Treatment schema (E, top panel).

**(G)** Images (left panels) and quantification (right panel) of total radiance in lungs of immunocompromised mice 29 days postintracardiac injection of control or GAS6-expressing MDA-MB-231-*luc* cells treated with vehicle or EYA2i (n = 5).

**(H)** Growth curves of 4T1-*luc* breast tumors in syngeneic immunocompetent mice treated with vehicle or EYA2i and IgG isotype (control) or anti-PD-1 antibody (bottom panel) (n = 5). Treatment schema (top panel).

**(I)** Representative bioluminescence images of mice in (H) at day 32 (left panels). Total body radiance (right panel) (n = 5).

**(J)** Flow cytometry analysis of indicated infiltrating immune cells in 4T1-*luc* breast tumors in (H) at day 32 (n = 4).

**(K)** Representative IHC images (left panels) and quantification (right panel) of CD8⁺ T cells and NK cells in tumors in (H). Scale bar, 100 μm. Six different fields were randomly chosen and quantified (n = 6).

**(L)** Flow cytometry analysis of MHC class I (H-2Kd) surface expression on 4T1-*luc* tumor cells in (H) (n = 4).

**(M)** Survival curves for mice in (H).

Data represent mean ± SEM. ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001 by one-way ANOVA followed by Tukey’s multiple comparisons test (D, G, I, J, and L), two-way ANOVA followed by Tukey’s multiple comparisons test (A, B, C, E, F, H, and K), and log-rank test (M).

See also Figure S6.

To assess if the FBXO7/EYA2-SCF^FBXW7 axis could be pharmacologically targeted for mesenchymal tumor treatment, immunocompromised mice bearing orthotopic MDA-MB-231-luc breast tumors were treated with EYA2i revealing diminished tumor cell autonomous growth and lung metastases, which were partially rescued by GAS6 expression (Figures 6E–6G). These data, and those described above, demonstrate stand-alone antitumor activity of targeting FBXO7/EYA2, consistent with EYA2 Tyr phosphatase activity being crucial for cancer cell migration, invasion, and metastasis (Pandey et al., 2010).

Given that FBXO7/EYA2 inhibition enhanced cancer cell immunogenicity in vitro, we next examined if EYA2i treatment could overcome resistance to ICB therapy. Immunocompetent mice bearing 4T1-luc TNBCs were treated with vehicle or EYA2i and isotype IgG (control) or anti-PD-1 antibody (Figure 6H). 4T1-luc tumors exhibited poor response to anti-PD-1 treatment (Figures 6H and 6I), corroborating a previous report (Bertrand et al., 2017). EYA2i treatment modestly reduced 4T1-luc tumor growth. In contrast, EYA2i + anti-PD-1 antibody promoted a more robust antitumor response. Flow cytometric and immunohistochemical (IHC) analyses showed that EYA2i stimulated the intratumoral infiltration of CD8⁺ T and NK cells, which was further enhanced by anti-PD-1 antibody (Figures 6J, 6K and S6C). EYA2i + anti-PD-1 antibody also increased IFNγ⁺ CD8⁺ T cells, indicating a functional immune response (Figures 6J and S6C). EYA2i treatment increased H-2Kd MHC class I alloantigen surface expression on 4T1-luc tumor cells, which was further enhanced by anti-PD-1 antibody (Figures 6L and S6C). EYA2i + anti-PD-1 treatment increased mouse survival (Figure 6M). Therefore, targeting FBXO7/EYA2 suppresses mesenchymal phenotypes and synergizes with ICB therapy in cancer treatment.

FBXO7 associates with mesenchymal and immune-suppressive phenotypes in cancer patient datasets

To establish clinical relevance of FBXO7, we interrogated public transcriptomic datasets to investigate if FBXO7 associated with mesenchymal phenotypes and immunotherapy responses in cancer patients. FBXO7 was overexpressed across many cancer types compared to normal adjacent tissue (Figure 7A). In breast cancer, increased FBXO7/EYA2 expression associated with basal-like and TNBC tumors (Figures 7B and 7C), which exhibit enhanced EMT and CSC characteristics (Lee et al., 2019). High FBXO7 expression associated with reduced survival of these patients (Figure 7D).

Figure 7. — **(A)** FBXO7 expression in the indicated cancer types relative to normal adjacent tissue (Oncomine, Compendia Bioscience, Ann Arbor, MI). Percentile rank analyzed as percentile of FBXO7 overexpression in top of all overexpressed genes for each study. Fold change (FBXO7 expression in tumor vs. normal tissue) is visualized in proportion to dot size. p value indicated by dot color.

**(B)** Violin plots of FBXO7 and EYA2 expression in breast cancer subtypes (http://bcgenex.ico.unicancer.fr/).

**(C)** Raincloud plots of FBXO7 and EYA2 expression in basal-like breast cancers and TNBCs (http://bcgenex.ico.unicancer.fr/).

**(D)** FBXO7 expression linked to patient survival using Tumor Immune Dysfunction and Exclusion (TIDE) framework in breast cancer dataset.

**(E to G)** Correlation analysis of FBXO7 (E) or FBXW7 expression (F), or *Fbxw7* alterations (G), and activities of canonical pathways from the Molecular Signatures Database in TCGA pan-cancer gene expression dataset. p values from Spearman correlation test corrected for multiple testing as FDR.

**(H and I)** Correlation analysis of FBXO7 (H) or FBXW7 (I) expression and z-scores for TGFβ receptor signaling in EMT in indicated cancer types from TCGA dataset. p values from Spearman correlation test corrected for multiple testing as FDR.

**(J)** FBXO7 expression linked to CTL abundance using TIDE framework in breast cancer dataset.

**(K)** FBXO7-immune gene signature z-scores in responder and non-responder groups of patients treated with anti-PD-1 or TIL therapy in the indicated datasets. p value, unpaired Student’s t-test.

**(L)** Model of FBXO7 maintenance of mesenchymal and immune evasion phenotypes of cancer cells.

See also Figure S7 and Tables S3–S5.

Interrogation of The Cancer Genome Atlas (TCGA) revealed FBXO7 expression correlated with several EMT-related pathways, including TGFβ receptor and MAPK signaling, and inversely correlated with antitumor immune response pathways, including antigen processing, programmed cell death, and type I IFN and inflammatory cytokines (Figure 7E). Consistent with SCF^FBXW7 antagonizing FBXO7 functions, FBXW7 low-expression and Fbxw7 alterations associated with increased EMT-related signaling and decreased immune-stimulatory pathways (Figures 7F and 7G). TGFβ receptor signaling in EMT, a pathway induced by EYA2-SIX1 (Farabaugh et al., 2012; Micalizzi et al., 2009), correlated with FBXO7 expression and inversely with FBXW7 expression in various cancer types (Figures 7H and 7I), further supporting antagonistic functions.

To investigate the clinical relevance of FBXO7/EYA2 targeting for cancer immunotherapy, we analyzed patient data to determine if FBXO7 expression correlated with an immune suppressive tumor microenvironment. FBXO7 expression inversely correlated with gene expression signatures associated with infiltration of cytotoxic T lymphocytes (CTLs) in breast cancer (Figure 7J). To evaluate if FBXO7 expression could predict cancer patients that might respond to immunotherapy, we generated an FBXO7-immune gene signature (See Methods; Figure S7A), and evaluated the predictive value of this signature score across multiple public cancer immunotherapy datasets, including anti-PD-1 and tumor-infiltrating T cell (TIL) therapies. Responders to these immune therapies expressed higher levels of the FBXO7-immune gene signature compared to non-responders across the datasets (Figures 7K, S7B and S7C). These data suggest that targeting FBXO7/EYA2 could have therapeutic potential by reducing mesenchymal and immune evasion phenotypes, thereby attenuating tumor growth and metastasis, and enhancing antitumor immunity and immunotherapy responses (Figure 7L).

DISCUSSION

Mesenchymal tumors associate with immune suppression and resistance to ICB therapy (Horn et al., 2020; Prager et al., 2019). Our data show that targeting FBXO7/EYA2 in cancer cells, such as via EYA2 Tyr phosphatase inhibitor, decreased mesenchymal phenotypes, stimulated immunogenicity, and synergized with anti-PD-1 therapy, providing rationale to evaluate FBXO7/EYA2 inhibitors to augment immunotherapy responses in clinical trials. Consistently, a previous report showed that EYA3 suppresses anti-cancer immune responses and KD increases CD8⁺ T cell infiltration in tumors (Vartuli et al., 2018).

FBXO7 maintains mesenchymal and immune evasion phenotypes of cancer cells, at least in part, by stimulating EYA2-SIX1-mediated expression of GAS6, dependent on EYA2’s Tyr phosphatase activity. FBXO7 binds EYA2’s AD, which also harbors the SCF^FBXW7 CPD recognition motif. EYA2’s CPD is dispensable for FBXO7 binding, suggesting FBXO7 binds elsewhere on the AD and sterically blocks SCF^FBXW7 from recognizing the CPD. Since EYA2 Tyr phosphatase activity and SIX1 binding are mediated through the ED, these functions may not be affected by FBXO7 binding. Of note, FBXO7 bound the Gas6 promoter and a sub-pool of EYA2 bound genes were not regulated in a FBXO7-dependent manner, suggesting FBXO7 could be a component of an active EYA2-SIX1 transcription complex that induces a subset of SIX1 target genes. EYA2 Tyr phosphatase activity is also required for induction of a subset of SIX1 target genes (Li et al., 2003).

SCF^FBXW7 was identified as a negative regulator of mesenchymal maintenance and immune evasion through targeted degradation of EYA2. SCF^FBXW7 is a tumor suppressor previously implicated as a negative regulator of EMT and cancer stemness by promoting the degradation of several EMT regulators, including MYC, mTOR, and NOTCH (Diaz and de Herreros, 2016). Fbxw7 KO cells displayed reduced immunogenicity, suggesting a role for SCF^FBXW7 in promoting antitumor immune responses. Consistently, Fbxw7 mutations associate with resistance to anti-PD-1 therapy in melanoma (Gstalder et al., 2020), and FBXW7 dysfunction promotes PD-L1 expression through upregulation of MYC (Zhou et al., 2019) and destabilizes intracellular viral sensors RIG-I and MDA5, resulting in diminished type I IFN and MHC class I expression (Gstalder et al., 2020; Song et al., 2017).

Our study shows the FBXO7/EYA2-SCF^FBXW7 axis is a crucial upstream regulator of AXL signaling in cancer cells. AXL signaling suppresses pro-inflammatory cytokines, antigen presentation, and TLR inflammatory signaling, upregulates immune checkpoint proteins, and promotes T cell exclusion (Aguilera et al., 2016; Hong et al., 2008; Terry et al., 2019; Tsukita et al., 2019). AXL overexpression associates with resistance to anti-PD-1 therapy in melanoma patients (Hugo et al., 2016). In addition to binding GAS6 secreted from tumor or stromal cells, AXL can also be activated by ligand-independent mechanisms, including AXL homo-aggregation or heterodimerization with other RTKs, including HER2, EGFR, and MET, leading to protracted signaling (Aguilera and Giaccia, 2017; Antony and Huang, 2017; Paolino and Penninger, 2016). Several AXL inhibitors with diverse mechanisms of action are currently being evaluated in clinical trials (Colavito, 2020; Zhu et al., 2019). Given that FBXO7 KD decreased GAS6 expression/secretion and AXL surface expression, targeting FBXO7/EYA2 could represent a therapeutic approach to attenuate AXL signaling and possibly overcome ligand-independent mechanisms of AXL inhibitor resistance in tumors.

Targeting the FBXO7/EYA2-SCF^FBXW7 axis, such as via EYA2 Tyr phosphatase inhibitors, could provide therapeutic benefit by reducing mesenchymal phenotypes and enhancing tumor immunogenicity. As EYA2 acts downstream of SCF^FBXW7, FBXO7/EYA2 inhibitors could be effective in blocking immune escape pathways and immunotherapy resistance in Fbxw7 mutant tumors. Furthermore, FBXO7/EYA2 inhibitors could be effective in mitigating AXL signaling and associated immune evasion, thus enhancing antitumor immune responses.

Limitations of the study

Our study shows that FBXO7/EYA2-SCF^FBXW7 promotes GAS-AXL signaling to maintain mesenchymal and immune evasion phenotypes of cancer cells. However, TNBC cells were primarily used in our analysis and the importance of this pathway in other cancer types is unclear given the transcriptional targets of SIX1-EYA exhibit cancer cell type-specificity (Kingsbury et al., 2019). Additionally, GAS6 expression or FBXW7 KD only partially rescued the decreased mesenchymal and increased immune-stimulatory phenotypes of FBXO7 KD cells, suggesting factors other than GAS6-AXL signaling may be involved. In support, SIX1 negatively regulates inflammatory gene expression independent of AXL (Liu et al., 2019), and SCF^FBXW7 promotes the degradation of other EMT regulators (Diaz and de Herreros, 2016). It is also unclear if FBXO7 or SCF^FBXW7 regulate other EYA proteins (i.e., EYA1, EYA3, EYA4) and what role, if any, these regulations have on mesenchymal and immune evasion phenotypes of cancer cells. Beyond promoting EYA2 stability, it is not understood if FBXO7-EYA2 binding influences EYA2 Tyr phosphatase activity, EYA2-SIX1 interaction, or EYA2-SIX1 recruitment to the Gas6 promoter. Future work will be needed to resolve these important questions.

STAR★METHODS

RESOURCE AVAILABILITY

Lead Contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Charles Spruck (cspruck@sbpdiscovery.org).

Materials Availability

All unique reagents generated by this study are available from the Lead Contact with a completed Materials Transfer Agreement.

Data and Code Availability

RNA-seq and ChIP-seq data have been deposited at GEO and are publicly available as of the date of publication. Accession numbers are listed in the key resources table. Original western blot images have been deposited at Mendeley and are available from lead contact upon request.
This paper does not report original code. Routine bioinformatics approaches used to analyze the data are described in relevant STAR Methods sections.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit anti-human FBXO7	Aviva Systems Biology	Cat# ARP43128_P050; RRID:AB_2045871
Mouse anti-human EYA2	Abnova	Cat# H00002139-M04; RRID:AB_565716
Rabbit anti-human EYA2	Sigma-Aldrich	Cat# HPA027024; RRID:AB_1848334
Rabbit anti-human SIX1	Cell Signaling	Cat# 12891; RRID:AB_2753209
Rabbit anti-human GAS6	Cell Signaling	Cat# 67202; RRID:AB_2799720
Rabbit anti-human Phospho-AXL^Tyr702	Cell Signaling	Cat# 5724; RRID:AB_10544794
Rabbit anti-human AXL	Cell Signaling	Cat# 8661; RRID:AB_11217435
Mouse anti-human GSK3β	Santa Cruz	Cat# sc-377213; RRID:AB_2892800
Mouse anti-human GAPDH	Santa Cruz	Cat# sc-25778; RRID:AB_10167668
Rabbit anti-human Vimentin	Cell Signaling	Cat# 5741; RRID:AB_10695459
Rabbit anti-human E-cadherin	Cell Signaling	Cat# 3195; RRID:AB_2291471
Rabbit anti-human ZEB1	Cell Signaling	Cat# 3396; RRID:AB_1904164
Rabbit anti-human Phospho-AKT^Thr308	Cell Signaling	Cat# 2965; RRID:AB_2255933
Rabbit anti-human P38	Cell Signaling	Cat# 9212; RRID:AB_330713
Rabbit anti-human Phospho-p38^{Thr180/Tyr182}	Cell Signaling	Cat# 9211; RRID:AB_331641
Rabbit anti-human SOCS1	Cell Signaling	Cat# 3950; RRID:AB_2192983
Mouse anti-human SOCS3	Thermo Fisher Scientific	Cat# MA1-19373; RRID:AB_1087394
Rabbit anti-human CUL1	Thermo Fisher Scientific	Cat# 71-8700; RRID:AB_2534002
Mouse anti-human Ub-K63	Thermo Fisher Scientific	Cat# 14-6077-82; RRID:AB_1257213
Rabbit anti-human Ub-K48	Cell Signaling	Cat# 8081; RRID:AB_10859893
Mouse anti-human Phosphoserine	Sigma-Aldrich	Cat# P5747; RRID:AB_477376
Mouse anti-human c-MYC	Santa Cruz	Cat# sc-42; RRID:AB_2282408
Rabbit anti-human MCL-1	Cell Signaling	Cat# 4572; RRID:AB_2281980
Mouse anti-Flag tag	Sigma-Aldrich	Cat# F3165; RRID:AB_259529
Rabbit anti-Flag tag	Sigma-Aldrich	Cat# F7425; RRID:AB_439687
Rabbit anti-Flag tag	Cell Signaling	Cat# 14793; RRID:AB_2572291
Mouse anti-Myc tag	Cell Signaling	Cat# 2276; RRID:AB_331783
Mouse anti-HA tag	BioLegend	Cat# 901513; RRID:AB_2565335
Rabbit anti-HA tag	Thermo Fisher Scientific	Cat# 71-5500; RRID:AB_2533988
Rabbit anti-human KAP1	Cell Signaling	Cat# 4124; RRID:AB_2209886
Mouse anti-human PE-HLA-A, B, C	BioLegend	Cat# 311405; RRID:AB_314874
Mouse anti-mouse PE-IgG2a isotype	BioLegend	Cat# 400212; RRID:AB_326460
Mouse anti-mouse BV605-CD45.2	BioLegend	Cat# 109841; RRID:AB_2563485
Rat anti-mouse PerCP/Cyanine5.5-CD4	BioLegend	Cat# 100539; RRID:AB_893332
Rat anti-mouse FITC-CD8	BioLegend	Cat# 100706; RRID:AB_312745
Rat anti-mouse BV711-CD25	BioLegend	Cat# 102049; RRID:AB_2564130
Hamster anti-mouse APC-CD3ε	BioLegend	Cat# 152306; RRID:AB_2632669
Rat anti-mouse PE-FOXP3	BioLegend	Cat# 126403; RRID:AB_1089118
Rat anti-mouse BV421-CD335	BioLegend	Cat# 137611; RRID:AB_10915472
Rat anti-mouse PE-IFNγ	BioLegend	Cat# 505857; RRID:AB_315401
Mouse anti-mouse FITC-H-2Kd	BioLegend	Cat# 116605; RRID:AB_313740
Rat anti-mouse CD8a	Thermo Fisher Scientific	Cat# 14-0808-82; RRID:AB_2572861
Rat anti-mouse NK Cell Marker (ANK61)	Santa Cruz	Cat# sc-59340; RRID:AB_784846
Normal rabbit IgG	Santa Cruz	Cat# sc-2027; RRID:AB_737197
Normal mouse IgG	Santa Cruz	Cat# sc-2025; RRID:AB_737182
Alexa Fluor 488 anti-rabbit IgG (H+L)	Thermo Fisher Scientific	Cat# A-21441; RRID:AB_2535859
Alexa Fluor 594 anti-mouse IgG (H+L)	Cell Signaling	Cat# 8890; RRID:AB_2714182
Rabbit TrueBlot anti-rabbit IgG HRP	Rockland	Cat# 18-8816-31; RRID:AB_2610847
Mouse TrueBlot ULTRA anti- mouse IgG HRP	Rockland	Cat# 18-8817-31; RRID:AB_2610850
Chemicals, peptides, and recombinant proteins
3x FLAG Peptide	Sigma-Aldrich	Cat# F4799
EYA2 inhibitor MLS000544460	Sigma-Aldrich	Cat# 531085
GSK3β inhibitor XIII	Cayman	Cat# 21190
D-Luciferin	Xenogen	Cat# XR-1001
Human TruStain FcX	BioLegend	Cat# 422301
7-AAD Viability Staining Solution	BioLegend	Cat# 420403
Cell Activation Cocktail with Brefeldin A	BioLegend	Cat# 423303
Cremophor EL	Millipore	Cat# 238470
Protein G agarose	Millipore	Cat# 16-266
Streptavidin beads	Cell Signaling	Cat# 3419
Cell Staining Buffer	BioLegend	Cat# 420201
Intracellular Staining Perm Wash Buffer	BioLegend	Cat# 421002
UBCH5A	R&D Systems	Cat# E2-616-100
UBE2R1/CDC34	R&D Systems	Cat# E2-610
SCF^FBXO7	R&D Systems	Cat# E3-526
SKP1/FBXO7 Complex	R&D Systems	Cat# E3-525
GSK3β	Sigma-Aldrich	Cat# G4296
SCF^FBXW7	Sigma-Aldrich	Cat# 23-030
Biotin-DSLNHSPGQSGFLSY	GenScript	N/A
Biotin-DSLNH(pSer)PGQ(pSer)GFLSY	GenScript	N/A
Critical commercial assays
Zombie UV Fixable Viability Kit	BioLegend	Cat# 423107
Tumor Dissociation Kit	Miltenyi Biotec	Cat# 130-096-730
Western Chemiluminescent HRP Substrate	Millipore	Cat# WBKLS0500
PURExpress® In Vitro Protein Synthesis Kit	New England Biolabs	Cat# E6800S
Ubiquitin Conjugation Initiation Kit	R&D Systems	Cat# K-995
QuantTag Biotin Quantitation Kit	Vector Laboratories	Cat# BDK-2000
Deposited data
RNA-seq, ChIP-seq	This study	GSE155979
RNA-seq	This study	GSE135306
Experimental models: Cell lines
Human: MDA-MB-231	ATCC	Cat# HTB-26
Human: BT-549	ATCC	Cat# HTB-122
Human: BT-20	ATCC	Cat# HTB-19
Human: MCF7	ATCC	Cat# HTB-22
Human: GSC 738	This study	N/A
Human: GSC 2907	This study	N/A
Mouse: 4T1-luc	ATCC	Cat# CRL-2539-LUC2
Human: MDA-MB-231-luc	This study	N/A
Human: HeLa	ATCC	Cat# CCL-2
Human: HEK293T	ATCC	Cat# CRL-11268
Human: DLD-1 WT and Fbxw7 KO	Dr. Bert Vogelstein	N/A
Human: HCT116 WT and Fbxw7 KO	Dr. Bert Vogelstein	N/A
Experimental models: Organisms/strains
Mouse: NOD.Cg-Prkdc^scid Il2rg^tm1Wjl/SzJ	Jackson Laboratory	Cat# 005557
Mouse: BALB/cJ	Jackson Laboratory	Cat# 000651
Oligonucleotides
Sequences provided in STAR Methods	This paper	N/A
Recombinant DNA
pCMV-Myc-FBXO7	This paper	N/A
pCMV-Myc-ΔF-FBXO7	This paper	N/A
pCMV-Myc-EYA2	This paper	N/A
pFlag-CMV2-FBXO7	This paper	N/A
pFlag-CMV2-ΔF-FBXO7	This paper	N/A
pFlag-CMV2-EYA2	This paper	N/A
pFlag-CMV2-EYA2-2A	This paper	N/A
pFlag-CMV2-FBXL5	This paper	N/A
pFlag-CMV2-FBXO27	This paper	N/A
pFlag-CMV2-SKP2	This paper	N/A
pFlag-CMV2-β-TRCP	This paper	N/A
pFlag-CMV2-FBXW7	This paper	N/A
pFlag-CMV2-FBXO44	This paper	N/A
pFlag-CMV2-CUL1	This paper	N/A
pcDNA3.1-HA-EYA2	This paper	N/A
pcDNA3.1-HA-SIX1	This paper	N/A
pcDNA3.1-HA-Tomm20	This paper	N/A
pcDNA3.1-HA-EYA2-AD	This paper	N/A
pcDNA3.1-HA-EYA2-ED	This paper	N/A
pcDNA3.1-GST-FBXW7	This paper	N/A
HA-Ubiquitin	(Kamitani et al., 1997); Addgene	Cat# 18712
Flag- EYA2(D274N)	(Zhang et al., 2021)	N/A
Flag- EYA2(A532R)	(Zhang et al., 2021)	N/A
Software and algorithms
ELDA analysis	Walter and Eliza Hall Institute	http://bioinf.wehi.edu.au/software/elda
ImageJ	NIH	https://imagej.nih.gov/ij/
FlowJo	BD	https://www.flowjo.com/about/company
STAR aligner	(Dobin et al., 2013)	https://code.google.com/p/rna-star/)
GSEA	(Subramanian et al., 2005)	https://www.gsea-msigdb.org/gsea/index.jsp
Bowtie 2	(Langmead and Salzberg, 2012)	http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
Cytoscape v3.8.0	(Shannon et al., 2003)	https://cytoscape.org/

Open in a new tab

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cell models

Cancer cell lines were purchased from the American Tissue Culture Collection (ATCC) or Thermo Fisher Scientific. MDA-MB-231, BT-549, MCF7, DLD-1, and 4T1-luc cells were cultured in RPMI 1640 (Corning), HeLa, HEK293T, and HEK293FT cells in DMEM (Corning), MDA-MB-231-luc cells in MEM (Corning), and HCT116 cells in McCoy’s 5A (Corning). The above media were supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, and 100 U/ml penicillin and streptomycin. All in vitro experiments were performed using multiple-well plates or dishes pre-treated with Matrigel (BD no. 356234) except tumorsphere assays and ELDA that used ultra-low attachment plates and migration/invasion assays that used commercial 24-well plates with inserts. Glioblastoma stem cells (GSCs) were cultured in Neurobasal medium (Thermo Fisher Scientific no. 11360070) supplemented with B27 without vitamin A (Thermo Fisher Scientific no. A3353501), EGF, and bFGF (20 ng/ml each, R&D Systems), sodium pyruvate (Thermo Fisher Scientific no. 11360070), and GlutaMAX (Thermo Fisher Scientific no. 35050061). All cells were incubated at 37°C in 5% CO₂. Cell cultures were authenticated by short tandem repeat (STR) analysis.

Animals

6-to-8-week-old female BALB/c mice and 4-to-6-week-old female NSG (NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ) mice were purchased from The Jackson Laboratory. Mice were maintained under pathogen-free conditions in 14 hrs light/10 hrs dark cycle with ad libitum access to food and water. All animal handling and procedures were performed in accordance with protocols approved by the Institutional Animal Care and Use Committees of SBP or University of California, San Diego (UCSD).

METHOD DETAILS

Gene silencing

The quantitative image-based RNAi screen was performed using a cell-spot microarray approach (Rantala et al., 2011), modified for detection of DAPI, E-cadherin, EpCAM, Vimentin, and KRT14. FBXO7 siRNAs (no. SI00097888, SI00097881), EYA2 siRNAs (no. SI00382200, SI04137280), and AXL siRNAs (no. SI00605304, SI00605311) were purchased from Qiagen. FBXW7 siRNA (ACAGGACAGUGUUUACAAATT) was synthesized by Dharmacon. siRNA transfections were performed using Lipofectamine RNAiMAX Reagent (Thermo Fisher Scientific no 13778150). Unless otherwise noted, cells were harvested 72 hrs post-transfection. Lentiviral shRNA vectors included non-targeting (Dharmacon no. RHS6848 and Sigma no. SCH002), FBXO7 #1 (Dharmacon no. RHS3979–201736610), FBXO7 #2 (Dharmacon no. RHS3979–201736614), SIX1 #1 (Sigma no. TRCN0000329803), and SIX1 #2 (Sigma no. TRCN0000329865). Plasmid transfections were performed using jetPRIME transfection reagent (Polyplus no. 114–15) for HEK293T and HEK293FT cells and Lipofectamine 2000 (Thermo Fisher Scientific no. 11668019) for all other cell lines, following the manufacturer’s instructions. Lentiviruses were generated using HEK293FT cells (Thermo Fisher Scientific no. R70007) and vectors pLenti CMV Puro DEST (Addgene plasmid no. 17452) or pLKO.1 (Addgene plasmid no. 10878) using standard techniques. Viral transductions were performed in the presence of 8 μg/ml polybrene (Sigma-Aldrich no. H9268).

RT-qPCR analysis

Total RNA was isolated using the RNeasy Plus Mini Kit (Qiagen no. 74134). cDNA was synthesized using qScript cDNA SuperMix (Quantabio no. 95048) following the manufacturer's instructions. qPCR reactions were performed using SYBR Select Master Mix (Thermo Fisher Scientific no. 4472908) and a Stratagene Mx3000P instrument (Agilent Technologies). Thermal cycling conditions included an initial denaturation step of 95°C for 10 min and 40 cycles at 95°C for 15 sec and 60°C for 60 sec. Analyses were carried out in triplicate. The qPCR primers used for gene expression analysis include: E-cadherin- TCCCAGGCGTAGACCAAGA and ATTTTTCCCTCGACACCCGAT, KRT19- GGATGGTCGTGTAGTAGTGGC and AACGGCGAGCTAGAGGTGA, Vimentin- TGTCCAAATCGATGTGGATGTTTC and TTGTACCATTCTTCTGCCTCCTG, N-cadherin- TCAGGCGTCTGTAGAGGCTT and ATGCACATCCTTCGATAAGACTG, Fibronectin- AAACCTCGGCTTCCTCCATAA and CGGTGGCTGTCAGTCAAAG, FBXO7- GCCCTAACATACTGTCGTCATTC and GATTCAGAGCATTCTTCACTCCA, EYA2- CAGCGATTGTCTGGATAAACTGA and GGAGGTGGGTAAGCTGTATAGG, GAS6- GGTAGCTGAGTTTGACTTCCG and GACAGCATCCCTGTTGACCTT, SIX1- CTCCACGTAATGCGCCTTCA and ACAAGAACGAGAGCGTACTCA, ZEB1- GATGATGAATGCGAGTCAGATG and ACAGCAGTGTCTTGTTGTTGT, FBXW7- CGACGCCGAATTACATCTGTC and CGTTGAAACTGGGGTTCTATCA, TWIST- CCAGCTTGAGGGTCTGAATC and GTCCGCAGTCTTACGAGGAG, IFNα- AATGACAGAATTCATGAAAGCGT and GGAGGTTGTCAGAGCAGA, IFNβ- GCCATCAGTCACTTAAACAGC and GAAACTGAAGATCTCCTAGCCT, CXCL9- CCAGTAGTGAGAAAGGGTCGC and AGGGCTTGGGGCAAATTGTT, CXCL10- GCCTTCGATTCTGGATTCAG and GTGGCATTCAAGGAGTACCTC, HLA-A- CGACGCCGCGAGCCAGA and GCGATGTAATCCTTGCCGTCGTAG, HLA-B- GACGGCAAGGATTACATCGCCCTGAA and CACGGGCCGCCTCCCACT, IFNGR1- TTCCATCTCGGCATACAGCAA and TCTTTGGGTCAGAGTTAAAGCCA, FBXO44- GCCCAGTAATGAGTGTCCACG and AGATTGCGGGTCCAAGTACC, GAPDH- CGACCACTTTGTCAAGCTCA and AGGGGTCTACATGGCAACTG.

Immunoblotting and IP

For immunoblotting, cells were lysed in ice-cold RIPA buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.01% SDS) supplemented with protease and phosphatase inhibitors (50 mM NaF, 1 mM PMSF, 1 mM Na₃VO₄, 1 μg/ml Aprotinin, 1 μg/ml Leupeptin, 1 μg/ml Pepstatin). Lysates were briefly sonicated, clarified, then subjected to SDS-PAGE and transferred to PVDF membranes using a Bio-Rad transfer apparatus. Membranes were blocked with 5% non-fat milk or bovine serum albumin (BSA) in TBS containing 0.1% Tween-20 (TBST) for 1 hr at 25°C, followed by incubation with primary antibody overnight at 4°C. Membranes were washed 3 × 10 min in TBST and incubated with species-specific HRP-conjugated secondary antibodies (Pierce) for 1 hr at 25°C. After 3 × 10 min washes in TBST, membranes were developed using an enhanced chemiluminescence (ECL) reagent before exposure to film or ChemiDoc Imaging System (Bio-Rad). For IP, cells were lysed in IP buffer (50 mM Tris-HCl [pH 7.4], 125 mM NaCl, 1 mM EDTA, 0.1% Triton X-100) with inhibitors (50 mM NaF, 1 mM PMSF, 1 mM Na₃VO₄, 1 μg/ml Aprotinin, 1 μg/ml Leupeptin, 1 μg/ml Pepstatin) followed by sonication and centrifugation to clear insoluble debris. Lysates were then incubated with protein G agarose and IgG antibody of the same species as the IP antibody for 2 hrs at 4°C to reduce non-specific binding. The cleared lysates were incubated with IP antibody overnight at 4°C. Following incubation, protein G agarose was added for 2 hrs at 4°C with rotation and beads washed 3x with IP buffer, boiled in 1x SDS gel loading buffer, and subjected to SDS-PAGE. Specifically, for Flag IP, 5 μg of anti-Flag antibody (Sigma-Aldrich no. F7425) was used for 2.5 mg of lysate. For Myc IP, anti-Myc antibody (Cell Signaling Technology no. 2276) was used at 1:1000 dilution. For HA IP, anti-HA antibody (Thermo Fisher Scientific no. 71–5500) was used at 1:50 dilution. For FBXO7 IP, 15 μg of anti-FBXO7 antibody (Aviva Systems Biology no. ARP43128_P050) was used for 5 mg of lysate. For EYA2 IP, 20 μl of anti-EYA2 antibody (Abnova no. H00002139-M04) was used for 4.5 mg of lysate.

In vitro binding and kinase assays

For FBXO7 in vitro binding assays, HA-tagged Tomm20, EYA2, and SIX1 proteins were generated using an in vitro translation system (PURExpress® In Vitro Protein Synthesis Kit, New England Biolabs no. E6800S) that does not support post-translational modifications. The resulting products were incubated with recombinant Flag-FBXO7 protein (2 μg, R&D Systems no. E3–525) in binding buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, and 1% NP-40) for 1 hr at 37°C with rotation. Samples were then incubated with protein G agarose and rabbit IgG antibody for 2 hrs at 4°C to reduce non-specific binding. The cleared supernatants were incubated with anti-HA antibody (1:50, Thermo Fisher Scientific no. 71–5500) and protein G agarose for 2 hrs at 4°C with rotation. Following incubation, beads were washed 3x with binding buffer, boiled in 1x SDS gel loading buffer, and subjected to SDS-PAGE as described above. For SCF^FBXW7 in vitro binding assays, 2 μg of biotinylated peptide corresponding to the un-phosphorylated or phosphorylated forms of the EYA2 CPD were incubated with recombinant SCF^FBXW7 (1 μg, Sigma-Aldrich no. 23–030) in binding buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, and 1% NP-40) for 1 hr at 37°C with rotation. Samples were then incubated with Streptavidin beads (20 μl, Cell Signaling no. 3419) for 2 hrs at 4°C followed by washing with binding buffer and SDS-PAGE. For in vitro kinase assays of biotin-EYA2 CPD peptide incubated with or without GSK3β, 8 μg of peptide (Biotin-DSLNH(S)PGQ(S)GFLSY) and 3.2 μl of 10x Mg-ATP were added to 1x reaction buffer diluted from 10x solution of the Ubiquitin Conjugation Initiation Kit (R&D Systems no. K-995). GSK3β (1.6 μl, Sigma-Aldrich no. G4296) or dH₂O was added for 45 min at 37°C with rotation. Following incubation, samples were diluted with IP buffer (50 mM Tris-HCl [pH 7.4], 125 mM NaCl, 1 mM EDTA, 0.1% Triton X-100) with protease and phosphatase inhibitors (50 mM NaF, 1 mM PMSF, 1 mM Na₃VO₄, 1 μg/ml Aprotinin, 1 μg/ml Leupeptin, 1 μg/ml Pepstatin) to 1 ml prior to IP with anti-phosphoserine antibody (1:50, Sigma-Aldrich no. P5747) according to the procedure described above. After IP, protein G beads were washed 3x with IP buffer and boiled in 30 μl of dH₂O for 5 min to release biotin molecules. The biotin signals reflecting relative levels of phosphorylated peptides were quantified using the QuantTag Biotin Quantitation Kit (Vector Laboratories no. BDK-2000) according to the manufacturer's instructions.

Ubiquitylation assays

For in vivo ubiquitylation assays, HEK293T or WT or Fbxw7 KO HCT116 cells were transfected with the indicated plasmids and treated with 26S proteasome inhibitor MG132 (10 μM) 6 hrs prior to harvesting 48 hrs post-transfection. For GSK3βi treatment, GSK3 inhibitor XIII (2 μM, Cayman no. 21190) was added to the medium at 24 hrs. Cells were lysed in 1% SDS with 10 mM N-ethylmaleimide and sonicated in NP-40 lysis buffer. Lysates were incubated with protein G agarose (20 μl) and normal rabbit IgG antibody (5 μg) for 2 hrs at 4°C to reduce non-specific binding. IP was performed by incubating the cleared lysates with 5 μg of anti-Flag antibody (Sigma-Aldrich no. F7425) overnight at 4°C. Beads were washed 3x with NP-40 lysis buffer, boiled in 1x SDS gel loading buffer, and subjected to SDS-PAGE. For SCF^FBXO7 in vitro ubiquitylation assays, HEK293T cells in 10 cm dishes were transfected with plasmids that express HA-EYA2 or HA-cIAP1. After 48 hrs, cells were resuspended in lysis buffer (1% SDS and 10% NP-40) containing protease inhibitor cocktail (Sigma-Aldrich no. P8340) and phosphatase inhibitors (10 mM NaF, 1 mM PMSF, 1 mM Na₃VO₄). IP was performed with anti-HA antibody (1:50, Thermo Fisher Scientific no. 71–5500) overnight at 4°C. Beads (20 μl) were washed 3x with lysis buffer prior to in vitro ubiquitylation reactions using the Ubiquitin Conjugation Initiation Kit (R&D Systems no. K-995). E2 UbcH5a (0.8 μl, R&D Systems no. E2-616-100) and SCF^FBXO7 (2 μl, R&D Systems no. E3–526) were added to the reactions (20 μl) containing ubiquitin, E1, and Mg-ATP for 1 hr at 37°C with rotation. Beads were then washed in lysis buffer and boiled in 1x SDS gel loading buffer prior to SDS-PAGE. For SCF^FBXW7 in vitro ubiquitylation assays, HA-EYA2 purified as described above was subjected to kinase reactions with GSK3β (1.6 μl, Sigma-Aldrich no. G4296) and Mg-ATP in reaction buffer (20 μl) from the Ubiquitin Conjugation Initiation Kit for 45 min at 37°C with rotation. Beads were washed 3x with reaction buffer prior to in vitro ubiquitylation reactions. E2 enzymes UBE2R1/CDC34 (0.8 μl, R&D Systems no. E2-610-100) and SCF^FBXW7 (2 μl, Sigma-Aldrich no. 23030) were added to the reaction (20 μl) containing ubiquitin, E1, and Mg-ATP for 1 hr at 37°C with rotation. FBXO7 recombinant protein (0.8 μl, R&D Systems no. E3–525) was included to detect the competition effect. Beads were washed 3x with reaction buffer, reactions resolved by SDS-PAGE, and ubiquitylation analyzed by immunoblotting with anti-GST and anti-HA antibodies. Polyubiquitylation of recombinant Cyclin E1 (2 μl, Thermo Fisher Scientific no. PV6295) by SCF^FBXW7 served as positive control.

RNA-seq

PolyA⁺ RNA was isolated using the NEBNext Poly(A) mRNA Magnetic Isolation Module and barcoded libraries made using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB). Libraries were pooled and single-end sequenced (1 × 75) on an Illumina NextSeq 500 using the High Output V2 Kit (Illumina). Read data was processed in BaseSpace (basespace.illumina.com). Reads were aligned to the Homo sapiens genome (hg19) using STAR aligner (https://code.google.com/p/rna-star/) with default settings. Differential transcript expression was determined using the Cufflinks Cuffdiff package (https://github.com/cole-trapnell-lab/cufflinks). GSEA was performed on pre-ranked gene lists upon FBXO7 KD using gene set permutation for statistical testing.

ChIP and ChIP-seq

For Flag-tagged ChIP experiments, cells were cross-linked with 1% formaldehyde for 10 min at 25°C and reactions stopped by adding glycine to 0.125 M for 5 min at 25°C. Cells were washed 3x with PBS and re-suspended in ChIP lysis buffer (50 mM Tris-HCl [pH 8.1], 1% SDS, 10 mM EDTA, 0.2 mM PMSF, 1 μg/ml Aprotinin, 1 μg/ml Leupeptin). Specifically, lysates prepared from 10⁶ cells in 130 μl lysis buffer were introduced into microsonication tubes (Covaris no. 520045). DNA was fragmented by sonication in a S220 Focused-Ultrasonicator (Covaris) for 7 min (Duty cycle- 5%, Intensity- 4, Cycles/Burst- 200). After centrifugation, the supernatant was diluted 1:10 with ChIP dilution buffer (Tris-HCl [pH 8.1], 0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM NaCl, 0.2 mM PMSF, 1 μg/ml Aprotinin, 1 μg/ml Leupeptin), 5% saved for input, and the remaining lysate pre-cleared for 2 hrs with 15 μl protein G agarose before overnight incubation with anti-Flag antibody. Specifically, 2.5 μl of anti-Flag antibody (Cell Signaling Technology no. 14793) was used for 10⁶ cells. Bound material was recovered after incubation with 15 μl of protein G agarose at 4°C. Beads were then washed sequentially with low salt buffer (20 mM Tris-HCl [pH 8.1], 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl), high salt buffer (20 mM Tris-HCl [pH 8.1], 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 500 mM NaCl), LiCl buffer (10 mM Tris-HCl [pH 8.1], 0.25 M LiCl, 1% IGEPAL-CH630, 1% Na deoxycholate, 1 mM EDTA), and TE (10 mM Tris-HCl [pH 8.1], 1 mM EDTA). Elution was performed by adding 200 μl of freshly prepared elution buffer (1% SDS, 0.1 M NaHCO₃) to 15 μl protein G agarose and rotating the sample for 15 min at 25°C. After centrifugation, the chromatin IP and input were reverse cross-linked by adding 5M NaCl (4 μl for input, 8 μl for IP sample) and incubated overnight at 65°C, and then DNA extracted using the Gel Extraction Kit (Qiagen no. 28704). Primers used for The qPCR reactions include: Gas6- GAGCATGAACTAAACGGGGCA and CCGTTTAGTTCATGCTCCGGG, and Gapdh- TCGAACAGGAGGAGCAGAGAG and TACTAGCGGTTTTACGGGCG. For ChIP-seq, libraries were constructed using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Libraries were pooled and single-end sequenced (1 × 75) on an Illumina NextSeq 500 using the High Output V2 kit (Illumina). Read data was processed in BaseSpace (basespace.illumina.com). ChIP-seq reads were then aligned to the Homo sapiens genome (hg19) using Bowtie 2 with default parameters. The binding peaks were called using MACS2 with the default parameters except --nomodel --extsize 200 -q 0.05. The heatmap and profile plots of ChIP-seq profiling were visualized by plotHeatmap and plotProfile functions in deepTools v3. The bigWig files were generated using bamCoverage function in deepTools v3 with the parameters --normalizeUsing CPM --binSize 10. The quantitative comparison of EYA2 ChIP-seq control and FBXO7 KD datasets was performed using MAnorm v1.3.0. Annotation of ChIP-seq binding peaks was performed with ChIPseeker package. Pathway enrichment analysis was done with ClueGO v2.5.7 in Cytoscape v3.8.0.

IF and IHC

For IF analysis, cells grown on coverslips were washed twice with ice-cold PBS and then fixed with 4% paraformaldehyde for 20 min at 25°C followed by permeabilization with 0.5% Triton X-100 in PBS for 5 min. After 3 × 10 min washes in PBS, cells were incubated in blocking buffer (10 mM Tris-Cl [pH 7.5], 120 mM KCl, 20 mM NaCl, 0.5 mM EDTA, 0.1% Triton X-100, 10% milk, 2% BSA) overnight at 4°C. The relevant primary antibodies diluted in blocking buffer were then added. Specifically, 1:200 dilution for anti-E-cadherin antibody (Cell Signaling Technology no. 3195) and 1:100 dilution for anti-Vimentin antibody (Cell Signaling Technology no. 5741). Cells were washed 3 × 10 min with KCMT buffer (10 mM Tris-Cl [pH 7.5], 120 mM KCl, 20 mM NaCl, 0.5 mM EDTA, 0.1% Triton X-100) and incubated with Alexa Fluor 488-labeled anti-rabbit (Thermo Fisher Scientific no. A-21441) or Alexa Fluor 594-labeled anti-mouse (Cell Signaling Technologies no. 8890) antibodies at 1:500 dilution for 1 hr at 25°C. After 3 × 10 min washes with KCMT buffer, cells were stained with DAPI (Thermo Fisher Scientific no. D1306), coverslips mounted with antifade mounting medium (Vector Laboratories no. H-1000), and slides examined by confocal microscopy (Zeiss LSM 710 NLO). IHC staining was performed using the Bond Polymer Refine Detection Kit (Leica no. DS9800) and images scanned using Aperio ScanScope AT2 (Aperio Technologies). For analysis of mouse lung specimens, lungs were removed and fixed in 10% formalin for 24 hrs and paraffin embedded. Serial sections cut at 5 μm thickness were stained with hematoxylin (Leica no. 3801560) for 4 min followed by eosin (Leica no. 3801600) for 30 sec. Slides were then dehydrated, cleaned, and mounted with Cytoseal 60 mounting media (Thermo Fisher Scientific no. 8310–4). Tissue sections were scanned using Aperio ScanScope AT2. For 4T1-luc tumors, staining was performed as above using the BOND RX automated IHC system (Leica) with anti-CD8a (1:50, Thermo Fisher Scientific no. 14-0808-82) and NK Cell Marker (ANK61) (1:50, Santa Cruz no. sc-59340) antibodies.

Mass spectrometry

Flag-FBXO7 or Flag-empty vector (control) were introduced into Flp-In TREx-HeLa cells (Thermo Fisher Scientific no. R78007) and FBXO7 protein complexes affinity purified. Specifically, cells were lysed and dissolved in 2 ml IP buffer and sonicated until the solution cleared. After centrifugation at 12,000 × g for 20 min at 4°C, the supernatants were collected and adjusted to 3 ml with IP buffer and pre-cleared by incubation with 10 μl of normal rabbit IgG and 60 μl of protein G agarose for 2 hrs at 4°C. The supernatants were then incubated with 12.5 μl of anti-Flag antibody (Sigma-Aldrich no. F7425) overnight at 4°C. After 3 × 10 min washes with IP buffer, immunoprecipitates were eluted 3x with 150 μl of Flag peptide elution buffer (Sigma-Aldrich no. FLAGIPT1). Trichloroacetic acid (Sigma-Aldrich no. T0699) was then added to the eluents to a final concentration of 20% and incubated on ice for 1 hr. After centrifugation at 14,000 × g for 25 min at 4°C, pellets were washed with 500 μl ice-cold acetone. After another centrifugation at 14,000 × g for 25 min at 4°C, pellets were air-dried for 30 min and stored at −20°C. Mass spectrometry was performed using duplicate samples as described (Vashisht et al., 2015).

Cell migration/invasion assays

Gap closure assays were performed using 6-well plates. Cells were plated at 5 × 10⁵/well and cultured until confluent. A wound gap was scratched using a sterile 10 μl pipette tip and the remaining cells washed with medium to remove loose cells prior to incubation with serum-free media for 24 hrs. Three wounds were made for each sample and migrating cells photographed and quantified at 0 and 24 hrs. For Boyden chamber migration assays, 4 × 10⁴ cells in 40 μl of medium containing 0.5% FBS were plated into the upper chambers of 24-well inserts with 8 μm pores (Trevigen no. 3484-024-01). Bottom wells contained 360 μl of medium supplemented with 10% FBS. After 24 hrs, cells were fixed with ice-cold methanol for 20 min, non-migrating cells that remained in the upper chamber gently removed using a cotton swab, and cells that migrated to the bottom chambers stained with 1% crystal violet. Invasion assays were performed using well inserts pre-coated with basement membrane (medium density). For both experiments, cells that migrated to the bottom chambers were quantified by imaging 4 randomly selected fields.

Tumorsphere assays and ELDA

For tumorsphere assays, 2.5 × 10³ cells were plated onto 6-well ultra-low attachment plates containing 2 ml complete MammoCult Human Medium (STEMCELL Technologies no. 05620). After 10 days, tumorspheres larger than 50 μm were counted using a light microscope. Experiments were performed in triplicate. For ELDA, decreasing numbers of cells (200, 100, 50, 25, and 10) per well were seeded onto 96-well ultra-low attachment plates for 14 days. Spheroids larger than 50 μm were recorded. ELDA assays were analyzed using software available at http://bioinf.wehi.edu.au/software/elda.

Flow cytometry

For cell surface expression of HLA-A/B/C, cells were plated into 6-well plates at 3 × 10⁵ cells/well. After 24 hrs, cells were detached using Accutase cell detachment solution (STEMCELL no. 07920) and 10⁶ cells stained with 5 μl PE-anti-HLA-A, B, C antibody (BioLegend no. 311405) or PE-IgG2a isotype antibody (BioLegend no. 400211) and analyzed on an LSR Fortessa instrument (BD PharMingen). For 4T1-luc experiments, tumors were dissociated into single cells using the gentleMACS Octo Dissociator with heaters (Miltenyi Biotec) as described in the protocol for the Tumor Dissociation Kit (Miltenyi Biotec no. 130-096-730). Cells were passed through a 70 μm filter to remove clumps and maintain single cell suspensions. Cell surface staining was performed with the indicated antibodies before fixation and permeabilization of cells for intracellular staining. For IFNγ detection, Cell Activation Cocktail (BioLegend no. 423303) was used for stimulation 5 hrs prior to cell surface staining. All antibodies (anti-CD45.2, anti-CD3ε, anti-CD8, anti-CD335, anti-Foxp3, anti-IFNγ, anti-H-2Kd) were purchased from BioLegend. Samples were analyzed using a LSR Fortessa instrument (BD PharMingen) and data analyzed with FlowJo Software (Treestar).

In vivo mouse studies

For intracardiac injections, 10⁵ MDA-MB-231-luc cells transduced with the indicated lentiviruses were injected into the left ventricle of 4-to-6-week-old female NSG mice anesthetized with isoflurane. Metastatic seeding was monitored weekly by intraperitoneal (i.p.) injection of 100 μl of 30 mg/ml D-Luciferin (Xenogen no. XR-1001) 10 min prior to imaging using an IVIS Spectrum Xenogen Imaging System (Caliper Life Sciences). Images were analyzed using Living Image 3.0 software (Caliper Life Sciences). For ex vivo imaging, tissues were harvested and placed in 24-well tissue culture plates containing 1 ml of 0.3 mg/ml D-Luciferin and imaged. For orthotopic xenograft experiments, 3 × 10⁶ MDA-MB-231-luc cells were injected into the mammary fat pads of 4-to-6-week-old female NSG mice. Tumor size was measured every 8 days (long diameter and short diameter) by caliper and tumor volume calculated as 0.5 × length × width × width. After 40 days, mice were euthanized and lung tissue fixed in 10% formalin and subjected to hematoxylin and eosin staining for metastasis analysis. For EYA2i treatment, 3 × 10⁶ MDA-MB-231-luc cells were injected into the mammary fat pads of 4-to-6-week-old female NSG mice. After 10 days, mice were administered vehicle (10% Cremophor EL in PBS) or EYA2i at 40 mg/kg body weight via local tumor injection on days 12, 14, 17, 19, 21 and 24 post-inoculation of cells. Tumor size was measured every 5 days. For ex vivo imaging of lung tissues, mice were injected with 100 μl of 30 mg/ml D-Luciferin (Xenogen no. XR-1001) 10 min prior to euthanasia, lung tissues harvested and placed in 24-well tissue culture plates containing 1 ml of 0.3 mg/ml D-Luciferin, and tissue imaged as described above. For 4T1-luc mammary tumor experiments, 10⁵ 4T1-luc cells were inoculated into the mammary fat pads of 6-to-8-week-old female BALB/c mice (The Jackson Laboratory). Mice were administered vehicle (10% Cremophor EL in PBS) or EYA2i at 40 mg/kg body weight via local tumor injection on days 9, 11, 13, 15, and 17 post-inoculation of cells and administered 200 μg rat IgG2a isotype (BioXCell no. BP0089) or anti-PD-1 antibody (BioXCell no. BP0273) via i.p. injection on days 12, 14, 16, 18, 20, 22, and 24 post-inoculation of 4T1-luc cells. Tumor size was measured every 5 days. On day 32, 5 mice per group were euthanized and portions of the tumors processed for flow cytometry and histological analysis. Mouse survival was monitored with tumor volume exceeding 2 cm³, weight loss >20%, and decreasing behavioral conditions considered as endpoints.

FBXO7-immune gene signature analysis in immunotherapy datasets

The FBXO7-immune gene signature was defined as the core-enrichment of marked genes in GSEA analysis of the 8 immune response-related gene sets, including “GO_ACUTE_INFLAMMATORY_RESPONSE”, “GO_ANTIGEN_PROCESSING_AND_PRESENTATION_OF_PEPTIDE_ANTIGEN_VIA_MHC_CLASS_I”, “GO_CHEMOKINE_MEDIATED_SIGNALING_PATHWAY”, “GO_POSITIVE_REGULATION_OF_CYTOKINE_SECRETION”, “GO_REGULATION_OF_T_CELL_PROLIFERATION”, “GO_RESPONSE_TO_INTERFERON_BETA”, “GO_RESPONSE_TO_INTERFERON_GAMMA” and “GO_T_CELL_MEDIATED_IMMUNITY”. The immunotherapy datasets for anti-PD1 therapy or adoptive cell transfer of TILs were analyzed in these studies (Harel et al., 2019; Lauss et al., 2017; Riaz et al., 2017). The processed protein or RNA expression data were retrieved from the publication or Gene Expression Omnibus (GSE91061 and GSE100797). The FBXO7-immune gene signature score was calculated in each dataset using the “z-score” method in GSVA. The difference of signature score between responders and non-responders was tested using unpaired Student’s t-test.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical significance tests, including unpaired Student’s t-test, one-way ANOVA, two-way ANOVA, Spearman correlation test and normality test, were performed using R or Graphpad Prism software, as denoted in each analysis. Data in the barplot or curve are presented as mean ± SEM. For box-and-whisker plots, the box indicates interquartile range (IQR), the line in the box indicates median, the whiskers indicate points within Q3+1.53IQR and Q1−1.53IQR and the points beyond whiskers indicate outliers. Q1 and Q3, the first and third quartiles, respectively. All statistical tests were two-tailed. p < 0.05 of the two tail was taken to indicate statistical significance unless otherwise stated. No statistical methods were used to predetermine sample size. Animal experiments were randomized. The investigators were not blinded to allocation during experiments and outcome assessment.

Supplementary Material

Supplemental Info

NIHMS1777914-supplement-Supplemental_Info.pdf^{(3.4MB, pdf)}

Table S1

Table S1, related to Figure 2. FBXO7-interacting proteins identified by mass spectrometry.

NIHMS1777914-supplement-Table_S1.xlsx^{(13.1KB, xlsx)}

Table S2

Table S2, related to Figure 4. List of EYA2 marked peaks identified by ChIP-seq analysis.

NIHMS1777914-supplement-Table_S2.xlsx^{(777KB, xlsx)}

Table S3

Table S3, related to Figure 7. Correlation analysis between FBXO7 expression and the indicated genes/pathways in TCGA database.

NIHMS1777914-supplement-Table_S3.xlsx^{(42.4MB, xlsx)}

Table S4

Table S4, related to Figure 7. Correlation analysis between FBXW7 expression and the indicated genes/pathways in TCGA database.

NIHMS1777914-supplement-Table_S4.xlsx^{(50MB, xlsx)}

Table S5

Table S5, related to Figure 7. Correlation analysis between Fbxw7 alterations and the indicated genes/pathways in TCGA database.

NIHMS1777914-supplement-Table_S5.xlsx^{(1.6MB, xlsx)}

Highlights:

FBXO7 maintains mesenchymal and immune evasion phenotypes of cancer cells
FBXO7 promotes EYA2-SIX1-mediated expression of GAS6 to stimulate AXL signaling
Ubiquitin ligase SCF^FBXW7 antagonizes FBXO7 by promoting EYA2 degradation
FBXO7/EYA2 targeting exhibits antitumor activity and augments ICB therapy response

ACKNOWLEDGMENTS

The authors thank Dr. Heide Ford (University of Colorado Denver, USA) for critically reading the manuscript, Drs. Peter Adams and Ani Deshpande (Sanford Burnham Prebys Medical Discovery Institute (SBP), USA) labs for reagents and instrument support, Drs. Anagha Deshpande (SBP), Hiroshi Tanaka (SBP), and Nirmalya Dasgupta (SBP) for help with ChIP and ChIP-seq data analysis, and Dr. Bert Vogelstein (Johns Hopkins University, USA) for WT and Fbxw7 KO colorectal cancer cell lines. Funding sources: This study was funded by an anonymous foundation grant and NIH grant CA267103 to C.S.; NIH grants CA197718, CA238662, and NS103434 to J.N.R.; Swedish Childhood Cancer Foundation (PR2019-0060), Swedish Cancer Society (20 1173 PjF), Swedish Research Council (2020-01243), and Radiumhemmets Forskningsfonder (201333) to O.S.; NIH grant GM089778 to J.W.; and NCI Cancer Center Support Grant (P30 CA030199) to SBP’s Shared Resources.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

DECLARATION OF INTERESTS

The authors declare no competing interests.

REFERENCES

Aguilera TA, and Giaccia AJ (2017). Molecular Pathways: Oncologic Pathways and Their Role in T-cell Exclusion and Immune Evasion-A New Role for the AXL Receptor Tyrosine Kinase. Clinical cancer research : an official journal of the American Association for Cancer Research 23, 2928–2933. 10.1158/1078-0432.CCR-17-0189. [DOI] [PMC free article] [PubMed] [Google Scholar]
Aguilera TA, Rafat M, Castellini L, Shehade H, Kariolis MS, Hui AB, Stehr H, von Eyben R, Jiang D, Ellies LG, et al. (2016). Reprogramming the immunological microenvironment through radiation and targeting Axl. Nature communications 7, 13898. 10.1038/ncomms13898. [DOI] [PMC free article] [PubMed] [Google Scholar]
Antony J, and Huang RY (2017). AXL-Driven EMT State as a Targetable Conduit in Cancer. Cancer research 77, 3725–3732. 10.1158/0008-5472.CAN-17-0392. [DOI] [PubMed] [Google Scholar]
Bertrand F, Montfort A, Marcheteau E, Imbert C, Gilhodes J, Filleron T, Rochaix P, Andrieu-Abadie N, Levade T, Meyer N, et al. (2017). TNFalpha blockade overcomes resistance to anti-PD-1 in experimental melanoma. Nature communications 8, 2256. 10.1038/s41467-017-02358-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
Blevins MA, Towers CG, Patrick AN, Zhao R, and Ford HL (2015). The SIX1-EYA transcriptional complex as a therapeutic target in cancer. Expert opinion on therapeutic targets 19, 213–225. 10.1517/14728222.2014.978860. [DOI] [PMC free article] [PubMed] [Google Scholar]
Brabletz T, Kalluri R, Nieto MA, and Weinberg RA (2018). EMT in cancer. Nature reviews. Cancer 18, 128–134. 10.1038/nrc.2017.118. [DOI] [PubMed] [Google Scholar]
Braunger J, Schleithoff L, Schulz AS, Kessler H, Lammers R, Ullrich A, Bartram CR, and Janssen JW (1997). Intracellular signaling of the Ufo/Axl receptor tyrosine kinase is mediated mainly by a multi-substrate docking-site. Oncogene 14, 2619–2631. 10.1038/sj.onc.1201123. [DOI] [PubMed] [Google Scholar]
Brooks MD, Burness ML, and Wicha MS (2015). Therapeutic Implications of Cellular Heterogeneity and Plasticity in Breast Cancer. Cell stem cell 17, 260–271. 10.1016/j.stem.2015.08.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
Chen L, Gibbons DL, Goswami S, Cortez MA, Ahn YH, Byers LA, Zhang X, Yi X, Dwyer D, Lin W, et al. (2014). Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nature communications 5, 5241. 10.1038/ncomms6241. [DOI] [PMC free article] [PubMed] [Google Scholar]
Colavito SA (2020). AXL as a Target in Breast Cancer Therapy. Journal of oncology 2020, 5291952. 10.1155/2020/5291952. [DOI] [PMC free article] [PubMed] [Google Scholar]
D'Alfonso TM, Hannah J, Chen Z, Liu Y, Zhou P, and Shin SJ (2014). Axl receptor tyrosine kinase expression in breast cancer. Journal of clinical pathology 67, 690–696. 10.1136/jclinpath-2013-202161. [DOI] [PMC free article] [PubMed] [Google Scholar]
David JM, Dominguez C, McCampbell KK, Gulley JL, Schlom J, and Palena C (2017). A novel bifunctional anti-PD-L1/TGF-beta Trap fusion protein (M7824) efficiently reverts mesenchymalization of human lung cancer cells. Oncoimmunology 6, e1349589. 10.1080/2162402X.2017.1349589. [DOI] [PMC free article] [PubMed] [Google Scholar]
Davis RJ, Welcker M, and Clurman BE (2014). Tumor suppression by the Fbw7 ubiquitin ligase: mechanisms and opportunities. Cancer cell 26, 455–464. 10.1016/j.ccell.2014.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
Diaz VM, and de Herreros AG (2016). F-box proteins: Keeping the epithelial-to-mesenchymal transition (EMT) in check. Seminars in cancer biology 36, 71–79. 10.1016/j.semcancer.2015.10.003. [DOI] [PubMed] [Google Scholar]
Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, and Gingeras TR (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21. 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]
Dongre A, Rashidian M, Reinhardt F, Bagnato A, Keckesova Z, Ploegh HL, and Weinberg RA (2017). Epithelial-to-Mesenchymal Transition Contributes to Immunosuppression in Breast Carcinomas. Cancer research 77, 3982–3989. 10.1158/0008-5472.CAN-16-3292. [DOI] [PMC free article] [PubMed] [Google Scholar]
Farabaugh SM, Micalizzi DS, Jedlicka P, Zhao R, and Ford HL (2012). EYA2 is required to mediate the pro-metastatic funxctions of SIX1 via inducxtion of TGF-b signaling, epithelial-mesenchymal transition, and cancer stem cell properties. Oncogene 31, 552–562. 10.1038/onc.2011.259. [DOI] [PMC free article] [PubMed] [Google Scholar]
Fridell YW, Jin Y, Quilliam LA, Burchert A, McCloskey P, Spizz G, Varnum B, Der C, and Liu ET (1996). Differential activation of the Ras/extracellular-signal-regulated protein kinase pathway is responsible for the biological consequences induced by the Axl receptor tyrosine kinase. Molecular and cellular biology 16, 135–145. 10.1128/MCB.16.1.135. [DOI] [PMC free article] [PubMed] [Google Scholar]
Geis-Asteggiante L, Belew AT, Clements VK, Edwards NJ, Ostrand-Rosenberg S, El-Sayed NM, and Fenselau C (2018). Differential Content of Proteins, mRNAs, and miRNAs Suggests that MDSC and Their Exosomes May Mediate Distinct Immune Suppressive Functions. Journal of proteome research 17, 486–498. 10.1021/acs.jproteome.7b00646. [DOI] [PMC free article] [PubMed] [Google Scholar]
Gjerdrum C, Tiron C, Hoiby T, Stefansson I, Haugen H, Sandal T, Collett K, Li S, McCormack E, Gjertsen BT, et al. (2010). Axl is an essential epithelial-to-mesenchymal transition-induced regulator of breast cancer metastasis and patient survival. Proceedings of the National Academy of Sciences of the United States of America 107, 1124–1129. 10.1073/pnas.0909333107. [DOI] [PMC free article] [PubMed] [Google Scholar]
Goyette MA, Duhamel S, Aubert L, Pelletier A, Savage P, Thibault MP, Johnson RM, Carmeliet P, Basik M, Gaboury L, et al. (2018). The Receptor Tyrosine Kinase AXL Is Required at Multiple Steps of the Metastatic Cascade during HER2-Positive Breast Cancer Progression. Cell reports 23, 1476–1490. 10.1016/j.celrep.2018.04.019. [DOI] [PubMed] [Google Scholar]
Gstalder C, Liu D, Miao D, Lutterbach B, DeVine AL, Lin C, Shettigar M, Pancholi P, Buchbinder EI, Carter SL, et al. (2020). Inactivation of Fbxw7 impairs dsRNA sensing and confers resistance to PD-1 blockade. Cancer discovery. 10.1158/2159-8290.CD-19-1416. [DOI] [PMC free article] [PubMed] [Google Scholar]
Hanson EM, Clements VK, Sinha P, Ilkovitch D, and Ostrand-Rosenberg S (2009). Myeloid-derived suppressor cells down-regulate L-selectin expression on CD4+ and CD8+ T cells. J Immunol 183, 937–944. 10.4049/jimmunol.0804253. [DOI] [PMC free article] [PubMed] [Google Scholar]
Harel M, Ortenberg R, Varanasi SK, Mangalhara KC, Mardamshina M, Markovits E, Baruch EN, Tripple V, Arama-Chayoth M, Greenberg E, et al. (2019). Proteomics of Melanoma Response to Immunotherapy Reveals Mitochondrial Dependence. Cell 179, 236–250 e218. 10.1016/j.cell.2019.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
Hong CC, Lay JD, Huang JS, Cheng AL, Tang JL, Lin MT, Lai GM, and Chuang SE (2008). Receptor tyrosine kinase AXL is induced by chemotherapy drugs and overexpression of AXL confers drug resistance in acute myeloid leukemia. Cancer letters 268, 314–324. 10.1016/j.canlet.2008.04.017. [DOI] [PubMed] [Google Scholar]
Horn LA, Fousek K, and Palena C (2020). Tumor Plasticity and Resistance to Immunotherapy. Trends in cancer 6, 432–441. 10.1016/j.trecan.2020.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
Hugo W, Zaretsky JM, Sun L, Song C, Moreno BH, Hu-Lieskovan S, Berent-Maoz B, Pang J, Chmielowski B, Cherry G, et al. (2016). Genomic and Transcriptomic Features of Response to Anti-PD-1 Therapy in Metastatic Melanoma. Cell 165, 35–44. 10.1016/j.cell.2016.02.065. [DOI] [PMC free article] [PubMed] [Google Scholar]
Jin G, Wang Z, Wang J, Zhang L, Chen Y, Yuan P, and Liu D (2017). Expression of Axl and its prognostic significance in human breast cancer. Oncology letters 13, 621–628. 10.3892/ol.2016.5524. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kamitani T, Kito K, Nguyen HP, and Yeh ET (1997). Characterization of NEDD8, a developmentally down-regulated ubiquitin-like protein. The Journal of biological chemistry 272, 28557–28562. 10.1074/jbc.272.45.28557. [DOI] [PubMed] [Google Scholar]
Kingsbury TJ, Kim M, and Civin CI (2019). Regulation of cancer stem cell properties by SIX1, a member of the PAX-SIX-EYA-DACH network. Advances in cancer research 141, 1–42. 10.1016/bs.acr.2018.12.001. [DOI] [PubMed] [Google Scholar]
Krueger AB, Drasin DJ, Lea WA, Patrick AN, Patnaik S, Backos DS, Matheson CJ, Hu X, Barnaeva E, Holliday MJ, et al. (2014). Allosteric inhibitors of the Eya2 phosphatase are selective and inhibit Eya2-mediated cell migration. The Journal of biological chemistry 289, 16349–16361. 10.1074/jbc.M114.566729. [DOI] [PMC free article] [PubMed] [Google Scholar]
Langmead B, and Salzberg SL (2012). Fast gapped-read alignment with Bowtie 2. Nature methods 9, 357–359. 10.1038/nmeth.1923. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lauss M, Donia M, Harbst K, Andersen R, Mitra S, Rosengren F, Salim M, Vallon-Christersson J, Torngren T, Kvist A, et al. (2017). Mutational and putative neoantigen load predict clinical benefit of adoptive T cell therapy in melanoma. Nature communications 8, 1738. 10.1038/s41467-017-01460-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lee KL, Kuo YC, Ho YS, and Huang YH (2019). Triple-Negative Breast Cancer: Current Understanding and Future Therapeutic Breakthrough Targeting Cancer Stemness. Cancers 11. 10.3390/cancers11091334. [DOI] [PMC free article] [PubMed] [Google Scholar]
Li X, Oghi KA, Zhang J, Krones A, Bush KT, Glass CK, Nigam SK, Aggarwal AK, Maas R, Rose DW, and Rosenfeld MG (2003). Eya protein phosphatase activity regulates Six1-Dach-Eya transcriptional effects in mammalian organogenesis. Nature 426, 247–254. 10.1038/nature02083. [DOI] [PubMed] [Google Scholar]
Linger RM, Keating AK, Earp HS, and Graham DK (2008). TAM receptor tyrosine kinases: biologic functions, signaling, and potential therapeutic targeting in human cancer. Advances in cancer research 100, 35–83. 10.1016/S0065-230X(08)00002-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
Liu Z, Mar KB, Hanners NW, Perelman SS, Kanchwala M, Xing C, Schoggins JW, and Alto NM (2019). A NIK-SIX signalling axis controls inflammation by targeted silencing of non-canonical NF-kappaB. Nature 568, 249–253. 10.1038/s41586-019-1041-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lu W, and Kang Y (2019). Epithelial-Mesenchymal Plasticity in Cancer Progression and Metastasis. Developmental cell 49, 361–374. 10.1016/j.devcel.2019.04.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
Mak MP, Tong P, Diao L, Cardnell RJ, Gibbons DL, William WN, Skoulidis F, Parra ER, Rodriguez-Canales J, Wistuba II, et al. (2016). A Patient-Derived, Pan-Cancer EMT Signature Identifies Global Molecular Alterations and Immune Target Enrichment Following Epithelial-to-Mesenchymal Transition. Clinical cancer research : an official journal of the American Association for Cancer Research 22, 609–620. 10.1158/1078-0432.CCR-15-0876. [DOI] [PMC free article] [PubMed] [Google Scholar]
May CD, Sphyris N, Evans KW, Werden SJ, Guo W, and Mani SA (2011). Epithelial-mesenchymal transition and cancer stem cells: a dangerously dynamic duo in breast cancer progression. Breast cancer research : BCR 13, 202. 10.1186/bcr2789. [DOI] [PMC free article] [PubMed] [Google Scholar]
Micalizzi DS, Christensen KL, Jedlicka P, Coletta RD, Baron AE, Harrell JC, Horwitz KB, Billheimer D, Heichman KA, Welm AL, et al. (2009). The Six1 homeoprotein induces human mammary carcinoma cells to undergo epithelial-mesenchymal transition and metastasis in mice through increasing TGF-beta signaling. The Journal of clinical investigation 119, 2678–2690. 10.1172/JCI37815. [DOI] [PMC free article] [PubMed] [Google Scholar]
Nelson DE, Randle SJ, and Laman H (2013). Beyond ubiquitination: the atypical functions of Fbxo7 and other F-box proteins. Open biology 3, 130131. 10.1098/rsob.130131. [DOI] [PMC free article] [PubMed] [Google Scholar]
Pandey RN, Rani R, Yeo EJ, Spencer M, Hu S, Lang RA, and Hegde RS (2010). The Eyes Absent phosphatase-transactivator proteins promote proliferation, transformation, migration, and invasion of tumor cells. Oncogene 29, 3715–3722. 10.1038/onc.2010.122. [DOI] [PMC free article] [PubMed] [Google Scholar]
Paolino M, and Penninger JM (2016). The Role of TAM Family Receptors in Immune Cell Function: Implications for Cancer Therapy. Cancers 8. 10.3390/cancers8100097. [DOI] [PMC free article] [PubMed] [Google Scholar]
Park BV, Freeman ZT, Ghasemzadeh A, Chattergoon MA, Rutebemberwa A, Steigner J, Winter ME, Huynh TV, Sebald SM, Lee SJ, et al. (2016). TGFbeta1-Mediated SMAD3 Enhances PD-1 Expression on Antigen-Specific T Cells in Cancer. Cancer discovery 6, 1366–1381. 10.1158/2159-8290.CD-15-1347. [DOI] [PMC free article] [PubMed] [Google Scholar]
Patrick AN, Cabrera JH, Smith AL, Chen XS, Ford HL, and Zhao R (2013). Structure-function analyses of the human SIX1-EYA2 complex reveal insights into metastasis and BOR syndrome. Nature structural & molecular biology 20, 447–453. 10.1038/nsmb.2505. [DOI] [PMC free article] [PubMed] [Google Scholar]
Prager BC, Xie Q, Bao S, and Rich JN (2019). Cancer Stem Cells: The Architects of the Tumor Ecosystem. Cell stem cell 24, 41–53. 10.1016/j.stem.2018.12.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
Rantala JK, Makela R, Aaltola AR, Laasola P, Mpindi JP, Nees M, Saviranta P, and Kallioniemi O (2011). A cell spot microarray method for production of high density siRNA transfection microarrays. BMC genomics 12, 162. 10.1186/1471-2164-12-162. [DOI] [PMC free article] [PubMed] [Google Scholar]
Riaz N, Havel JJ, Makarov V, Desrichard A, Urba WJ, Sims JS, Hodi FS, Martin-Algarra S, Mandal R, Sharfman WH, et al. (2017). Tumor and Microenvironment Evolution during Immunotherapy with Nivolumab. Cell 171, 934–949 e916. 10.1016/j.cell.2017.09.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
Sasaki T, Knyazev PG, Clout NJ, Cheburkin Y, Gohring W, Ullrich A, Timpl R, and Hohenester E (2006). Structural basis for Gas6-Axl signalling. The EMBO journal 25, 80–87. 10.1038/sj.emboj.7600912. [DOI] [PMC free article] [PubMed] [Google Scholar]
Serafini P, Mgebroff S, Noonan K, and Borrello I (2008). Myeloid-derived suppressor cells promote cross-tolerance in B-cell lymphoma by expanding regulatory T cells. Cancer research 68, 5439–5449. 10.1158/0008-5472.CAN-07-6621. [DOI] [PMC free article] [PubMed] [Google Scholar]
Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B, and Ideker T (2003). Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome research 13, 2498–2504. 10.1101/gr.1239303. [DOI] [PMC free article] [PubMed] [Google Scholar]
Sharma P, Hu-Lieskovan S, Wargo JA, and Ribas A (2017). Primary, Adaptive, and Acquired Resistance to Cancer Immunotherapy. Cell 168, 707–723. 10.1016/j.cell.2017.01.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
Song Y, Lai L, Chong Z, He J, Zhang Y, Xue Y, Xie Y, Chen S, Dong P, Chen L, et al. (2017). E3 ligase FBXW7 is critical for RIG-I stabilization during antiviral responses. Nature communications 8, 14654. 10.1038/ncomms14654. [DOI] [PMC free article] [PubMed] [Google Scholar]
Soundararajan R, Fradette JJ, Konen JM, Moulder S, Zhang X, Gibbons DL, Varadarajan N, Wistuba II, Tripathy D, Bernatchez C, et al. (2019). Targeting the Interplay between Epithelial-to-Mesenchymal-Transition and the Immune System for Effective Immunotherapy. Cancers 11. 10.3390/cancers11050714. [DOI] [PMC free article] [PubMed] [Google Scholar]
Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, and Mesirov JP (2005). Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences of the United States of America 102, 15545–15550. 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]
Tan Y, Sangfelt O, and Spruck C (2008). The Fbxw7/hCdc4 tumor suppressor in human cancer. Cancer letters 271, 1–12. 10.1016/j.canlet.2008.04.036. [DOI] [PubMed] [Google Scholar]
Tanaka K, Tokunaga E, Inoue Y, Yamashita N, Saeki H, Okano S, Kitao H, Oki E, Oda Y, and Maehara Y (2016). Impact of Expression of Vimentin and Axl in Breast Cancer. Clinical breast cancer 16, 520–526 e522. 10.1016/j.clbc.2016.06.015. [DOI] [PubMed] [Google Scholar]
Terry S, Abdou A, Engelsen AST, Buart S, Dessen P, Corgnac S, Collares D, Meurice G, Gausdal G, Baud V, et al. (2019). AXL Targeting Overcomes Human Lung Cancer Cell Resistance to NK- and CTL-Mediated Cytotoxicity. Cancer immunology research 7, 1789–1802. 10.1158/2326-6066.CIR-18-0903. [DOI] [PubMed] [Google Scholar]
Tsukita Y, Fujino N, Miyauchi E, Saito R, Fujishima F, Itakura K, Kyogoku Y, Okutomo K, Yamada M, Okazaki T, et al. (2019). Axl kinase drives immune checkpoint and chemokine signalling pathways in lung adenocarcinomas. Molecular cancer 18, 24. 10.1186/s12943-019-0953-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
Vartuli RL, Zhou H, Zhang L, Powers RK, Klarquist J, Rudra P, Vincent MY, Ghosh D, Costello JC, Kedl RM, et al. (2018). Eya3 promotes breast tumor-associated immune suppression via threonine phosphatase-mediated PD-L1 upregulation. The Journal of clinical investigation 128, 2535–2550. 10.1172/JCI96784. [DOI] [PMC free article] [PubMed] [Google Scholar]
Vashisht AA, Yu CC, Sharma T, Ro K, and Wohlschlegel JA (2015). The Association of the Xeroderma Pigmentosum Group D DNA Helicase (XPD) with Transcription Factor IIH Is Regulated by the Cytosolic Iron-Sulfur Cluster Assembly Pathway. The Journal of biological chemistry 290, 14218–14225. 10.1074/jbc.M115.650762. [DOI] [PMC free article] [PubMed] [Google Scholar]
Wei SC, Duffy CR, and Allison JP (2018). Fundamental Mechanisms of Immune Checkpoint Blockade Therapy. Cancer discovery 8, 1069–1086. 10.1158/2159-8290.CD-18-0367. [DOI] [PubMed] [Google Scholar]
Wilson C, Ye X, Pham T, Lin E, Chan S, McNamara E, Neve RM, Belmont L, Koeppen H, Yauch RL, et al. (2014). AXL inhibition sensitizes mesenchymal cancer cells to antimitotic drugs. Cancer research 74, 5878–5890. 10.1158/0008-5472.CAN-14-1009. [DOI] [PubMed] [Google Scholar]
Wu X, Zahari MS, Ma B, Liu R, Renuse S, Sahasrabuddhe NA, Chen L, Chaerkady R, Kim MS, Zhong J, et al. (2015b). Global phosphotyrosine survey in triple-negative breast cancer reveals activation of multiple tyrosine kinase signaling pathways. Oncotarget 6, 29143–29160. 10.18632/oncotarget.5020. [DOI] [PMC free article] [PubMed] [Google Scholar]
Zhang G, Dong Z, Gimple RC, Wolin A, Wu Q, Qiu Z, Wood LM, Shen JZ, Jiang L, Zhao L, et al. (2021). Targeting EYA2 tyrosine phosphatase activity in glioblastoma stem cells induces mitotic catastrophe. The Journal of experimental medicine 218. 10.1084/jem.20202669. [DOI] [PMC free article] [PubMed] [Google Scholar]
Zhou S, Zhao X, Yang Z, Yang R, Chen C, Zhao K, Wang W, Ma Y, Zhang Q, and Wang X (2019). Neddylation inhibition upregulates PD-L1 expression and enhances the efficacy of immune checkpoint blockade in glioblastoma. International journal of cancer 145, 763–774. 10.1002/ijc.32379. [DOI] [PubMed] [Google Scholar]
Zhu C, Wei Y, and Wei X (2019). AXL receptor tyrosine kinase as a promising anti-cancer approach: functions, molecular mechanisms and clinical applications. Molecular cancer 18, 153. 10.1186/s12943-019-1090-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
Zou W, Wolchok JD, and Chen L (2016). PD-L1 (B7-H1) and PD-1 pathway blockade for cancer therapy: Mechanisms, response biomarkers, and combinations. Science translational medicine 8, 328rv324. 10.1126/scitranslmed.aad71 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Info

NIHMS1777914-supplement-Supplemental_Info.pdf^{(3.4MB, pdf)}

Table S1

Table S1, related to Figure 2. FBXO7-interacting proteins identified by mass spectrometry.

NIHMS1777914-supplement-Table_S1.xlsx^{(13.1KB, xlsx)}

Table S2

Table S2, related to Figure 4. List of EYA2 marked peaks identified by ChIP-seq analysis.

NIHMS1777914-supplement-Table_S2.xlsx^{(777KB, xlsx)}

Table S3

Table S3, related to Figure 7. Correlation analysis between FBXO7 expression and the indicated genes/pathways in TCGA database.

NIHMS1777914-supplement-Table_S3.xlsx^{(42.4MB, xlsx)}

Table S4

Table S4, related to Figure 7. Correlation analysis between FBXW7 expression and the indicated genes/pathways in TCGA database.

NIHMS1777914-supplement-Table_S4.xlsx^{(50MB, xlsx)}

Table S5

Table S5, related to Figure 7. Correlation analysis between Fbxw7 alterations and the indicated genes/pathways in TCGA database.

NIHMS1777914-supplement-Table_S5.xlsx^{(1.6MB, xlsx)}

Data Availability Statement

RNA-seq and ChIP-seq data have been deposited at GEO and are publicly available as of the date of publication. Accession numbers are listed in the key resources table. Original western blot images have been deposited at Mendeley and are available from lead contact upon request.
This paper does not report original code. Routine bioinformatics approaches used to analyze the data are described in relevant STAR Methods sections.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit anti-human FBXO7	Aviva Systems Biology	Cat# ARP43128_P050; RRID:AB_2045871
Mouse anti-human EYA2	Abnova	Cat# H00002139-M04; RRID:AB_565716
Rabbit anti-human EYA2	Sigma-Aldrich	Cat# HPA027024; RRID:AB_1848334
Rabbit anti-human SIX1	Cell Signaling	Cat# 12891; RRID:AB_2753209
Rabbit anti-human GAS6	Cell Signaling	Cat# 67202; RRID:AB_2799720
Rabbit anti-human Phospho-AXL^Tyr702	Cell Signaling	Cat# 5724; RRID:AB_10544794
Rabbit anti-human AXL	Cell Signaling	Cat# 8661; RRID:AB_11217435
Mouse anti-human GSK3β	Santa Cruz	Cat# sc-377213; RRID:AB_2892800
Mouse anti-human GAPDH	Santa Cruz	Cat# sc-25778; RRID:AB_10167668
Rabbit anti-human Vimentin	Cell Signaling	Cat# 5741; RRID:AB_10695459
Rabbit anti-human E-cadherin	Cell Signaling	Cat# 3195; RRID:AB_2291471
Rabbit anti-human ZEB1	Cell Signaling	Cat# 3396; RRID:AB_1904164
Rabbit anti-human Phospho-AKT^Thr308	Cell Signaling	Cat# 2965; RRID:AB_2255933
Rabbit anti-human P38	Cell Signaling	Cat# 9212; RRID:AB_330713
Rabbit anti-human Phospho-p38^{Thr180/Tyr182}	Cell Signaling	Cat# 9211; RRID:AB_331641
Rabbit anti-human SOCS1	Cell Signaling	Cat# 3950; RRID:AB_2192983
Mouse anti-human SOCS3	Thermo Fisher Scientific	Cat# MA1-19373; RRID:AB_1087394
Rabbit anti-human CUL1	Thermo Fisher Scientific	Cat# 71-8700; RRID:AB_2534002
Mouse anti-human Ub-K63	Thermo Fisher Scientific	Cat# 14-6077-82; RRID:AB_1257213
Rabbit anti-human Ub-K48	Cell Signaling	Cat# 8081; RRID:AB_10859893
Mouse anti-human Phosphoserine	Sigma-Aldrich	Cat# P5747; RRID:AB_477376
Mouse anti-human c-MYC	Santa Cruz	Cat# sc-42; RRID:AB_2282408
Rabbit anti-human MCL-1	Cell Signaling	Cat# 4572; RRID:AB_2281980
Mouse anti-Flag tag	Sigma-Aldrich	Cat# F3165; RRID:AB_259529
Rabbit anti-Flag tag	Sigma-Aldrich	Cat# F7425; RRID:AB_439687
Rabbit anti-Flag tag	Cell Signaling	Cat# 14793; RRID:AB_2572291
Mouse anti-Myc tag	Cell Signaling	Cat# 2276; RRID:AB_331783
Mouse anti-HA tag	BioLegend	Cat# 901513; RRID:AB_2565335
Rabbit anti-HA tag	Thermo Fisher Scientific	Cat# 71-5500; RRID:AB_2533988
Rabbit anti-human KAP1	Cell Signaling	Cat# 4124; RRID:AB_2209886
Mouse anti-human PE-HLA-A, B, C	BioLegend	Cat# 311405; RRID:AB_314874
Mouse anti-mouse PE-IgG2a isotype	BioLegend	Cat# 400212; RRID:AB_326460
Mouse anti-mouse BV605-CD45.2	BioLegend	Cat# 109841; RRID:AB_2563485
Rat anti-mouse PerCP/Cyanine5.5-CD4	BioLegend	Cat# 100539; RRID:AB_893332
Rat anti-mouse FITC-CD8	BioLegend	Cat# 100706; RRID:AB_312745
Rat anti-mouse BV711-CD25	BioLegend	Cat# 102049; RRID:AB_2564130
Hamster anti-mouse APC-CD3ε	BioLegend	Cat# 152306; RRID:AB_2632669
Rat anti-mouse PE-FOXP3	BioLegend	Cat# 126403; RRID:AB_1089118
Rat anti-mouse BV421-CD335	BioLegend	Cat# 137611; RRID:AB_10915472
Rat anti-mouse PE-IFNγ	BioLegend	Cat# 505857; RRID:AB_315401
Mouse anti-mouse FITC-H-2Kd	BioLegend	Cat# 116605; RRID:AB_313740
Rat anti-mouse CD8a	Thermo Fisher Scientific	Cat# 14-0808-82; RRID:AB_2572861
Rat anti-mouse NK Cell Marker (ANK61)	Santa Cruz	Cat# sc-59340; RRID:AB_784846
Normal rabbit IgG	Santa Cruz	Cat# sc-2027; RRID:AB_737197
Normal mouse IgG	Santa Cruz	Cat# sc-2025; RRID:AB_737182
Alexa Fluor 488 anti-rabbit IgG (H+L)	Thermo Fisher Scientific	Cat# A-21441; RRID:AB_2535859
Alexa Fluor 594 anti-mouse IgG (H+L)	Cell Signaling	Cat# 8890; RRID:AB_2714182
Rabbit TrueBlot anti-rabbit IgG HRP	Rockland	Cat# 18-8816-31; RRID:AB_2610847
Mouse TrueBlot ULTRA anti- mouse IgG HRP	Rockland	Cat# 18-8817-31; RRID:AB_2610850
Chemicals, peptides, and recombinant proteins
3x FLAG Peptide	Sigma-Aldrich	Cat# F4799
EYA2 inhibitor MLS000544460	Sigma-Aldrich	Cat# 531085
GSK3β inhibitor XIII	Cayman	Cat# 21190
D-Luciferin	Xenogen	Cat# XR-1001
Human TruStain FcX	BioLegend	Cat# 422301
7-AAD Viability Staining Solution	BioLegend	Cat# 420403
Cell Activation Cocktail with Brefeldin A	BioLegend	Cat# 423303
Cremophor EL	Millipore	Cat# 238470
Protein G agarose	Millipore	Cat# 16-266
Streptavidin beads	Cell Signaling	Cat# 3419
Cell Staining Buffer	BioLegend	Cat# 420201
Intracellular Staining Perm Wash Buffer	BioLegend	Cat# 421002
UBCH5A	R&D Systems	Cat# E2-616-100
UBE2R1/CDC34	R&D Systems	Cat# E2-610
SCF^FBXO7	R&D Systems	Cat# E3-526
SKP1/FBXO7 Complex	R&D Systems	Cat# E3-525
GSK3β	Sigma-Aldrich	Cat# G4296
SCF^FBXW7	Sigma-Aldrich	Cat# 23-030
Biotin-DSLNHSPGQSGFLSY	GenScript	N/A
Biotin-DSLNH(pSer)PGQ(pSer)GFLSY	GenScript	N/A
Critical commercial assays
Zombie UV Fixable Viability Kit	BioLegend	Cat# 423107
Tumor Dissociation Kit	Miltenyi Biotec	Cat# 130-096-730
Western Chemiluminescent HRP Substrate	Millipore	Cat# WBKLS0500
PURExpress® In Vitro Protein Synthesis Kit	New England Biolabs	Cat# E6800S
Ubiquitin Conjugation Initiation Kit	R&D Systems	Cat# K-995
QuantTag Biotin Quantitation Kit	Vector Laboratories	Cat# BDK-2000
Deposited data
RNA-seq, ChIP-seq	This study	GSE155979
RNA-seq	This study	GSE135306
Experimental models: Cell lines
Human: MDA-MB-231	ATCC	Cat# HTB-26
Human: BT-549	ATCC	Cat# HTB-122
Human: BT-20	ATCC	Cat# HTB-19
Human: MCF7	ATCC	Cat# HTB-22
Human: GSC 738	This study	N/A
Human: GSC 2907	This study	N/A
Mouse: 4T1-luc	ATCC	Cat# CRL-2539-LUC2
Human: MDA-MB-231-luc	This study	N/A
Human: HeLa	ATCC	Cat# CCL-2
Human: HEK293T	ATCC	Cat# CRL-11268
Human: DLD-1 WT and Fbxw7 KO	Dr. Bert Vogelstein	N/A
Human: HCT116 WT and Fbxw7 KO	Dr. Bert Vogelstein	N/A
Experimental models: Organisms/strains
Mouse: NOD.Cg-Prkdc^scid Il2rg^tm1Wjl/SzJ	Jackson Laboratory	Cat# 005557
Mouse: BALB/cJ	Jackson Laboratory	Cat# 000651
Oligonucleotides
Sequences provided in STAR Methods	This paper	N/A
Recombinant DNA
pCMV-Myc-FBXO7	This paper	N/A
pCMV-Myc-ΔF-FBXO7	This paper	N/A
pCMV-Myc-EYA2	This paper	N/A
pFlag-CMV2-FBXO7	This paper	N/A
pFlag-CMV2-ΔF-FBXO7	This paper	N/A
pFlag-CMV2-EYA2	This paper	N/A
pFlag-CMV2-EYA2-2A	This paper	N/A
pFlag-CMV2-FBXL5	This paper	N/A
pFlag-CMV2-FBXO27	This paper	N/A
pFlag-CMV2-SKP2	This paper	N/A
pFlag-CMV2-β-TRCP	This paper	N/A
pFlag-CMV2-FBXW7	This paper	N/A
pFlag-CMV2-FBXO44	This paper	N/A
pFlag-CMV2-CUL1	This paper	N/A
pcDNA3.1-HA-EYA2	This paper	N/A
pcDNA3.1-HA-SIX1	This paper	N/A
pcDNA3.1-HA-Tomm20	This paper	N/A
pcDNA3.1-HA-EYA2-AD	This paper	N/A
pcDNA3.1-HA-EYA2-ED	This paper	N/A
pcDNA3.1-GST-FBXW7	This paper	N/A
HA-Ubiquitin	(Kamitani et al., 1997); Addgene	Cat# 18712
Flag- EYA2(D274N)	(Zhang et al., 2021)	N/A
Flag- EYA2(A532R)	(Zhang et al., 2021)	N/A
Software and algorithms
ELDA analysis	Walter and Eliza Hall Institute	http://bioinf.wehi.edu.au/software/elda
ImageJ	NIH	https://imagej.nih.gov/ij/
FlowJo	BD	https://www.flowjo.com/about/company
STAR aligner	(Dobin et al., 2013)	https://code.google.com/p/rna-star/)
GSEA	(Subramanian et al., 2005)	https://www.gsea-msigdb.org/gsea/index.jsp
Bowtie 2	(Langmead and Salzberg, 2012)	http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
Cytoscape v3.8.0	(Shannon et al., 2003)	https://cytoscape.org/

Open in a new tab

[R1] Aguilera TA, and Giaccia AJ (2017). Molecular Pathways: Oncologic Pathways and Their Role in T-cell Exclusion and Immune Evasion-A New Role for the AXL Receptor Tyrosine Kinase. Clinical cancer research : an official journal of the American Association for Cancer Research 23, 2928–2933. 10.1158/1078-0432.CCR-17-0189. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R2] Aguilera TA, Rafat M, Castellini L, Shehade H, Kariolis MS, Hui AB, Stehr H, von Eyben R, Jiang D, Ellies LG, et al. (2016). Reprogramming the immunological microenvironment through radiation and targeting Axl. Nature communications 7, 13898. 10.1038/ncomms13898. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R3] Antony J, and Huang RY (2017). AXL-Driven EMT State as a Targetable Conduit in Cancer. Cancer research 77, 3725–3732. 10.1158/0008-5472.CAN-17-0392. [DOI] [PubMed] [Google Scholar]

[R4] Bertrand F, Montfort A, Marcheteau E, Imbert C, Gilhodes J, Filleron T, Rochaix P, Andrieu-Abadie N, Levade T, Meyer N, et al. (2017). TNFalpha blockade overcomes resistance to anti-PD-1 in experimental melanoma. Nature communications 8, 2256. 10.1038/s41467-017-02358-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R5] Blevins MA, Towers CG, Patrick AN, Zhao R, and Ford HL (2015). The SIX1-EYA transcriptional complex as a therapeutic target in cancer. Expert opinion on therapeutic targets 19, 213–225. 10.1517/14728222.2014.978860. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R6] Brabletz T, Kalluri R, Nieto MA, and Weinberg RA (2018). EMT in cancer. Nature reviews. Cancer 18, 128–134. 10.1038/nrc.2017.118. [DOI] [PubMed] [Google Scholar]

[R7] Braunger J, Schleithoff L, Schulz AS, Kessler H, Lammers R, Ullrich A, Bartram CR, and Janssen JW (1997). Intracellular signaling of the Ufo/Axl receptor tyrosine kinase is mediated mainly by a multi-substrate docking-site. Oncogene 14, 2619–2631. 10.1038/sj.onc.1201123. [DOI] [PubMed] [Google Scholar]

[R8] Brooks MD, Burness ML, and Wicha MS (2015). Therapeutic Implications of Cellular Heterogeneity and Plasticity in Breast Cancer. Cell stem cell 17, 260–271. 10.1016/j.stem.2015.08.014. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R9] Chen L, Gibbons DL, Goswami S, Cortez MA, Ahn YH, Byers LA, Zhang X, Yi X, Dwyer D, Lin W, et al. (2014). Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nature communications 5, 5241. 10.1038/ncomms6241. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R10] Colavito SA (2020). AXL as a Target in Breast Cancer Therapy. Journal of oncology 2020, 5291952. 10.1155/2020/5291952. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R11] D'Alfonso TM, Hannah J, Chen Z, Liu Y, Zhou P, and Shin SJ (2014). Axl receptor tyrosine kinase expression in breast cancer. Journal of clinical pathology 67, 690–696. 10.1136/jclinpath-2013-202161. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R12] David JM, Dominguez C, McCampbell KK, Gulley JL, Schlom J, and Palena C (2017). A novel bifunctional anti-PD-L1/TGF-beta Trap fusion protein (M7824) efficiently reverts mesenchymalization of human lung cancer cells. Oncoimmunology 6, e1349589. 10.1080/2162402X.2017.1349589. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R13] Davis RJ, Welcker M, and Clurman BE (2014). Tumor suppression by the Fbw7 ubiquitin ligase: mechanisms and opportunities. Cancer cell 26, 455–464. 10.1016/j.ccell.2014.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R14] Diaz VM, and de Herreros AG (2016). F-box proteins: Keeping the epithelial-to-mesenchymal transition (EMT) in check. Seminars in cancer biology 36, 71–79. 10.1016/j.semcancer.2015.10.003. [DOI] [PubMed] [Google Scholar]

[R15] Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, and Gingeras TR (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21. 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R16] Dongre A, Rashidian M, Reinhardt F, Bagnato A, Keckesova Z, Ploegh HL, and Weinberg RA (2017). Epithelial-to-Mesenchymal Transition Contributes to Immunosuppression in Breast Carcinomas. Cancer research 77, 3982–3989. 10.1158/0008-5472.CAN-16-3292. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R17] Farabaugh SM, Micalizzi DS, Jedlicka P, Zhao R, and Ford HL (2012). EYA2 is required to mediate the pro-metastatic funxctions of SIX1 via inducxtion of TGF-b signaling, epithelial-mesenchymal transition, and cancer stem cell properties. Oncogene 31, 552–562. 10.1038/onc.2011.259. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R18] Fridell YW, Jin Y, Quilliam LA, Burchert A, McCloskey P, Spizz G, Varnum B, Der C, and Liu ET (1996). Differential activation of the Ras/extracellular-signal-regulated protein kinase pathway is responsible for the biological consequences induced by the Axl receptor tyrosine kinase. Molecular and cellular biology 16, 135–145. 10.1128/MCB.16.1.135. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R19] Geis-Asteggiante L, Belew AT, Clements VK, Edwards NJ, Ostrand-Rosenberg S, El-Sayed NM, and Fenselau C (2018). Differential Content of Proteins, mRNAs, and miRNAs Suggests that MDSC and Their Exosomes May Mediate Distinct Immune Suppressive Functions. Journal of proteome research 17, 486–498. 10.1021/acs.jproteome.7b00646. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R20] Gjerdrum C, Tiron C, Hoiby T, Stefansson I, Haugen H, Sandal T, Collett K, Li S, McCormack E, Gjertsen BT, et al. (2010). Axl is an essential epithelial-to-mesenchymal transition-induced regulator of breast cancer metastasis and patient survival. Proceedings of the National Academy of Sciences of the United States of America 107, 1124–1129. 10.1073/pnas.0909333107. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R21] Goyette MA, Duhamel S, Aubert L, Pelletier A, Savage P, Thibault MP, Johnson RM, Carmeliet P, Basik M, Gaboury L, et al. (2018). The Receptor Tyrosine Kinase AXL Is Required at Multiple Steps of the Metastatic Cascade during HER2-Positive Breast Cancer Progression. Cell reports 23, 1476–1490. 10.1016/j.celrep.2018.04.019. [DOI] [PubMed] [Google Scholar]

[R22] Gstalder C, Liu D, Miao D, Lutterbach B, DeVine AL, Lin C, Shettigar M, Pancholi P, Buchbinder EI, Carter SL, et al. (2020). Inactivation of Fbxw7 impairs dsRNA sensing and confers resistance to PD-1 blockade. Cancer discovery. 10.1158/2159-8290.CD-19-1416. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R23] Hanson EM, Clements VK, Sinha P, Ilkovitch D, and Ostrand-Rosenberg S (2009). Myeloid-derived suppressor cells down-regulate L-selectin expression on CD4+ and CD8+ T cells. J Immunol 183, 937–944. 10.4049/jimmunol.0804253. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R24] Harel M, Ortenberg R, Varanasi SK, Mangalhara KC, Mardamshina M, Markovits E, Baruch EN, Tripple V, Arama-Chayoth M, Greenberg E, et al. (2019). Proteomics of Melanoma Response to Immunotherapy Reveals Mitochondrial Dependence. Cell 179, 236–250 e218. 10.1016/j.cell.2019.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R25] Hong CC, Lay JD, Huang JS, Cheng AL, Tang JL, Lin MT, Lai GM, and Chuang SE (2008). Receptor tyrosine kinase AXL is induced by chemotherapy drugs and overexpression of AXL confers drug resistance in acute myeloid leukemia. Cancer letters 268, 314–324. 10.1016/j.canlet.2008.04.017. [DOI] [PubMed] [Google Scholar]

[R26] Horn LA, Fousek K, and Palena C (2020). Tumor Plasticity and Resistance to Immunotherapy. Trends in cancer 6, 432–441. 10.1016/j.trecan.2020.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R27] Hugo W, Zaretsky JM, Sun L, Song C, Moreno BH, Hu-Lieskovan S, Berent-Maoz B, Pang J, Chmielowski B, Cherry G, et al. (2016). Genomic and Transcriptomic Features of Response to Anti-PD-1 Therapy in Metastatic Melanoma. Cell 165, 35–44. 10.1016/j.cell.2016.02.065. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R28] Jin G, Wang Z, Wang J, Zhang L, Chen Y, Yuan P, and Liu D (2017). Expression of Axl and its prognostic significance in human breast cancer. Oncology letters 13, 621–628. 10.3892/ol.2016.5524. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R29] Kamitani T, Kito K, Nguyen HP, and Yeh ET (1997). Characterization of NEDD8, a developmentally down-regulated ubiquitin-like protein. The Journal of biological chemistry 272, 28557–28562. 10.1074/jbc.272.45.28557. [DOI] [PubMed] [Google Scholar]

[R30] Kingsbury TJ, Kim M, and Civin CI (2019). Regulation of cancer stem cell properties by SIX1, a member of the PAX-SIX-EYA-DACH network. Advances in cancer research 141, 1–42. 10.1016/bs.acr.2018.12.001. [DOI] [PubMed] [Google Scholar]

[R31] Krueger AB, Drasin DJ, Lea WA, Patrick AN, Patnaik S, Backos DS, Matheson CJ, Hu X, Barnaeva E, Holliday MJ, et al. (2014). Allosteric inhibitors of the Eya2 phosphatase are selective and inhibit Eya2-mediated cell migration. The Journal of biological chemistry 289, 16349–16361. 10.1074/jbc.M114.566729. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R32] Langmead B, and Salzberg SL (2012). Fast gapped-read alignment with Bowtie 2. Nature methods 9, 357–359. 10.1038/nmeth.1923. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R33] Lauss M, Donia M, Harbst K, Andersen R, Mitra S, Rosengren F, Salim M, Vallon-Christersson J, Torngren T, Kvist A, et al. (2017). Mutational and putative neoantigen load predict clinical benefit of adoptive T cell therapy in melanoma. Nature communications 8, 1738. 10.1038/s41467-017-01460-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R34] Lee KL, Kuo YC, Ho YS, and Huang YH (2019). Triple-Negative Breast Cancer: Current Understanding and Future Therapeutic Breakthrough Targeting Cancer Stemness. Cancers 11. 10.3390/cancers11091334. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R35] Li X, Oghi KA, Zhang J, Krones A, Bush KT, Glass CK, Nigam SK, Aggarwal AK, Maas R, Rose DW, and Rosenfeld MG (2003). Eya protein phosphatase activity regulates Six1-Dach-Eya transcriptional effects in mammalian organogenesis. Nature 426, 247–254. 10.1038/nature02083. [DOI] [PubMed] [Google Scholar]

[R36] Linger RM, Keating AK, Earp HS, and Graham DK (2008). TAM receptor tyrosine kinases: biologic functions, signaling, and potential therapeutic targeting in human cancer. Advances in cancer research 100, 35–83. 10.1016/S0065-230X(08)00002-X. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R37] Liu Z, Mar KB, Hanners NW, Perelman SS, Kanchwala M, Xing C, Schoggins JW, and Alto NM (2019). A NIK-SIX signalling axis controls inflammation by targeted silencing of non-canonical NF-kappaB. Nature 568, 249–253. 10.1038/s41586-019-1041-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R38] Lu W, and Kang Y (2019). Epithelial-Mesenchymal Plasticity in Cancer Progression and Metastasis. Developmental cell 49, 361–374. 10.1016/j.devcel.2019.04.010. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R39] Mak MP, Tong P, Diao L, Cardnell RJ, Gibbons DL, William WN, Skoulidis F, Parra ER, Rodriguez-Canales J, Wistuba II, et al. (2016). A Patient-Derived, Pan-Cancer EMT Signature Identifies Global Molecular Alterations and Immune Target Enrichment Following Epithelial-to-Mesenchymal Transition. Clinical cancer research : an official journal of the American Association for Cancer Research 22, 609–620. 10.1158/1078-0432.CCR-15-0876. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R40] May CD, Sphyris N, Evans KW, Werden SJ, Guo W, and Mani SA (2011). Epithelial-mesenchymal transition and cancer stem cells: a dangerously dynamic duo in breast cancer progression. Breast cancer research : BCR 13, 202. 10.1186/bcr2789. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R41] Micalizzi DS, Christensen KL, Jedlicka P, Coletta RD, Baron AE, Harrell JC, Horwitz KB, Billheimer D, Heichman KA, Welm AL, et al. (2009). The Six1 homeoprotein induces human mammary carcinoma cells to undergo epithelial-mesenchymal transition and metastasis in mice through increasing TGF-beta signaling. The Journal of clinical investigation 119, 2678–2690. 10.1172/JCI37815. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R42] Nelson DE, Randle SJ, and Laman H (2013). Beyond ubiquitination: the atypical functions of Fbxo7 and other F-box proteins. Open biology 3, 130131. 10.1098/rsob.130131. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R43] Pandey RN, Rani R, Yeo EJ, Spencer M, Hu S, Lang RA, and Hegde RS (2010). The Eyes Absent phosphatase-transactivator proteins promote proliferation, transformation, migration, and invasion of tumor cells. Oncogene 29, 3715–3722. 10.1038/onc.2010.122. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R44] Paolino M, and Penninger JM (2016). The Role of TAM Family Receptors in Immune Cell Function: Implications for Cancer Therapy. Cancers 8. 10.3390/cancers8100097. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R45] Park BV, Freeman ZT, Ghasemzadeh A, Chattergoon MA, Rutebemberwa A, Steigner J, Winter ME, Huynh TV, Sebald SM, Lee SJ, et al. (2016). TGFbeta1-Mediated SMAD3 Enhances PD-1 Expression on Antigen-Specific T Cells in Cancer. Cancer discovery 6, 1366–1381. 10.1158/2159-8290.CD-15-1347. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R46] Patrick AN, Cabrera JH, Smith AL, Chen XS, Ford HL, and Zhao R (2013). Structure-function analyses of the human SIX1-EYA2 complex reveal insights into metastasis and BOR syndrome. Nature structural & molecular biology 20, 447–453. 10.1038/nsmb.2505. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R47] Prager BC, Xie Q, Bao S, and Rich JN (2019). Cancer Stem Cells: The Architects of the Tumor Ecosystem. Cell stem cell 24, 41–53. 10.1016/j.stem.2018.12.009. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R48] Rantala JK, Makela R, Aaltola AR, Laasola P, Mpindi JP, Nees M, Saviranta P, and Kallioniemi O (2011). A cell spot microarray method for production of high density siRNA transfection microarrays. BMC genomics 12, 162. 10.1186/1471-2164-12-162. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R49] Riaz N, Havel JJ, Makarov V, Desrichard A, Urba WJ, Sims JS, Hodi FS, Martin-Algarra S, Mandal R, Sharfman WH, et al. (2017). Tumor and Microenvironment Evolution during Immunotherapy with Nivolumab. Cell 171, 934–949 e916. 10.1016/j.cell.2017.09.028. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R50] Sasaki T, Knyazev PG, Clout NJ, Cheburkin Y, Gohring W, Ullrich A, Timpl R, and Hohenester E (2006). Structural basis for Gas6-Axl signalling. The EMBO journal 25, 80–87. 10.1038/sj.emboj.7600912. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R51] Serafini P, Mgebroff S, Noonan K, and Borrello I (2008). Myeloid-derived suppressor cells promote cross-tolerance in B-cell lymphoma by expanding regulatory T cells. Cancer research 68, 5439–5449. 10.1158/0008-5472.CAN-07-6621. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R52] Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B, and Ideker T (2003). Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome research 13, 2498–2504. 10.1101/gr.1239303. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R53] Sharma P, Hu-Lieskovan S, Wargo JA, and Ribas A (2017). Primary, Adaptive, and Acquired Resistance to Cancer Immunotherapy. Cell 168, 707–723. 10.1016/j.cell.2017.01.017. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R54] Song Y, Lai L, Chong Z, He J, Zhang Y, Xue Y, Xie Y, Chen S, Dong P, Chen L, et al. (2017). E3 ligase FBXW7 is critical for RIG-I stabilization during antiviral responses. Nature communications 8, 14654. 10.1038/ncomms14654. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R55] Soundararajan R, Fradette JJ, Konen JM, Moulder S, Zhang X, Gibbons DL, Varadarajan N, Wistuba II, Tripathy D, Bernatchez C, et al. (2019). Targeting the Interplay between Epithelial-to-Mesenchymal-Transition and the Immune System for Effective Immunotherapy. Cancers 11. 10.3390/cancers11050714. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R56] Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, and Mesirov JP (2005). Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences of the United States of America 102, 15545–15550. 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R57] Tan Y, Sangfelt O, and Spruck C (2008). The Fbxw7/hCdc4 tumor suppressor in human cancer. Cancer letters 271, 1–12. 10.1016/j.canlet.2008.04.036. [DOI] [PubMed] [Google Scholar]

[R58] Tanaka K, Tokunaga E, Inoue Y, Yamashita N, Saeki H, Okano S, Kitao H, Oki E, Oda Y, and Maehara Y (2016). Impact of Expression of Vimentin and Axl in Breast Cancer. Clinical breast cancer 16, 520–526 e522. 10.1016/j.clbc.2016.06.015. [DOI] [PubMed] [Google Scholar]

[R59] Terry S, Abdou A, Engelsen AST, Buart S, Dessen P, Corgnac S, Collares D, Meurice G, Gausdal G, Baud V, et al. (2019). AXL Targeting Overcomes Human Lung Cancer Cell Resistance to NK- and CTL-Mediated Cytotoxicity. Cancer immunology research 7, 1789–1802. 10.1158/2326-6066.CIR-18-0903. [DOI] [PubMed] [Google Scholar]

[R60] Tsukita Y, Fujino N, Miyauchi E, Saito R, Fujishima F, Itakura K, Kyogoku Y, Okutomo K, Yamada M, Okazaki T, et al. (2019). Axl kinase drives immune checkpoint and chemokine signalling pathways in lung adenocarcinomas. Molecular cancer 18, 24. 10.1186/s12943-019-0953-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R61] Vartuli RL, Zhou H, Zhang L, Powers RK, Klarquist J, Rudra P, Vincent MY, Ghosh D, Costello JC, Kedl RM, et al. (2018). Eya3 promotes breast tumor-associated immune suppression via threonine phosphatase-mediated PD-L1 upregulation. The Journal of clinical investigation 128, 2535–2550. 10.1172/JCI96784. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R62] Vashisht AA, Yu CC, Sharma T, Ro K, and Wohlschlegel JA (2015). The Association of the Xeroderma Pigmentosum Group D DNA Helicase (XPD) with Transcription Factor IIH Is Regulated by the Cytosolic Iron-Sulfur Cluster Assembly Pathway. The Journal of biological chemistry 290, 14218–14225. 10.1074/jbc.M115.650762. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R63] Wei SC, Duffy CR, and Allison JP (2018). Fundamental Mechanisms of Immune Checkpoint Blockade Therapy. Cancer discovery 8, 1069–1086. 10.1158/2159-8290.CD-18-0367. [DOI] [PubMed] [Google Scholar]

[R64] Wilson C, Ye X, Pham T, Lin E, Chan S, McNamara E, Neve RM, Belmont L, Koeppen H, Yauch RL, et al. (2014). AXL inhibition sensitizes mesenchymal cancer cells to antimitotic drugs. Cancer research 74, 5878–5890. 10.1158/0008-5472.CAN-14-1009. [DOI] [PubMed] [Google Scholar]

[R65] Wu X, Zahari MS, Ma B, Liu R, Renuse S, Sahasrabuddhe NA, Chen L, Chaerkady R, Kim MS, Zhong J, et al. (2015b). Global phosphotyrosine survey in triple-negative breast cancer reveals activation of multiple tyrosine kinase signaling pathways. Oncotarget 6, 29143–29160. 10.18632/oncotarget.5020. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R66] Zhang G, Dong Z, Gimple RC, Wolin A, Wu Q, Qiu Z, Wood LM, Shen JZ, Jiang L, Zhao L, et al. (2021). Targeting EYA2 tyrosine phosphatase activity in glioblastoma stem cells induces mitotic catastrophe. The Journal of experimental medicine 218. 10.1084/jem.20202669. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R67] Zhou S, Zhao X, Yang Z, Yang R, Chen C, Zhao K, Wang W, Ma Y, Zhang Q, and Wang X (2019). Neddylation inhibition upregulates PD-L1 expression and enhances the efficacy of immune checkpoint blockade in glioblastoma. International journal of cancer 145, 763–774. 10.1002/ijc.32379. [DOI] [PubMed] [Google Scholar]

[R68] Zhu C, Wei Y, and Wei X (2019). AXL receptor tyrosine kinase as a promising anti-cancer approach: functions, molecular mechanisms and clinical applications. Molecular cancer 18, 153. 10.1186/s12943-019-1090-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R69] Zou W, Wolchok JD, and Chen L (2016). PD-L1 (B7-H1) and PD-1 pathway blockade for cancer therapy: Mechanisms, response biomarkers, and combinations. Science translational medicine 8, 328rv324. 10.1126/scitranslmed.aad71 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

This article has been retracted.

A FBXO7/EYA2-SCFFBXW7 Axis Promotes AXL-mediated Maintenance of Mesenchymal and Immune Evasion Phenotypes of Cancer Cells

Jia Z Shen

Zhixin Qiu

Qiulian Wu

Guoxin Zhang

Rebecca Harris

Dahui Sun

Juha Rantala

William D Barshop

Linjie Zhao

Deguan Lv

Kwang-Ai Won

James Wohlschlegel

Olle Sangfelt

Heike Laman

Jeremy N Rich

Charles Spruck