Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2022 Mar 19;12(4):97. doi: 10.1007/s13205-021-03018-w

KDM5A regulates the growth and gefitinib drug resistance against human lung adenocarcinoma cells

Hong Wu 1, Lidong Xu 2, Xun Hu 1,✉
PMCID: PMC8934368  PMID: 35371900

Abstract

KDM5A, a histone demethylase, has been shown to be involved in several cancer-related process. The present study was undertaken to explore the role and therapeutic potential of KDM5A in human lung adenocarcinoma. The results of the qRT-PCR, immunohistochemistry, and western blotting showed significant upregulation of KDM5A expression in lung adenocarcinoma tissues and cell lines. The RNA interference-mediated silencing of KDM5A in lung adenocarcinoma cell line SK-LU-1 led to significant inhibition of in vitro cell proliferation via induction of apoptosis. The induction of apoptosis in SK-LU-1 lung adenocarcinoma cells was concomitant with upregulation of Bax and downregulation of Bcl-2 expression. In contrary, overexpression of KDM5A prompted the proliferation of SK-LU-1 lung adenocarcinoma cells. Interestingly, the SK-LU-1 cancer cells showed remarkably higher sensitivity to gefitinib under KDM5A transcriptional knockdown. Taken together, KDM5A is significantly upregulated in human lung adenocarcinoma and regulates the proliferation of the lung adenocarcinoma cells. These findings suggest potential of KDM5A to act as a therapeutic target for the management of human lung adenocarcinoma.

Keywords: Lung adenocarcinoma, Histone demethylase, KDM5A, Chemo-sensitivity, Proliferation, Apoptosis

Introduction

Ranked as the most lethal human cancer, lung cancer has two broad histological sub-categories: non-small cell lung carcinoma and small cell lung carcinoma (Qiu et al. 2018; Denisenko et al. 2018). The non-small cell lung carcinoma is the most dominant type of lung cancer and accounts for nearly 85% of total lung cancer cases throughout the globe (Herbst et al. 2018). Lung adenocarcinoma is categorized with the non-small cell lung carcinoma, arising from the mucosa glandular cells, and is seen to comprise about 40% of all lung cancer cases (Qiu et al. 2018). The most common risk factor for lung adenocarcinoma is tobacco smoking. However, it is the most commonly diagnosed lung cancer in non-smokers also (Kinoshita et al. 2017). Prognosis of lung adenocarcinoma is extremely difficult, and the disease is often detected at advanced stages and is most commonly accompanied with distant metastasis with a marginally lower average 5-year survival rate of around 5% (Jao et al. 2018; Wang et al. 2017). Considering this, it becomes essential to study the pathogenesis of lung adenocarcinoma at molecular level to identify various therapeutic targets which might prove helpful in its effective management. It has been reported that the study of different epigenomic molecular transitions can be used for discriminating the normal and abnormal cellular states, and moreover, the analyses of molecular patterns of DNA methylation, acetylation, and histone modifications can help in understanding the molecular alterations dictating the malignant behavior of eukaryotic cells (Dietel et al. 2016; Postmus et al. 2017). Recently, LaFave et al. showed that lung adenocarcinoma progression is marked by a continuum of heterogeneous epigenomic states. Regulatory networks that maintain functional, differentiated cell states are often dysregulated in tumor development. The identification of these regulatory networks may prove beneficial in the development of biomarkers and therapeutic targets for the management of the lung adenocarcinoma (LaFave et al. 2020). Consistently, the present study explored the functional role of a lysine-specific histone demethylase, KDM5A in regulating the growth and proliferation of human adenocarcinoma. KDM5A has been implicated to act as a vital therapeutic target for its role in promoting the proliferation of cancer cells including breast, stomach, and lung cancer cells, and is known to regulate the drug resistance of human tumors (Yang et al. 2019). The current study revealed significant upregulation of KDM5A in lung adenocarcinoma cells and tissues. Silencing of KDM5A at transcriptional level restrained the growth and proliferation of cancer cells by inducing apoptosis. Besides, the KDM5A knockdown in adenocarcinoma cells enhanced their chemo-sensitivity toward gefitinib. Together, the results indicated that KDM5A has tumor promotive role and regulates the drug resistance of adenocarcinoma cells.

Materials and methods

Human tissues

A total of 50 lung adenocarcinoma tissue samples along with normal adjacent tissue samples were obtained from Jiaxing Second Hospital, Jiaxing, Zhejiang, China after surgical resection. The patients were informed in advance and samples were collected only after proper consent signing and written patient undertaking. Tissue specimens were stored frozen in liquid nitrogen till experimental use. The study was approved by the Institutional Ethics Committee.

Cell lines and culturing

Three human lung adenocarcinoma cell lines (Hs 618.T, Calu-3, and SK-LU-1) and a normal bronchial epithelial cell line (MRC-5) were purchased from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. The cell lines were propagated using RPMI-1640 Medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, USA), 100 μg/ml streptomycin, and 100 U/ml penicillin. The cells were maintained at 37 °C in a humidified CO2 incubator with 5% CO2.

Transfection

The SK-LU-1 cancer cells were grown up to 70% confluence and transfected with suitable transfection constructs using lipofectamine 3000 (Thermo Fisher Scientific, USA) according to the manufacturer’s guidelines. Knockdown of KDM5A was carried out by transfecting the cancer cells with si-KDM5A RNA interference oligonucleotides and the si-NC-transfected cells served as negative control. Overexpression of KDM5A was performed by cloning KDM5A into pcDNA6.2 overexpression vector and subsequent transfection of pcDNA6.2-KDM5A into SK-LU-1 cancer cells. The vector alone transfected cells were used as negative control. The untransfected cells (transfection reagent added without the addition of constructs) were also used as control to overrule the possible effects of the transfection reagent on cell viability. The si-KDM5A along with negative silencing control, si-NC were obtained from RiboBio Biotech., China. The target sequences are as follows: si-KDM5A 5′–AAGAGCUACAACAGGCUCGGU–3′ (sense) and si-NC 5′–UUCUCCGAACGUGUCACGUTT–3′ (sense).

RNA isolation and qRT-PCR

Total RNA was isolated from the tissue samples and cell lines using the RNeasy Mini Kit (Qiagen, Valencia, CA). The RNA was reverse transcribed to cDNA with the help of QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA) as per the manufacturer’s instructions. The qRT-PCR analysis of KDM5A mRNA levels was performed using the SYBR Green qRT-PCR master mix (TaKaRa, Otsu, Shiga, Japan). Human GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as an internal control in the qRT-PCR study. The relative expression levels of KDM5A were determined with reference to GAPDH and quantified as 2−(Ct KDM5A−Ct GAPDH). The primer sequences used were: GADPH; forward primer 5′–GTCTCCTCTGACTTCAACAGCG–3′ and reverse primer 5′–ACCACCCTGTTGCTGTAGCCAA–3′ and KDM5A; forward primer 5′–CCGTCTTTGAGCCGAGTTG–3′ and reverse primer 5′–GACTCTTGGAGTGAAACGA–3′.

Western blotting

Total proteins were extracted from cell lines with the help of RIPA lysis buffer and then resolved by 8–10% SDS-PAGE gels. The PAGE gels were blotted to 0.22 μm PVDF membranes (Millipore, USA). 5% skimmed milk powder was used to block the membranes followed by their overnight incubation with specific primary antibodies [Bax (CAT. NO.sc-6236) and Bcl-2 (Cat No. sc-509) purchased from Santa Cruz Biotechnology, Inc. Dallas, TX, USA and KMD5A (Cat No. MA5-34682) from ThermoFisher Scientific, Waltham, Massachusetts, United States] overnight at 4 °C (dilution1:1000), followed by incubation with incubated with horseradish peroxidase-conjugated secondary antibody (1:1, 000; Cat. No. sc-516087, Santa Cruz Biotechnology, Inc.) for 1 h at 4 °C. Finally, ECL detection system (Bio-Rad, USA) was used to detect the protein bands. Human β-actin was used as a reference protein.

Immunohistochemical staining

The cancerous and normal adjacent tissue samples were fixed with 4% paraformaldehyde, dehydrated using alcohol grades, and then embed in paraffin. The samples were sectioned using ultra-microtome into consecutive sections of 4-μm thickness. The sections were incubated with KDM5A antibody (ThermoFisher Scientific; dilution 1:1000) for immunohistochemical staining assay using DAKO EnVision System (Dako Diagnostics, Switzerland) following the manufacturer’s instructions.

MTT and Edu assays

Cell viability was determined 3-(4,5-cimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, Sigma-Aldrich) assay. The transfected SK-LU-1 cells were plated at a density of 1 × 104 cells/well suspended in 100 μL culture medium in 96-well plates and incubated at 37 °C in a 5% CO2 incubator overnight to allow for a proper adhesion to the bottom surface of the plate. Next morning, fresh medium (or fresh medium containing 20 µM gefitinib in case of drug sensitivity assay) was added to the cells and the cell samples were collected at 0, 24, 48, and 72 h time intervals. After completion of the time point, MTT dye was added to the wells at 2.5 mg/mL MTT dye for 3–4 h. The formation of formazan crystals that had formed in the living cells was dissolved with dimethyl sulfoxide (DMSO). The optical density of each sample was read with a microplate reader at 570 nm. The experiment was performed using three replicates.

The stably transfected SK-LU-1 cancer cells were plated into 12-well plates at a density of 2 × 105 cells/well and incubated at 37 °C. The proliferation of cancer cells was then evaluated at 48 h with the help of EdU incorporation assay kit (RiboBio, China) following the manufacture protocol. The 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) solution was used for counter-staining of the cancer cells. The images were obtained with a fluorescence microscope (Nikon, Japan). The western blots were quantified with the help of imageJ software.

Annexin V/PI staining assay

The relative percentage of apoptotic cells was determined using the Annexin V-FITC Apoptosis Detection Kit (Beyotime, China). Around 105 si-KDM5A or si-NC transfected SK-LU-1 cancer cells were cultured for 48 h. The cells were subsequently, collected and then re-suspended in binding buffer containing Annexin V-FITC and PI solutions as per the manufacturer’s instructions. Flow cytometer (BD Biosciences, USA) was used for analyzing the samples with the help of BD FACSDiva 6.1.3 software (BD Biosciences, USA). Experiments were performed three times, independently.

Statistical analysis

Each experiment was performed using at least three replicates and the final values were given as mean ± SD. The analyses of the statistical data were performed using SPSS software (version, 19.0; IBM PSS, Armonk, NY, USA). The Student’s t test was performed for analyzing the statistical significance between two data points. P < 0.05 was considered to specify the statistically significant difference.

Results

KDM5A is upregulated in lung adenocarcinoma

To investigate the relative transcript levels of KDM5A in normal and adenocarcinoma lung tissues, qRT-PCR was performed. The malignant tissues were shown to express significantly higher KDM5A transcripts than the normal lung tissues (Fig. 1A). The immunohistochemical staining of KDM5A was carried out from cancer and normal lung tissues. The cancer tissues exhibited markedly higher KDM5A-specific staining intensity than the normal tissues (Fig. 1B). Moreover, when KDM5A protein levels were analyzed from cancer cell lines (Hs 618.T, Calu-3, and SK-LU-1) and compared with those form MRC-5 normal lung cell line, all three cancer cells were shown to express significantly (P < 0.05) higher KDM5A protein levels in comparison to the normal cell line, the highest expression was observed in SK-LU-1 cell line (Fig. 1C). The results indicate that KDM5A is over-expressed in lung adenocarcinoma suggesting its possible role in tumor pathogenesis.

Fig. 1.

Fig. 1

Open in a new tab

KDM5A is upregulated in lung adenocarcinoma. A Relative expression analysis of KDM5A in normal and lung adenocarcinoma tissues estimated by qRT-PCR; B immuno-fluorescent staining of KDM5A from normal and lung adenocarcinoma tissues analyzed at different magnifications using fluorescent microscope; C western blotting of KDM5A from normal bronchial cell line (MRC-5) and three different lung cancer cell lines (Hs 618.T, Calu-3, and SK-LU-1) showing relative protein levels of KDM5A. All experiments were carrying three replicates and P values < 0.05 were representative of statistically significant difference

Silencing of KDM5A suppresses proliferation of lung adenocarcinoma cells via induction of apoptosis

To characterize the role of KDM5A in adenocarcinoma, RNAi approach was used for silencing of KDM5A in SK-LU-1 cancer cells which was confirmed by western blotting (Fig. 2A). The MTT assay was used for estimating the proliferation of si-KDM5A-transfected SK-LU-1 cancer cells along with the negative control cells (si-NC-transfected and si-NC-untransfected cell). The si-KDM5A-transfected cancer cells proliferated at significantly lower rates than the negative control cells when the proliferation was assessed at the indicated time intervals (Fig. 2B). Furthermore, the SK-LU-1 cancer cells exhibited significant loss in their proliferation under KDM5A silencing as evidenced by the relatively lesser number of EdU-positive cells (Fig. 2C). The Annexin V-FITC/PI staining showed that silencing of KDM5A significantly increased the percentage of apoptotic SK-LU-1 cancer cells (Fig. 2D). The si-KDM5A-transfected SK-LU-1 cancer cells expressed significantly higher Bax but lower Bcl-2 proteins than the negative control cells (Fig. 2E). Therefore, the silencing of KDM5A induced apoptosis in lung adenocarcinoma cells and declined their proliferation, in vitro.

Fig. 2.

Fig. 2

Open in a new tab

KDM5A silencing inhibits lung adenocarcinoma cell proliferation via apoptosis. A Western blot and qRT-PCR analyses of KDM5A from untransfected, si-KDM5A-transfected, or s-NC-transfected SK-LU-1 cancer cells. B MTT assay showing viability of untransfected, si-KDM5A-transfected, or s-NC-transfected SK-LU-1 cancer cells at different incubation periods. C EdU assay showing proliferation of untransfected, si-KDM5A-transfected, or s-NC-transfected SK-LU-1 cancer cells. D Annexin V-FITC/PI staining-based apoptosis analysis of untransfected, si-KDM5A-transfected, or s-NC-transfected SK-LU-1 cancer cells. E Western blotting of Bax and Bcl-2 proteins from untransfected, si-KDM5A-transfected, or s-NC-transfected SK-LU-1 cancer cells. All experiments were carrying three replicates and P values < 0.05 was representative of statistically significant difference

Overexpression of KDM5A promotes the proliferation of lung adenocarcinoma cells

To further understand the lung adenocarcinoma cell growth regulatory role of KDM5A, KDM5A was over-expressed in SK-LU-1 cancer cells by transfecting the cancer cells with pcDNA6.2-KDM5A Overexpression construct using Lipofectamine 2000. The overexpression was confirmed by western blotting and qRT-PCR (Fig. 3A). KDM5A overexpressing SK-LU-1 cells exhibited significantly higher proliferation than the control vector transfected and untransfected cancer cells (Fig. 3B). The EdU assay also showed that the overexpression of KDM5A enhanced the proliferation of the SK-LU-1 lung adenocarcinoma cells (Fig. 3C). Annexin V/PI staining showed that overexpression of KMD5A prevented the induction of apoptosis and as such promoted the proliferation of the SK-LU-1 cells (Fig. 3C). The KMD5A cells overexpressing SK-LU-1 cells also showed slight increase in Bcl-2 and decrease Bax protein levels (Fig. 3D). The results thus show that KDM5A positively regulates the proliferation of lung adenocarcinoma cells.

Fig. 3.

Fig. 3

Open in a new tab

Overexpression of KDM5A enhances the lung adenocarcinoma cell proliferation. A Western blot and qRT-PCR analyses of from untransfected, pcDNA6.2-KDM5A-transfected, or pcDNA6.2 vector transfected SK-LU-1 cells. B MTT assay showing cell viability of untransfected, pcDNA6.2-KDM5A-transfected, or pcDNA6.2 vector transfected SK-LU-1 cells at different incubation periods. C EdU assay showing proliferation of untransfected, pcDNA6.2-KDM5A-transfected, or pcDNA6.2 vector transfected SK-LU-1 cells. D Annexin V/PI assay showing apoptosis in untransfected, pcDNA6.2-KDM5A-transfected, or pcDNA6.2 vector transfected SK-LU-1 cells. E Western blots showing the expression of Bax and bcl-2 in untransfected, pcDNA6.2-KDM5A-transfected, or pcDNA6.2 vector transfected SK-LU-1 cells. All experiments were carrying three replicates and P < 0.05 was representative of statistically significant difference

KDM5A increases the gefitinib sensitivity of lung adenocarcinoma cells

To assess whether KDM5A regulates the drug sensitivity of adenocarcinoma cancer cells, the SK-LU-1 cancer cells transfected with si-KDM5A were administered with 20 µM gefitinib for 0, 24, 48, and 72 h and their proliferation was studied in comparison to control cells treated with gefitinib only. The proliferation of si-KDM5A-transfected plus gefitinib-treated SK-LU-1 cancer cells was significantly lower than either of the gefitinib-treated or si-KDM5A-transfected SK-LU-1 cancer cells(Fig. 4A). Similar inferences were drawn regarding the proliferation of lung adenocarcinoma cells as revealed by the Edu assay (Fig. 4B). The results are therefore indicative that KDM5A enhances the gefitinib drug sensitivity of lung adenocarcinoma cells.

Fig. 4.

Fig. 4

Open in a new tab

KDM5A regulates gefitinib sensitivity of lung adenocarcinoma cells, in vitro. A MTT assay showing cell viability of untransfected, si-NC transfected si-KDM5A transfected, gefitinib (20 µM) treated, or si-KDM5A transfected plus gefitinib-treated (20 µM) SK-LU-1 cells at different incubation periods. B EdU showing the proliferation of MTT assay showing cell viability of untransfected, si-NC transfected si-KDM5A transfected, gefitinib (20 µM) treated, or si-KDM5A transfected plus gefitinib-treated (20 µM) SK-LU-1 cells. The experiments were carrying three replicates and P < 0.05 was representative of statistically significant difference

Discussion

The lysine-specific histone demethylase, KDM5A has achieved considerable scientific attention and is considered as an efficient therapeutic target for epigenetic anticancer therapy (Yang et al. 2018). KDM5A, also known as Retinol binding Factor 2 (RBP2) or jumonji, AT-rich interactive domain 1A (JARID1A) was originally identified as retinoblastoma protein (Rb)-binding partner (Defeo-Jones et al. 1991). KDM5A up-regulation has been reported to be linked with risk of tumorigenesis and correlates with the poor disease prognosis and the selective inhibition of KDM5A is valued as an effective measure to inhibit the proliferation of ovarian and triple-negative breast cancer cells (Ren et al. 2020; Yang et al. 2018). The increased expression of KDM5A has been shown to promote tumor growth and positively regulate the expression of pro-metastatic genes in Ewing sarcoma (McCann et al. 2020). The results of present study revealed that exhibit significantly higher transcript levels of KDM5A lung adenocarcinoma tissues, and cell lines. Previously, KDM5A was shown to be over-expressed in pancreatic cancer and promoted their growth, migration, and invasion by targeting mitochondrial pyruvate carrier 1 (MPC-1) (Cui et al. 2019). In the present study, KDM5A was also shown to exhibit tumor promotive role in lung adenocarcinoma. KDM5A was also reported to promote the proliferation of ovarian cancer cells and its transcriptional knockdown inhibited the ovarian cancer cell growth by inducing the programmed cell death, apoptosis (Feng et al. 2017). Consistently, the silencing of KDM5A in lung adenocarcinoma cells declined the growth and viability of cancer cells by inducing apoptosis. The Bax/Bcl-2 protein ratio was shown to be increased in cancer cells confirming the induction of apoptosis (Raisova et al. 2001). There are a good number of scientific reports which highlight that KDM5A regulates drug sensitivity of cancer cells, and its targeting was shown to sensitize the cancer cells to drug treatments (Raisova et al. 2001; Hou et al. 2012; Banelli et al. 2015). The present study also suggests similar role of KDM5A in lung adenocarcinoma. The silencing of KDM5A in lung adenocarcinoma cells enhanced the effectiveness of gefitinib administration, in vitro. Acquired drug resistance by cancer cells nullifies the clinical outcome of therapeutic measures and researchers are in continuous hunt to identify the regulators of cancer drug resistance (Ward et al. 2020). The present study clearly elucidated the importance of KDM5A in lung adenocarcinoma drug resistance and thus implicates its therapeutic importance.

Taken together, the present study showed that lung adenocarcinoma is associated with significant level of overexpression of KDM5A histone demethylase. The results specify that KDM5A promotes growth and proliferation of lung adenocarcinoma cells, and also regulates their drug sensitivity. The finding suggests that silencing of KMD5A induced apoptosis in cancer cells to decrease their proliferation and enhanced their sensitivity to gefitinib, signifying the therapeutic importance of KDM5A in lung adenocarcinoma.

Acknowledgements

We acknowledge Jiaxing Second Hospital, Jiaxing China for providing the lab facilities.

Author contributions

HW and XU designed the study. HU and LX performed the experimental work and collected the data for presented study. XH and LX carried out the statistical analysis. XH supervised the work and drafted the manuscript. All authors read and approved the final manuscript.

Funding

This study was supported by Jiaxing City Scientific Research Project (Public Welfare Research Project) (No: 2018AY32001).

Availability of data and materials

Available on request.

Declarations

Conflict of interest

The authors declare no competing interests.

Ethics approval

The study was approved by the research ethics committee of Jiaxing Second Hospital, Jiaxing Zhejiang, China (Approval No. 667JZ-2020).

Consent to participate

Informed written consent was obtained from all the patients before participation in the present study.

Consent for publication

Not applicable.

References

  1. Banelli B, Carra E, Barbieri F, Würth R, Parodi F, Pattarozzi A, Carosio R, Forlani A, Allemanni G, Marubbi D, Florio T. The histone demethylase KDM5A is a key factor for the resistance to temozolomide in glioblastoma. Cell Cycle. 2015;14:3418–3429. doi: 10.1080/15384101.2015.1090063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Cui J, Quan M, Xie D, Gao Y, Guha S, Fallon MB, Chen J, Xie K. A novel KDM5A/MPC-1 signaling pathway promotes pancreatic cancer progression via redirecting mitochondrial pyruvate metabolism. Oncogene. 2019;39:1140–1151. doi: 10.1038/s41388-019-1051-8. [DOI] [PubMed] [Google Scholar]
  3. Defeo-Jones D, Huang PS, Jones RE, Haskell KM, Vuocolo GA, Hanobik MG, Huber HE, Oliff A. Cloning of cDNAs for cellular proteins that bind to the retinoblastoma gene product. Nature. 1991;352:251–254. doi: 10.1038/352251a0. [DOI] [PubMed] [Google Scholar]
  4. Denisenko TV, Budkevich IN, Zhivotovsky B. Cell death-based treatment of lung adenocarcinoma. Cell Death Dis. 2018;9:1–4. doi: 10.1038/s41419-017-0063-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Dietel M, Bubendorf L, Dingemans AM, Dooms C, Elmberger G, García RC, Kerr KM, Lim E, López-Ríos F, Thunnissen E, Van Schil PE. Diagnostic procedures for non-small-cell lung cancer (NSCLC): recommendations of the European Expert Group. Thorax. 2016;71:177–184. doi: 10.1136/thoraxjnl-2014-206677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Feng T, Wang Y, Lang Y, Zhang Y. KDM5A promotes proliferation and EMT in ovarian cancer and closely correlates with PTX resistance. Mol Med Rep. 2017;16:3573–3580. doi: 10.3892/mmr.2017.6960. [DOI] [PubMed] [Google Scholar]
  7. Herbst RS, Morgensztern D, Boshoff C. The biology and management of non-small cell lung cancer. Nature. 2018;553:446–454. doi: 10.1038/nature25183. [DOI] [PubMed] [Google Scholar]
  8. Hou J, Wu J, Dombkowski A, Zhang K, Holowatyj A, Boerner JL, Yang ZQ. Genomic amplification and a role in drug-resistance for the KDM5A histone demethylase in breast cancer. Am J Transl Res. 2012;4:247–256. [PMC free article] [PubMed] [Google Scholar]
  9. Jao K, Tomasini P, Kamel-Reid S, Korpanty GJ, Mascaux C, Sakashita S, Labbé C, Leighl NB, Liu G, Feld R, Bradbury PA. The prognostic effect of single and multiple cancer-related somatic mutations in resected non-small-cell lung cancer. Lung Cancer. 2018;123:22–29. doi: 10.1016/j.lungcan.2018.06.023. [DOI] [PubMed] [Google Scholar]
  10. Kinoshita T, Kudo-Saito C, Muramatsu R, Fujita T, Saito M, Nagumo H, Sakurai T, Noji S, Takahata E, Yaguchi T, Tsukamoto N. Determination of poor prognostic immune features of tumour microenvironment in non-smoking patients with lung adenocarcinoma. Eur J Cancer. 2017;86:15–27. doi: 10.1016/j.ejca.2017.08.026. [DOI] [PubMed] [Google Scholar]
  11. LaFave LM, Kartha VK, Ma S, Meli K, Del Priore I, Lareau C, Naranjo S, Westcott PM, Duarte FM, Sankar V, Chiang Z. Epigenomic state transitions characterize tumor progression in mouse lung adenocarcinoma. Cancer Cell. 2020;38:212–228. doi: 10.1016/j.ccell.2020.06.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. McCann TS, Parrish JK, Hsieh J, Sechler M, Sobral LM, Self C, Jones KL, Goodspeed A, Costello JC, Jedlicka P. KDM5A and PHF2 positively control expression of pro-metastatic genes repressed by EWS/Fli1, and promote growth and metastatic properties in Ewing sarcoma. Oncotarget. 2020;11:3818–3831. doi: 10.18632/oncotarget.27737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Postmus PE, Kerr KM, Oudkerk M, Senan S, Waller DA, Vansteenkiste J, Escriu C, Peters S. Early and locally advanced non-small-cell lung cancer (NSCLC): ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol. 2017;28(suppl 4):iv1–21. doi: 10.1093/annonc/mdx222. [DOI] [PubMed] [Google Scholar]
  14. Qiu M, Xia W, Chen R, Wang S, Xu Y, Ma Z, Xu W, Zhang E, Wang J, Fang T, Hu J. The circular RNA circPRKCI promotes tumor growth in lung adenocarcinoma. Cancer Res. 2018;78(11):2839–2851. doi: 10.1158/0008-5472.CAN-17-2808. [DOI] [PubMed] [Google Scholar]
  15. Raisova M, Hossini AM, Eberle J, Riebeling C, Orfanos CE, Geilen CC, Wieder T, Sturm I, Daniel PT. The Bax/Bcl-2 ratio determines the susceptibility of human melanoma cells to CD95/Fas-mediated apoptosis. J Invest Dermatol. 2001;117:333–340. doi: 10.1046/j.0022-202x.2001.01409.x. [DOI] [PubMed] [Google Scholar]
  16. Ren F, Shrestha C, Shi H, Sun F, Zhang M, Cao Y, Li G. Targeting of KDM5A by miR-421 in human ovarian cancer suppresses the progression of ovarian cancer cells. Onco Targets Ther. 2020;13:9419–9428. doi: 10.2147/OTT.S266211. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  17. Wang JZ, Xiang JJ, Wu LG, Bai YS, Chen ZW, Yin XQ, Wang Q, Guo WH, Peng Y, Guo H, Xu P. A genetic variant in long non-coding RNA MALAT1 associated with survival outcome among patients with advanced lung adenocarcinoma: a survival cohort analysis. BMC Cancer. 2017;17:167. doi: 10.1186/s12885-017-3151-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ward RA, Fawell S, Floc’h N, Flemington V, McKerrecher D, Smith PD. Challenges and opportunities in cancer drug resistance. Chem Rev. 2020;121:3297–3351. doi: 10.1021/acs.chemrev.0c00383. [DOI] [PubMed] [Google Scholar]
  19. Yang GJ, Wang W, Mok SW, Wu C, Law BY, Miao XM, Wu KJ, Zhong HJ, Wong CY, Wong VK, Ma DL. Selective inhibition of lysine-specific demethylase 5A (KDM5A) using a rhodium (III) complex for triple-negative breast cancer therapy. Angew Chem Int Ed. 2018;130:13091–13095. doi: 10.1002/anie.201807305. [DOI] [PubMed] [Google Scholar]
  20. Yang GJ, Ko CN, Zhong HJ, Leung CH, Ma DL. Structure-based discovery of a selective KDM5A inhibitor that exhibits anti-cancer activity via inducing cell cycle arrest and senescence in breast cancer cell lines. Cancers. 2019;11:92. doi: 10.3390/cancers11010092. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Available on request.

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES