A sensitive and quantitative assay to enumerate and measure Mycobacterium leprae viability in clinical and experimental specimens

Abstract

Mycobacterium leprae, the etiologic agent of leprosy, cannot be cultured on artificial media. This characteristic, coupled with its long generation time, presents a number of unique challenges to studying this pathogen. One of the difficulties facing both researchers and clinicians is the absence of a rapid test to measure viability of M. leprae in clinical or experimental specimens. The lack of such a tool limits the understanding of M. leprae immunopathogenesis and makes determining the efficacy of drug treatments difficult. With this in mind, we developed a robust two-step molecular viability assay (MVA) which first enumerates the M. leprae in the tissue; then, this data is used to normalize bacterial RNA quantities for the second step, which measures the expression of M. leprae esxA and hsp18. This assay is specific and sensitive enough to be used on most clinical samples. This protocol describes the steps required to extract DNA and RNA from M. leprae infected tissue, enumerate M. leprae, and to measure M. leprae viability based on the normalized expression of two M. leprae specific genes (hsp18 and esxA). This protocol also outlines an optimal laboratory design and workflow for performing this assay.

Basic Protocol 1:

DNA AND RNA PURIFICATION FROM M. LEPRAE-INFECTED TISSUE

Basic Protocol 2:

ENUMERATION OF M. LEPRAE by RLEP qPCR ON THE DNA FRACTION

Basic Protocol 3:

CALCULATION OF M. LEPRAE PER TISSUE AND NORMALIZATION OF RNA

Basic Protocol 4:

REVERSE-TRANSCRIPTION OF NORMALIZED RNA TO GENERATE cDNA

Basic Protocol 5:

DETERMINATION OF M. LEPRAE VIABILITY USING HSP18 AND ESXA qPCR ON THE cDNA

Support Protocol 1:

M. leprae qPCR PRIMER/PROBE STOCK PREPARATION

Support Protocol 2:

PREPARATION OF PLASMID STOCKS AND STANDARD CURVES

INTRODUCTION

Leprosy, also known as Hansen’s Disease, is caused by the acid-fast bacterium, Mycobacterium leprae. It manifests as an immunohistopathological spectrum that is dependent on the immune capabilities of the host and affects the skin, mucous membranes of the upper respiratory tract, and peripheral nerves. The disease ranges from multibacillary lepromatous disease at one end of the spectrum, where enormous numbers of M. leprae are found in the lesions and there is a poorly developed cell mediated immunity (CMI) but strong antibody response, to tuberculoid disease at the other end of the spectrum, where few bacilli are present and there is a strong CMI to M. leprae antigens. Between these two extremes are varying levels of CMI and bacterial growth. To confound this complicated disease presentation, reactional episodes can arise from an apparent change in the host’s immune response and frequently manifest during or following anti-leprosy treatment (Scollard et al., 2006).

Leprosy is diagnosed primarily by clinical examination. Confirmation of diagnosis is via histopathological observation of acid-fast bacilli inside the peripheral nerves of a leprosy lesion. Recently, a M. leprae-specific quantitative polymerase chain reaction (qPCR) assay has become standard-of-care for leprosy diagnostics at the National Hansen’s Disease Programs (NHDP) (Sharma et al., 2020). This diagnostic qPCR test, however, detects M. leprae DNA but does not distinguish between live and dead bacilli. In fact, the assessment of M. leprae viability has been the bane of both clinical and research studies (Lahiri & Adams, 2016). This is due to three characteristics of M. leprae. First, this organism has yet to be cultivated on artificial medium and must be grown in animal models, such as the mouse footpad or the nine-banded armadillo. Second, M. leprae has an extremely long division time of 12–14 days; therefore, cultivation experiments can take up to a year to complete. Third, due to its dense lipid cell wall it can take months to years for the immune system to clear dead bacilli from tissues, so presence of acid-fast bacteria in tissue does not necessarily indicate viable organisms. Thus, the difficulty in determining whether an immunological manifestation of leprosy is induced or exacerbated by metabolites generated by live bacilli or by cellular remnants released by dead bacteria cannot be overstated. The capacity to assess the viability of M. leprae in a tissue sample in a sensitive, specific, easy, and relatively short-term manner would be beneficial.

The NHDP maintains multiple clinical strains of M. leprae in continuous programmed passage in athymic mouse footpads. This colony provides a regular, consistent, and reproducible supply of highly viable M. leprae suspensions and infected tissues for use as research reagents (Truman & Krahenbuhl, 2001; Lenz, Collins, Lahiri, & Adams, 2020; Adams 2021). This resource was instrumental in developing, refining, and validating this two-step molecular viability assay (MVA) for M. leprae (Davis et al, 2013). In the first step, M. leprae is quantified in the tissue sample and this data is used to normalize bacterial RNA quantities for the second step, which measures the expression of M. leprae esxA and hsp18. This article details how to perform this MVA. DNA and RNA purification from M. leprae-infected host tissues, including human biopsies and mouse footpads, is presented in Basic Protocol 1. Enumeration of the number of M. leprae per tissue by qPCR is described in Basic Protocol 2. A key step in the MVA protocol is the normalization of the M. leprae RNA based on the M. leprae count. This procedure is explained in Basic Protocol 3. The normalized RNA is then reverse transcribed to cDNA (Basic Protocol 4), and M. leprae viability is measured by quantifying esxA and hsp18 transcripts (Basic Protocol 5). Preparation of the M. leprae-specific primers and probe for the qPCR assays are detailed in Support Protocol 1, and preparation of the standard curves are presented in Support Protocol 2.

SAFETY PRECAUTIONS

• M. leprae is a BSL-2 pathogen in the United States. However, once the infected tissue is fixed in 70% ethanol for at least 24 hr it is no longer infectious. Therefore, all molecular work can be performed in a BSL-1 laboratory following basic biosafety protocols. However, laboratories should consult their institutional biosafety guidelines before starting work.

• Disposable gloves are to be worn at all times throughout the procedure. Powdered latex gloves are not recommended.

• All work should be performed in still air hood dedicated for either DNA or RNA extraction/handling, as well as a separate hood for loading 96 well plates for qPCR. Use of a chemical fume-hood is recommended when handling organic reagents.

• All surfaces and pipettors should be disinfected with DNA AWAY™ and RNase AWAY™ or a similar product after work is completed.

STRATEGIC PLANNING

• It is important to follow a unidirectional workflow to prevent contamination. Separate areas or rooms, complete with their own equipment, should be dedicated to each part of the workflow. Primers/probes and other qPCR reagents should be stored and handled in a Reagent Area that is separate from where specimens are handled (Sample Prep Area). qPCR should be performed in a Product Area. qPCR products should never be taken into the Reagent or Sample Prep Areas. Pipettors should be designated for either DNA or RNA work and not used interchangeably. Refer to the Clinical and Laboratory Standards Institute’s publication MM19-A for comprehensive guidance and recommendations on molecular biology laboratory design.

• If there are multiple tissue samples to evaluate, we have found that a group of 12 samples is a reasonable number to process at one time.

• This assay takes multiple days to complete, so it is important to plan and allocate sufficient time for the entire procedure. Figure 1 gives a brief overview of the MVA.

Figure 1.

Overview of Basic Protocols 1–5.

BASIC PROTOCOL 1

DNA AND RNA PURIFICATION FROM M. LEPRAE-INFECTED TISSUE

This protocol describes how to purify DNA and RNA from M. leprae-infected tissues and how to DNase the purified RNA. Infected tissue is first homogenized, and then DNA and RNA is extracted and purified. Purified RNA is DNase treated using Turbo DNase.

Materials

Specimens fixed in 70% ethanol, i.e. 4–5 mm human leprosy lesion biopsy or M. leprae-infected mouse footpad tissue

Nuclease-free water (Fisher ThermoScientific, CAT# AM9930)

Trizol (Fisher Thermo Scientific, CAT# 15596–018)

Chloroform IsoAmyl mixture (Sigma, CAT# 25666)

GlycoBlue Co-Precipitant (Fisher ThermoScientific, CAT# AM9516)

Ammonium Acetate (5M) (Fisher Thermo Scientific, CAT# AM9070G)

Molecular grade isopropanol (Fisher Scientific, CAT# BP2618500) 500 ml bottles

Molecular grade ethanol 200 proof (Fisher Scientific, CAT# BP2818) 500 ml bottles

1X TE buffer (Sigma, CAT# T9285) 100X Tris EDTA buffer solution. Use at 1X.

Turbo DNAse Kit (Thermo Fisher Scientific, CAT# AM1907)

Ice and ice bucket

10μl, 20μl, 200μl, and 1000μl Pipettors

Filtered Pipette Tips

Refrigerated Microcentrifuge

Petri Dishes 35mm x 10mm (Fisher Scientific, CAT# FB0875711YZ)

Scalpels No. 10 BP (Fisher Scientific, CA# 14–823-45)

Micro Dissecting Scissors: curved; sharp points; 24mm blade length; 4.5 in. overall length (Fisher Scientific, CAT# RS5913)

Blue cap FastPrep® tubes containing MP Biomedicals Lysing Matrix B, 2.0ml tubes- RNase/DNase free (Fisher Scientific, CAT# 6911–500)

FastPrep® FP-24 instrument (MP Bio, SKU:116005500)

1.5ml conical tubes (Fisher Scientific, CAT# 50809238)

Heat block

PCR reaction tubes (Thermo Fisher Scientific CAT# N8010540)

PCR tube adapters (Thomas Scientific, CAT# 2508Z68)

NOTE: This protocol is optimized for human leprosy lesion tissue (4–5mm punch biopsy) or mouse footpad tissue (~20–40mg) that has been placed immediately upon collection into 1ml of 70% ethanol and fixed for at least 24 hr. Tissues in 70% ethanol can be kept at room temperature (RT; 20–22°C) during transport to the laboratory. However, if tissues must be shipped to another site, we recommend using cold packs. Long-term storage should be at −20°C.

Tissue Homogenization

• 1Retrieve tubes containing tissue samples in 70% ethanol from −20°C and place on ice.
• 2Centrifuge tubes at 10,000 x g for 10 min at 4˚C if the sample is in multiple small pieces.
• 3Pipette off ethanol.
• 4Add 1 ml nuclease-free water to each tube to re-hydrate samples.
• 5Incubate at RT for 1 hr for human biopsy tissue or 15 min for mouse footpad tissue.
• 6Spin tubes at 10,000 x g for 10 min at 4˚C.
• 7Pipette off water and place each tissue sample in the lid of a 35mm x 10mm Petri dish. Use a pipette tip to aid in removing tissue sample from the tube.
• 8Add 100 μl of water on tissue and mince in with No. 10 scalpels for 1 min.

  It is more comfortable to mince the tissue in the lid rather than the bottom piece of the dish since it is shallower.

• 9Continue to mince with scissors for 3 min until fine. Tissue pieces should be <1mm in size after mincing.

  Use a new scalpel and scissors for each sample.

• 10Transfer each tissue homogenate to a blue cap FastPrep® tube using the scissors.
• 11Add 900 μl of TRIzol to each tube for a total volume of 1ml.
• 12Place tubes in the FastPrep® FP-24 instrument, and homogenize the tissue using a speed setting of 6.5 m/s for 45 sec.

  The Fast Prep is used to efficiently homogenize the tissue and break open the cell wall of M. leprae, which increases the yield of nucleic acids.

• 13Allow the blue cap FastPrep® tubes containing the homogenates to sit in the FastPrep® FP-24 instrument for 5 min.

  Homogenization in the FastPrep® FP-24 instrument generates heat, which may decrease the yield of nucleic acids, especially RNA. This 5 min incubation allows the homogenates to cool.

• 14Repeat step 12.
• 15Chill tubes on ice for 5 min.

  Never homogenize a third time. This decreases the RNA yield.

DNA and RNA Extraction

• 16Transfer the blue cap FastPrep® tubes to a tube rack and add 200 μl of chloroform/isoamyl alcohol (CIA) to each tube. Vortex for 10 sec.
• 17Let tubes sit at RT for 3 min.
• 18Centrifuge the tubes at 700 x g for 5 min at 4°C. Remove the tubes from the centrifuge and place on a rack.
• 19Transfer the contents of the tube (both the pink and clear layers) to a new 1.5 ml conical microfuge tube.

  During the transfer, some of the white matrix beads may also be pulled up which is acceptable.

• 20Centrifuge the tubes at 14,000 x g for 10 min at 4°C. Remove the tubes from the centrifuge and place on a rack.

  The mixture should have separated into a pink, phenol-chloroform lower phase, a solid interphase, and a colorless upper aqueous phase. The RNA is in the colorless upper phase. The DNA is in the interphase.

• 21Transfer ONLY 400 μl of the top colorless aqueous phase (RNA) to new 1.5 ml conical microfuge tubes.

  It is crucial not to aspirate any of the interphase.

• 22Place the original tube, which contains the pink phenol-chloroform lower phase and solid interphase, on ice.

  This tube contains the DNA needed for step 32 in DNA precipitation.

RNA Precipitation

• 23Add 400 μl of CIA to the 400 μl aqueous phase (tubes from Step 21) and vortex for 5 sec to mix.
• 24Let tubes sit at RT for 3 min.
• 25Centrifuge tubes at 14,000 x g for 2 min at 4°C.
• 26Transfer 300 μl of each top aqueous phase to a new 1.5 ml conical microfuge tube.
• 27Add 2.0 μl GlycoBlue to each tube.

  GlycoBlue will enable visualization of the RNA pellet.

• 28Add 30 μl of 5M ammonium acetate to each tube.
• 29Precipitate the RNA by adding 332 μl of cold 100% Isopropanol to each tube. Vortex for 5 sec to mix.

  Isopropanol is stored at −20°C.

• 30Incubate tubes at RT for 5 min.
• 31Incubate the tubes at −70°C overnight or until ready to complete precipitation.

  This is a safe stopping point for RNA.

DNA Precipitation

• 32Transfer the contents of each tube saved at step 22 (containing the interphase and phenol-chloroform phases) to a new 1.5 ml conical microfuge tube.
• 33Add 100 μl of 1X TE to each tube.
• 34Add 150 μl chloroform/isoamyl alcohol (CIA) to each tube.
• 35Place tubes in the FastPrep® FP 24 instrument.
• 36Homogenize twice at a speed setting of 6.5 m/s for 45 sec with 5 min rest in between each cycle.
• 37Centrifuge tubes at 14,000 x g for 10 min. at 4⁰C.
• 38Transfer the aqueous phase (~200μl) to a new 1.5 ml tube.

  If there are not 200 μl of aqueous phase, add an additional 200 μl of 1X TE directly into tube, vortex, and centrifuge again at 14,000 x g for 10mins at 4⁰C.

• 39Add 1.5 μl of GlycoBlue to each tube.
• 40Precipitate the DNA by adding 20 μl of 5M ammonium acetate followed by 400 μl of cold 100% ethanol to each tube. Vortex for 5 sec to mix.

  Ethanol is stored at −20°C.

• 41Store tubes at −70°C overnight or until ready to complete.

  This is a safe stopping point for DNA.

DNA Purification

• 42Place the tubes from step 41 on ice.
• 43Centrifuge at 10,000 x g for 10 min at 4°C.

  Pellets will be blue.

• 44Remove the supernatant and wash the DNA pellet by re-suspending in 1 ml cold 70% ethanol. Vortex for 5 sec to mix.
• 45Centrifuge at 10,000 x g for 10 min at 4°C.
• 46Remove the supernatant then air dry the pellet by inverting the tube on sterile gauze at RT for 30 min.
• 47Re-suspend the DNA in 30 μl of sterile 1X TE by vortexing for 5 sec.
• 48Spin at 10,000 x g for 30 sec.
• 49Store purified DNA at −70°C until use.

  Generally, ~2 μg of total DNA (both host and M. leprae) per mg of sample are recovered. This is a safe stopping point for DNA.

RNA Purification

• 50Place tubes from step 31 on ice.
• 51Centrifuge tubes at 14,000 x g for 30 min at 4°C.

  If there is not a visible blue pellet after this spin, add another 2 μl of GlycoBlue and repeat the 30 min centrifugation.

• 52Pipette off the supernatant from each tube without disturbing the pellet.
• 53Wash the pellets by adding 1 ml cold 75% ethanol. Vortex each tube briefly for 2 sec.
• 54Centrifuge tubes at 12,000 x g for 5 min at 4°C.
• 55Let the tubes sit at RT for 5 min.
• 56Centrifuge again at 12,000 x g for 5 min at 4°C.
• 57Carefully remove the supernatant from each tube without disturbing the pellet.

  Pellets will be blue.

• 58Repeat steps 53–57 once more.

  After pipetting off the initial 1 ml of ethanol, use a 20 μl pipette to carefully pipette off as much of the residual ethanol that may remain.

• 59Invert the tubes on sterile gauze and let air dry for 10 min ONLY.

  Do not over-dry the pellet. If the pellet dries for too long, the RNA will not solubilize properly.

• 60Re-suspend each RNA pellet in 25 μl of nuclease-free water at RT. Vortex for 5 sec.
• 61Spin at 10,000 x g for 30 sec.
• 62Place tubes in 55°C heat block for 15 min.

  Heating ensures that the RNA is completely solubilized.

• 63Remove tubes from heat block and place on ice.

DNasing the RNA

• 64Add 17 μl of nuclease-free water from the Turbo DNase Kit to a PCR reaction tube, one for each RNA sample.
• 65Add 5 μl of Turbo DNase 10X buffer to each tube.
• 66Add 25 μl of purified RNA from Step 63 to each respective tube.
• 67Add 1.5 μl of Turbo DNase to each tube. Vortex for 5 sec and spin for 30 sec at 10,000 x g.
• 68Incubate for 30 min at 37°C in a thermocycler.
• 69Add an additional 1.5 μl of Turbo DNase to each tube. Vortex for 5 sec and spin for 30 sec at 10,000 x g.
• 70Incubate for 30 min at 37°C in a thermocycler.

DNase Inactivation

• 71Remove the PCR tubes from the thermocycler.
• 72Add 10 μl of DNase Inactivation Reagent to each tube.
• 73Set a timer for 5 min. Vortex each tube individually for 10 sec. Once each tube has been vortexed for 10 sec, start back at the first tube and repeat the 10 sec vortex for each tube until the 5 min is over.

  It is crucial that the tubes are constantly agitated during this step.

• 74Centrifuge the tubes at 10,000 x g for 2 min at RT.

  Use either PCR tube adapters to place the PCR tubes in the centrifuge or transfer contents of each PCR tube into a new conical microfuge tube before centrifuging.

• 75Transfer 45 μl of each supernatant to a sterile microfuge tube.

  Avoid the “pellet” at the bottom.

• 76Keep the DNased RNA on ice or store at 4°C while setting up the reverse transcription reaction.

  Approximately 2 μg of total RNA (both host and M. leprae) per mg sample are usually obtained.

BASIC PROTOCOL 2

ENUMERATION OF M. leprae by RLEP qPCR ON THE DNA FRACTION

This protocol describes how to set up and run RLEP qPCR to quantify the number of M. leprae in each sample. Purified DNA from the previous protocol is used as a template to target and amplify the M. leprae-specific repetitive element, RLEP, using qPCR. RLEP is unique to M. leprae, having been tested against 17 mycobacterial species, including the closely related M. lepromatosis (Sharma et al, 2020), and RLEP qPCR correlates with microscopic counting of acid-fast bacilli for the enumeration of M. leprae in tissues (Truman et al, 2008; Davis et al, 2013).

Materials

DNA samples from Basic Protocol 1: Step 49

1X TE buffer (Sigma, CAT# T9285) 100X Tris EDTA buffer solution. Use at 1X.

TaqMan® Universal Master Mix II, with UNG (Fisher ThermoScientific, CAT# 4440045) This catalog number is for a 5ml five pack.

Nuclease-free water (Fisher ThermoScientific, CAT# AM9930)

RLEP Primers (1X concentration, see Support Protocol 1)

RLEP Probe (1X concentration, see Support Protocol 1)

Corning^® 96 Well Clear PVC Assay Microplate (Sigma, CAT# CLS2797)

Reagent Reservoir (Vistalab Technologies, CAT# 3054–1004)

Applied Biosystems™ MicroAmp™ Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL (Fisher Thermo Scientific, CAT# 4346906)

PCR reaction tubes (Thermo Fisher Scientific CAT# N8010540)

10μl, 20μl, 200μl, and 1000μl Pipettors

200 μl Multi-Channel Pipette

Pipette Tips

Vortex

Mini centrifuge

Real-time PCR machine

Microsoft Excel

Dilution of DNA

• 1Prepare serial 10-fold dilutions of 1:10, 1:100, and 1:1000 of each extracted DNA sample.
• 2Pipette 45 μl of 1X TE into each tube. For the first dilution (1:10), add 5 μl of the undiluted extracted DNA into the first tube. Briefly vortex the tube and centrifuge at 10,000 x g for 30 sec to mix. For the second dilution (1:100), add 5 μl of the 1:10 DNA dilution to the tube. Briefly vortex the tube and centrifuge at 10,000 x g for 30 sec to mix. For the final dilution (1:1000) use 5 μl of the 1:100 dilution as the addition to the tube. Briefly vortex the tube and centrifuge at 10,000 x g for 30 sec to mix.

  The DNA dilution scheme is shown in Figure 2.

• 3DNA dilutions should be stored at −20°C until ready to use.

Figure 2.

Dilution scheme for making serial dilutions of purified DNA to perform RLEP-qPCR.

Master mix preparation

• 4Prepare the qPCR master mix as shown in Table 1 using the RLEP primers and probe.

Table 1.

qPCR Master Mix

Reagent	μl Per Reaction	μl for 96-well Plate
Universal Master Mix	12.5	1350
Sterile Water	7	756
Forward Primer	1.25	135
Reverse Primer	1.25	135
1x Probe	0.5	54
Total	22.5	2430

RLEP qPCR

• 5Distribute 22.5 μl master mix per well into a 96 well plate using a multi-channel pipette.
• 6Add 2.5 μl of each DNA dilution, in duplicate, to wells.
• 7Add 2.5 μl of each dilution of the standard curve, in duplicate, to the plate.
• 8Add 2.5 μl of 1X TE and nuclease-free water, in duplicate, to the plate. These serve as the negative controls.

  An example plate set-up is shown in Figure 3.

• 9Run qPCR reactions on a real-time PCR machine using the following thermal profile:

  Step 1: 50°C for 2 min (Holding Stage)

  Step 2: 95°C for 10 min (Holding Stage)

  Step 3: 95°C for 15 sec (denaturation)

  Step 4: 60°C for 1 min (annealing/extension)

  Repeat steps 3 and 4 for 40 cycles.

  This thermal profile for qPCR is shown in Figure 4.

• 10Export the data into Excel.

Figure 3.

RLEP qPCR Plate layout. The RLEP plasmid standard curve should consist of 8 points using a 1:4 serial dilution (shown in Table 5) and plated in duplicate. The negative controls are nuclease-free water and 1X TE used to set up the qPCR, run in duplicate. The “unknown” samples being tested for RLEP on the remainder of the plate are run in duplicate.

Figure 4.

Thermal profile for qPCR. In Step 1, samples are held at 50°C for 2 min. In Step 2, samples are held at 95°C for 10 min. Samples are denatured at 95°C for 15 sec (Step 3), then annealing and extension proceeds at 60°C for 1 min (Step 4). Steps 3 and 4 are repeated for 40 cycles.

BASIC PROTOCOL 3

CALCULATION OF M. LEPRAE PER TISSUE AND NORMALIZATION OF RNA

This protocol explains how to use the NHDP MVA calculator to calculate the number of M. leprae per sample and determine the dilutions necessary to normalize the RNA for the reverse transcription reaction. The number of dilutions required will be dependent on the number of M. leprae in the sample, not on the weight of the tissue or the amount of total RNA recovered (see Critical Parameters).

Materials

DNased RNA samples from Basic Protocol 1: Step 76

Nuclease-free water (Fisher ThermoScientific, CAT# AM9930)

RLEP qPCR Data from Basic Protocol 2 Step 10.

NHDP MVA Calculator (supplemental Excel File)

PCR reaction tubes (Thermo Fisher Scientific CAT# N8010540)

10μl, 20μl, 200μl, and 1000μl Pipettors

Pipette Tips

Vortex

Mini centrifuge

Calculation of the number of M. leprae per tissue sample

• 1Refer to the RLEP qPCR data from Basic Protocol 2: Step 10. Compare the linearity of the Mean Quantity values to the DNA 10-fold dilutions for each sample. Choose the Mean Quantity value of the highest dilution that is closest to the Mean Quantity value of the “C” dilution of the standard curve.
• 2Input the Mean Quantity value of your chosen dilution into the “Mean Quantity” column (Column B) of the NHDP MVA Calculator.
• 3Enter the DNA dilution for that chosen sample, e.g., 10, 100, or 1000 into the “Dilution” column (Column C).
• 4The NHDP MVA Calculator will calculate the number of M. leprae per tissue sample (Column E).

  A set of example data is depicted in Figure 5A.

Figure 5.

Calculations for an example data set using the NHDP MVA Calculator. A) Example of data. The Mean Quantity from the RLEP qPCR for example data set #1–4 are manually entered into column B. The corresponding dilution for each example is manually entered into column C. The number of M. leprae per tissue (Column E) and the dilutions for normalizing the RNA (columns G-P) are automatically calculated. B) Dilution scheme of example data set #1–4 for making dilutions to normalize M. leprae RNA.

Calculation of dilutions to normalize each M. leprae RNA sample

• 5The NHDP MVA Calculator will also calculate the RNA dilutions needed to normalize each RNA sample to 3,000 M. leprae equivalents per reverse transcription reaction.

  For the normalization calculations, we assume that 100% of the M. leprae DNA is recovered in the DNA fraction and 100% of the M. leprae RNA is recovered in the RNA fraction. We normalize the RNA to 3000 bacterial equivalents per reverse transcription reaction because this number provides a linear dynamic range to measure M. leprae transcript expression (Figure 6).

• 6Prepare the required number of serial 10-fold dilutions (Columns G-M) by transferring 3 μl of the DNase-treated RNA into 27 μl of nuclease-free water. Vortex and quick-spin after each dilution.

  The dilutions for the example data set in Figure 5A are shown in Figure 5B.

• 7Transfer the calculated volume of RNA (Column O) from the last dilution into the calculated volume of nuclease-free water (Column P) for a total volume of 30 μl.
• 8If an ERROR message appears in the Dilution columns (Columns G-M), there are not enough M. leprae (<1.9×10⁴) present in the sample to normalize the RNA. Disregard any values in columns O and P for samples that give an ERROR. The viability assay cannot be performed on that sample.

  Be sure to “Save As” and use a new file name when saving work done in the NHDP MVA Calculator Excel file.

• 9Store the normalized RNA samples on ice.

Figure 6.

Establishment of RNA linear range. Serial 10-fold dilutions of DNased RNA were reversed transcribed and esxA expression was determined by qPCR.

BASIC PROTOCOL 4

REVERSE-TRANSCRIPTION OF NORMALIZED M. LEPRAE RNA TO GENERATE cDNA FOR THE VIABILITY qPCR

This protocol explains the steps required to reverse transcribe the normalized RNA from step 7 in Basic Protocol 3 to generate cDNA using the Advantage® RT-for-PCR Kit from Clontech. The cDNA generated in this protocol will be used as the qPCR template in Basic Protocol 5 to measure the viability of M. leprae in the sample.

Materials

Normalized RNA samples from Basic Protocol 3: Step 9

Nuclease-free water (Fisher ThermoScientific, CAT# AM9930)

Advantage® RT-for-PCR Kit (Clontech, CAT# 639506)

PCR reaction tubes (Thermo Fisher Scientific CAT# N8010540)

10μl, 20μl, 200μl, and 1000μl Pipettors

Pipette Tips

Vortex

Mini centrifuge

Thermocycler

1. Prepare the Reverse Transcription master mix using the reagents provided in the Advantage® RT-for-PCR kit as shown in Table 2. Store the master mix on ice until it is ready to add to the PCR tube.

2. Prepare a second master mix, the Mock master mix, by substituting nuclease-free water for the MMLV Reverse Transcriptase (Table 3). Do not use the DEPC-treated water supplied in the kit for this step. Store the master mix on ice until it is ready to add to the PCR tube.

   A Mock master mix is necessary to ensure that the samples do not contain any contaminating DNA.

3. Label a set of “RT” tubes, one per sample.

4. Label a set of “Mock” tubes, one per sample.

5. Add 1.0 μl of Random Hexamer to each tube and close tubes.

6. Add 12.5 μl of each normalized RNA sample to a “RT” tube.

7. Add 12.5 μl of each normalized RNA sample to its corresponding “Mock” tube.

8. Mix the PCR tube contents by vortexing for 5 sec followed by a quick-spin in a micro-centrifuge.

9. Transfer the PCR tubes to a thermocycler.

10. Heat the RNA at 70°C for 2 min.

11. Remove the PCR tubes from the thermocycler.

12. Add 6.5μl of RT Master Mix to each RT sample tube. Vortex and quick-spin tubes.

13. Add 6.5μl of Mock Master Mix to each Mock sample tube. Vortex and quick-spin tubes.

14. Place the RT tubes and the Mock tubes in a thermocycler and run the program shown below.

    • 42°C for 1 hr
    • 94°C for 5 min
    • 4°C for 5 min
    • 4°C Hold

15. Remove the tubes from the thermocycler.

16. Add 30 μl of nuclease free water to each tube for a final volume of 50μl. Vortex for 5 sec and quick spin.

17. Transfer each cDNA and Mock into an appropriate long-term storage tube and store at −70°C.

    Do not make any adjustments to the cDNA generated in this Protocol. Each cDNA was prepared from normalized RNA and is ready for the qPCR reactions.

Table 2.

Reverse Transcription Master Mix

Reagent	μl Per Reaction	μl for 12 samples
5X Reaction Buffer	4	56
dNTP Mix (10mM each)	1	14
Recombinant RNase Inhibitor	0.5	7
MMLV Reverse Transcriptase	1	14
Total	6.5	91

Table 3.

Mock Master Mix

Reagent	μl Per Reaction	μl for 12 samples
5X Reaction Buffer	4	56
dNTP Mix (10mM each)	1	14
Recombinant RNase Inhibitor	0.5	7
Nuclease-Free Water	1	14
Total	6.5	91

BASIC PROTOCOL 5

DETERMINATION OF M. LEPRAE VIABILITY USING hsp18 AND esxA qPCR ON THE cDNA

This protocol describes how to set up and run a qPCR assay to determine the viability of M. leprae in a sample by measuring the expression of hsp18, which encodes the 18 kD heat shock protein, and esxA, which encodes the ESAT-6 protein, transcripts. These genes were chosen because of their high expression levels by M. leprae actively growing in athymic nude mouse footpads and for their ability to discriminate loss of viability after bacterial killing by anti-microbial drugs or immunologically mediated methods (Williams et al, 2004; Davis et al, 2013).

Materials

cDNA and Mock samples from Basic Protocol 4: Step 17

1X TE buffer (Sigma, CAT# T9285) 100X Tris EDTA buffer solution. Use at 1X.

TaqMan® Universal Master Mix II, with UNG (Fisher ThermoScientific, CAT# 4440045) This catalog number is for a 5ml five pack.

Nuclease-free water (Fisher ThermoScientific, CAT# AM9930)

hsp18 Primers (1X concentration, see Support Protocol 1)

hsp18 Probe (1X concentration, see Support Protocol 1)

esxA Primers (1X concentration, see Support Protocol 1)

esxA Probe (1X concentration, see Support Protocol 1)

16S Primers (1X concentration, see Support Protocol 1)

16S Probe (1X concentration, see Support Protocol 1)

Corning^® 96 Well Clear PVC Assay Microplate (Sigma, CAT# CLS2797)

Reagent Reservoir (Vistalab Technologies, CAT# 3054–1004)

Applied Biosystems™ MicroAmp™ Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL (Fisher Thermo Scientific, CAT# 4346906)

PCR reaction tubes (Thermo Fisher Scientific CAT# N8010540)

10μl, 20μl, 200μl, and 1000μl Pipettors

200 μl Multi-Channel Pipette

Pipette Tips

Vortex

Mini centrifuge

Real-time PCR machine

1. Prepare 3 sets of qPCR master mix (refer to Table 1):

   • 1 set using hsp18 primers and probe
   • 1 set using esxA primers and probe
   • 1 set using 16S primers and probe

   16S qPCR is used as an internal RNA extraction control. It is NOT a viability indicator.

2. Distribute 22.5 μl per well of each qPCR master mix into a 96 well plate using a multi-channel pipette.

3. Add 2.5 μl of each cDNA sample, in duplicate, to each master mix set.

4. Add 2.5 μl of each Mock sample, in duplicate, to each master mix set.

5. Add 2.5 μl of each dilution of the standard curve, in duplicate, to each master mix set.

6. Add 2.5 μl of 1X TE and nuclease-free water, in duplicate, to each master mix set. These serve as negative controls.

   An example plate set-up is shown in Figure 7.

7. Run qPCR reactions on a real-time PCR machine using the following thermal profile:

   Step 1: 50°C for 2 min (Holding Stage)

   Step 2: 95°C for 10 min (Holding Stage)

   Step 3: 95°C for 15 sec (denaturation)

   Step 4: 60°C for 1 min (annealing/extension)

   Repeat steps 3 and 4 for 40 cycles.

   The thermal profile for each qPCR is shown in Figure 4.

8. Export the data into Excel.

Figure 7.

hsp18, esxA, or 16S qPCR plate layout. The hsp18/esxA and/or 16S plasmid standard curve should consist of 8 points using a 1:4 serial dilution and plated in duplicate. The negative controls are nuclease-free water and 1X TE used to set up the qPCR, run in duplicate. The “unknown” samples, both cDNA and mocks, being tested for hsp18/esxA and/or 16S on the remainder of the plate are run in duplicate.

Support Protocol 1

M. leprae qPCR PRIMER/PROBE STOCK PREPARATION

This protocol describes the how to rehydrate and prepare the qPCR primers and probes used in the MVA to quantify M. leprae and measure M. leprae viability. The primer and probe sequences are shown in Table 4. All primers and probes used in this assay have been extensively tested to ensure there is no expression of the targets in non-infected mouse and human tissue.

Table 4.

Primers and probe sequences.

M. leprae Target	Primer and Probe Sequence
RLEP	FORWARD: 5′ GCAGCAGTATCGTGTTAGTGAA 3′ REVERSE: 5′ CGCTAGAAGGTTGCCGTAT 3′ PROBE: 5′ CGCCGACGGCCGGATCATCGA 3′
hsp18	FORWARD: 5′ CGATCGGGAAATGCTTGC 3′ REVERSE: 5′ CGAGAACCAGCTGACGATTG 3′ PROBE: 5′ ACACCGCGTGGCCGCTCG 3′
esxA	FORWARD: 5′ CCGAGGGAATAAACCATGCA 3′ REVERSE: 5′ CGTTTCAGCCGAGTGATTGA 3′ PROBE: 5′ TGCTTGCACCAGGTCGCCCA 3′
16S	FORWARD: 5′ GCATGTCTTGTGGTGGAAAGC 3′ REVERSE: 5′ CACCCCACCAACAAGCTGAT 3′ PROBE: 5′ CATCCTGCACCGCA 3′

Materials

TaqMan® Universal Master Mix II, with UNG (Fisher ThermoScientific, CAT# 4440045)

This catalog number is for a 5ml five pack.

Lyophilized RLEP forward and reverse primers

RLEP probe (liquid)

Lyophilized hsp18 forward and reverse primers

hsp18 probe (liquid)

Lyophilized esxA forward and reverse primers

esxA probe (liquid)

Lyophilized 16s forward and reverse primers

16S probe (liquid)

Nuclease-free water (Fisher ThermoScientific, CAT# AM9930)

1X TE (Sigma, CAT# T9285) 100X Tris EDTA buffer solution. Use at 1X.

Corning^® 96 Well Clear PVC Assay Microplate (Sigma, CAT# CLS2797)

Reagent Reservoir (Vistalab Technologies, CAT# 3054–1004)

Applied Biosystems™ MicroAmp™ Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL (Fisher Thermo Scientific, CAT# 4346906)

1.5ml conical tubes (Fisher Scientific, CAT# 50809238)

Mini-centrifuge

Vortex Mixer

10μl, 20μl, 200μl, and 1000μl Pipettors and tips

M. leprae Primers

1. Centrifuge tubes at 10,000 x g for 1 min to ensure lyophilized primers are at the bottom of the tube. Primers are ordered at a concentration of 80,000 pmol and come lyophilized.

   All reagents are to be handled only in the Reagent Area. All primers are rehydrated using nuclease-free water. All primers and probes are ordered through ABI.

2. Add 400 μl of nuclease-free water to each tube containing the lyophilized primer.

3. Vortex for 10 sec and incubate at RT for at least 30 min.

4. Vortex each tube for 10 sec and quick spin in the mini-centrifuge.

   The primers are now at a concentration of 200 μM. For RLEP, this is a 20X concentration. For hsp18, esxA, and 16s, this is a 10X concentration. Store at −20°C.

5. Prepare a 1:20 dilution by adding 25 μl of the 20X RLEP primer to 475 μl of nuclease-free water to make a 1X working stock of RLEP primer. Store at −20°C.

   The final concentration of RLEP primers is 10 μM.

6. Prepare a 1:10 dilution by adding 50 μl of the hsp18, esxA, or 16S primers to 450 μl nuclease-free water to make a 1X working stock of hsp18, esxA, or 16S primers.

7. Store all primers at −20°C.

   The final concentration of hsp18, esxA, and 16S primers is 20 μM.

M. leprae Probes

1. Perform a 1:10 dilution to make a 1X working stock. This is applicable for all probes (RLEP, hsp18, esxA, and 16s). Probes are ordered as a liquid at a 100 μM concentration.

2. Store all probes at −20°C.

   Probes need to be protected from light by wrapping the tube in aluminum foil or keeping the tube in a small box while it is worked with outside of the freezer. The final concentration of all probes is 10 μM.

NOTE: Each lab may vary in how they choose to order or prepare primers and probes. However, it is important to ensure the 1X concentration for all primers and probes is the same as those listed in this protocol.

Support Protocol 2

PREPARATION OF PLASMID STOCKS AND STANDARD CURVES

This protocol describes how to rehydrate and prepare stock solutions of plasmids and dilute plasmids to create a standard curve used for qPCR. Custom designed plasmids are used to prepare the standard curves for qPCR. One plasmid contains the RLEP sequence, another includes the genes for both esxA and hsp18, and the third includes 16S, all of which are specific to M. leprae. The sequence for RLEP (supplemental Excel file) was cloned into a pUCIDT (Amp) plasmid using custom gene synthesis by Integrated DNA Technologies (IDT). Both sequences for hsp18 and esxA (supplemental Excel file) were cloned into a separate pUCIDT (Amp) plasmid using the same custom gene synthesis from IDT. These genes can be cloned separately into their own respective plasmid if desired. The sequence for 16S was also cloned into a separate pUCIDT (Amp) plasmid using the same custom gene synthesis from IDT.

Materials

Lyophilized plasmid from IDT

Nuclease-free water (Fisher ThermoScientific, CAT# AM9930)

1x TE (Sigma, CAT# T9285) 100X Tris EDTA buffer solution. Use at 1x.

1.5ml conical tubes (Fisher Scientific, CAT# 50809238)

Mini-centrifuge

Vortex Mixer

10μl, 20μl, 200μl, and 1000μl Pipettors

Pipette Tips

Preparation of plasmid stocks

• 1Spin the tube for 30 sec at 10,000 x g prior to opening.
• 2Re-suspend the plasmid DNA in 20 μl of TE by pipetting.
• 3Vortex for 20 sec.
• 4Incubate the tube at RT for 30 min.
• 5Centrifuge for 1 min at 10,000 x g.
• 6Store at −20°C. The plasmid is now at a concentration of 200 ng/μl.

Preparation of “A” dilution for plasmid standard curve

• 7Make a 1:100 dilution of the plasmid by adding 2 μl of plasmid DNA to 198 μl of TE in a 1.5 ml tube. Mix by gently pipetting for 30–45 sec. Let tube sit at RT for 2 min. Label this tube as “Stock (insert name) Plasmid DNA”. Store at −20°C.
• 8Perform a series of five 1:4 serial dilutions for RLEP, starting with 25 μl of “Stock RLEP Plasmid DNA” and 75 μl of TE. Mix each dilution by gently pipetting for 30–45 sec. Let tube sit at room temperature for 2 min before making the next dilution. The tube you stop at will be the “A” dilution of the standard curve.

  The dilution scheme for this step is shown in Figure 8A.

• 9Perform a series of six 1:4 serial dilutions for esxA, hsp18, and 16S, starting with 25 μl of “Stock (esxA, hsp18, or 16S) Plasmid DNA” and 75 μl of TE. Mix each dilution by gently pipetting for 30–45 sec. Let each tube sit at RT for 2 min before making the next dilution. The final tube will be the “A” dilution of the standard curve.

  The dilution scheme for this step is shown in Figure 8B.

Figure 8.

Plasmid dilutions. A) Dilution scheme for making serial dilutions to make a working stock of RLEP plasmid DNA and B) Dilution scheme for making serial dilutions to make a working stock of hsp18/esxA and 16S plasmid DNA.

Preparation of plasmid standard curves

• 10Perform a series of seven 1:4 serial dilutions from the “A” dilution is prepared, starting with 25 μl of the “A” dilution and 75 μl of TE to make dilutions for the standard curve. Mix each dilution by gently pipetting for 30–45 sec. Let each tube sit at RT for 2 min before making the next dilution. These are dilutions “A” through “H” for making the standard curves. Store at 4°C.

  The number of M. leprae per ml for each dilution on the standard curve is shown in Table 5. In our laboratory using a 7500 Fast Real-Time PCR System (Applied Biosciences) and thresholding per the manufacturer’s recommendation, the “A” dilution of the RLEP standard curve gives a C_T value of ~18. The “A” dilution of the esxA, hsp18, and 16S standard curves give a C_T value of ~21.

Table 5.

Number of equivalent M. leprae per ml on each point of the RLEP, hsp18, esxA, and 16S plasmid standard curve.

Standard Curve Dilution	Number of M. leprae per ml
A	2×107
B	5×106
C	1.25×106
D	3.13×105
E	7.81×104
F	1.95×104
G	4.88×103
H	1.22×103

COMMENTARY

Background Information

Since M. leprae cannot be grown on axenic media, traditional methods of determining viability, such as calculating colony-forming units, are impossible. The gold standard for measuring M. leprae viability is the mouse footpad assay (Shepard, 1962; Levy & Ji, 2006). In this assay, M. leprae bacilli are recovered from the clinical or experimental tissue sample and counted by microscopic examination of acid-fast stained smears. This count is total bacteria recovered, both live and dead. To assess if viable M. leprae are present, the suspension is adjusted to an inoculum of 5000 bacilli and injected into the footpads of passage mice. After one year, M. leprae are harvested from the footpads of the passage mice and counted to determine if there was bacterial growth. Theoretically, if there is one viable M. leprae in the inoculum it will multiply to a countable level of ~10⁵ in one year. No growth after one year means that the bacteria in the original sample were dead. While this technique is effective, the amount of time required to obtain results and the costs associated with purchasing and maintaining scores of mice make it impractical for most laboratories.

Several studies have made significant progress toward development of alternative M. leprae viability assays that are simpler and less time-consuming than the mouse footpad assay (Lahiri & Adams, 2016). The most widely used are viability stains (Lahiri R, Randhawa B, & Krahenbuhl J., 2005) and metabolic assays (Franzblau SG, 1988). Both of these techniques, however, require large numbers, 10⁶ to 10⁷, of freshly harvested M. leprae from unfixed host tissues. Furthermore, most metabolic assays utilize radioactive compounds such that appropriate radioactive material user licenses, safety protocols, and disposal methods must be maintained. Due to these limitations, both techniques are primarily used in research laboratories rather than clinical settings. qPCR based assays have so far shown the greatest promise for developing a simple and robust viability assay that is specific, sensitive, rapid, field-friendly, and reliable.

The advantages of the MVA are that it is 1) highly specific for M. leprae; therefore, any co-infection or contamination in the host tissue will not influence the assay results; 2) effective with as few as 1.9×10⁴ M. leprae per tissue sample, a sensitivity that makes it available for most human biopsy samples; 3) field-friendly and can be used on any appropriately fixed host tissue, making it clinically useful; 4) relatively rapid as results can be obtained as little as four days; and 5) reliable and has been extensively validated by comparison with other proven viability assays and optimized using M. leprae preparations with known high and low viability. In addition, the user-friendly NHDP MVA Calculator makes assay quality control, normalization, data calculation, and result interpretation easy and straightforward. There are, however, numerous steps in the protocol and rather sophisticated equipment is required; consequently, this assay is most likely suited for clinical reference laboratories or research laboratories.

We have gone to great lengths to seek the most accurate viability indicators for the MVA, i.e. genes that are abundantly expressed by viable M. leprae but are rapidly degraded once the bacilli become non-viable (Borah et al, 2020; Ojo, Williams, Adams, & Lahiri, manuscript accepted). Most molecular assays to-date measure the presence or absence of the16S rRNA transcript because it is produced in copious amounts and is easily detected. M. leprae 16S rRNA, however, is extremely stable. Like M. leprae DNA, the 16S rRNA can be detected in dead bacilli that have remained in tissues for years (manuscript in preparation). For this reason, 16S rRNA is not a valid indicator of M. leprae viability. Conversely, 16S rRNA expression is an excellent internal control for M. leprae RNA extraction. For example, if a sample is “Undetermined” for esxA and hsp18 expression, indicating dead M. leprae in the sample, one can verify that the RNA extraction was successful by running the 16S rRNA qPCR.

The MVA has been utilized to evaluate new anti-leprosy drugs (Lahiri, Adams, Thomas & Pethe, manuscript accepted), study experimental models of the immunological spectrum of leprosy (Hagge et al, 2014), and search for potential transmission vectors (Tongluan et al, 2021). The MVA is also proving useful in clinical settings to determine whether a patient has viable M. leprae following completion of anti-leprosy regimens or when relapse or re-infection is suspected. The MVA would also be of great benefit in clinical trials of new drugs for leprosy, as programs currently must rely on the mouse footpad assay for confirmation of anti-mycobacterial efficacy.

Critical Parameters

The most crucial aspect of the MVA is the normalization of M. leprae RNA at the reverse transcription step based on the number of M. leprae in the sample. Most reverse transcription-PCR assays normalize the RNA on the basis of total RNA quantity, e.g., 500 ng RNA per reverse transcription reaction. However, in M. leprae-infected tissues, whether human biopsy or mouse footpad, the majority of the RNA recovered will be host derived, and it is impossible to distinguish between host and M. leprae RNA through normal RNA quantification methods. Furthermore, depending on a patient’s position in the leprosy spectrum, the number of M. leprae per biopsy specimen will vary greatly. Therefore, since we are measuring expression of M. leprae transcripts, normalization of RNA based on the number of M. leprae in the sample is imperative for the data to have any meaning.

It is also important to emphasize that a minimum of 1.9×10⁴ M. leprae must be present in the sample in order to normalize the RNA to 3000 bacterial equivalents per reverse transcription reaction. The NHDP MVA Calculator will show an ERROR for samples that do not meet the threshold for normalizing RNA. If the threshold is not met, the MVA cannot be performed on that sample.

While care should be taken in every step of any molecular-based assay, our experience has taught us that certain steps in the MVA protocol are especially sensitive to user manipulation. Do not over-dry the RNA (Basic Protocol 1: Step 59); any moisture seen on the pellets after 10 min of drying is residual water, not ethanol. Second, be sure to frequently agitate the tubes during DNase inactivation (Basic Protocol 1: Step 73). Third, allow a minimum of 2 min incubation at each step when diluting the plasmids (Support Protocol 2). Following these steps precisely will promote a successful outcome. We also recommend making small aliquots of the primers and probes to reduce freezing and thawing. When working with the light-sensitive probes, one should cover the tubes with some form of light blocking material, such as aluminum foil.

The MVA has been optimized for human leprosy lesion biopsy tissues (4–5mm punch biopsy) or mouse footpad tissues that have been fixed in 70% ethanol for at least 24 hr. Ethanol fixation kills the bacilli (Lahiri et al, 2005) and preserves the M. leprae nucleic acids (Fiallo et al., 1992). Human biopsies are best collected from the leading edge of an active leprosy lesion and should be placed in 70% ethanol immediately upon collection. We do not recommend the use of RNA-later as it makes the tissue “rubbery”; subsequently, the fixed tissue does not homogenize well.

Troubleshooting

Problem	Possible Cause	Solution
No DNA/RNA pellet after precipitation	Improper fixation of tissue Inefficient precipitation Extraction failure Contamination	Add an additional 1.5 μls of GlycoBlue during the precipitation step Obtain fresh sample and re-extract
No amplification of standard curve or amplification of negative controls	Master mix prepared incorrectly Contamination	Prepare new master mix correctly Decontaminate working area
Amplification of cDNA that is similar to DNA amplification	DNase failure	Perform the DNase protocol from the beginning with fresh RNA

Understanding Results

Immunocompetent BALB/c mice are quite resistant to M. leprae. If viable M. leprae are inoculated with a low dose of 5000 bacilli, i.e., Shepard’s mouse footpad assay explained above, the organisms will multiply until they reach a plateau of ~10⁵-10⁶ per footpad. Growth ceases at this point due to immune recognition (Welch, Gelber, Murray, Ng, O’Neill & Levy, 1980). If BALB/c mice are inoculated with ≥10⁶ M. leprae per footpad, the bacilli will not multiply as the mice will be immunized. We used this high-dose mouse infection model to validate the MVA and evaluate human leprosy lesion biopsies in which viability is unknown. As shown in Figure 9, footpad tissues from BALB/c mice infected with a high dose of viable M. leprae were harvested on Day 1 (MFP-D1) and at 3months (MFP-3m) post-infection. Human leprosy lesion biopsies were collected from untreated lepromatous leprosy patients. All tissues were fixed in 70% ethanol and stored at −20°C. DNA and RNA were harvested from the infected tissues and processed in the MVA.

Figure 9.

MVA data from mouse footpad tissue and human leprosy lesion biopsy tissue. BALB/c mice were infected with 3×10⁷ viable M. leprae per footpad. Footpad tissues were harvested on Day 1 (MFP-D1) and at 3months (MFP-3m) post-infection. Human leprosy lesion biopsies were collected from untreated lepromatous leprosy patients. All tissues were fixed in 70% ethanol and stored at −20°C. DNA and RNA were harvested from the infected tissues and processed in the MVA. (A) M. leprae were enumerated on the DNA fraction by RLEP qPCR. The dotted line represents the minimum number of M. leprae that must be present in a sample to progress to the reverse transcription step. Molecular viability of M. leprae was determined by measuring the expression of hsp18 (B) and esxA (C) transcripts by qPCR on normalized cDNA derived from the DNased RNA fraction. Dotted lines depict the viability cut-off values determined by ROC analyses.

M. leprae were first enumerated on the DNA fraction by RLEP qPCR (Figure 9A). Approximately 10⁵ M. leprae were recovered from all mouse footpad tissues. There was much greater variability in the number of M. leprae in the human biopsy tissues. All tissues, however, had at least 1.9×10⁴ M. leprae per sample (dotted line).

Based on these counts, each DNased RNA was normalized to 3000 M. leprae equivalents and reverse transcribed. Viability was determined by hsp18 and esxA qPCR. As shown in Figures 9B and C, M. leprae from footpads harvested on Day 1 showed high viability, whereas M. leprae from footpads harvested at 3months had low viability. M. leprae from human biopsies had varying levels of viability.

Normalized RNA from a M. leprae population with a high percent viability will yield about 10⁵ hsp18 and esxA transcripts. This expression will decrease to about 10³ for normalized RNA from a population of M. leprae that is only ~1% viable. Upon examination of >300 M. leprae-infected tissues, a receiver operating characteristic (ROC) curve analysis of the results yielded a viability cut-off value of 1.785×10³ for hsp18 expression and 5.395×10³ for esxA expression (manuscript in preparation). These levels are depicted in Figures 9B and C, respectively. Therefore, each sample can be independently assessed for viability.

It is also important to note that there is no correlation between M. leprae counts and viability. While there was little difference in the number of bacilli at Day 1 and 3 months, the M. leprae from the former population had high viability whereas those from the latter had very low viability. This lack of correlation also held true for the human biopsy samples. This further confirms the importance of normalization step in the MVA.

Time Considerations

It is important to plan properly before starting this assay to allow enough time to reach the appropriate safe stopping points. The MVA can be completed in as few as four days. Working stocks of the primers and probes (Support Protocol 1) and a properly diluted standard curve (Support Protocol 2) can be made prior to beginning Basic Protocols 1–5. Basic Protocol 1 takes two full days to complete. Basic Protocols 3 and 4 can be completed on the third day and Basic Protocol 5 on the fourth day. It is recommended to begin this protocol at the beginning of the week to allow enough time to finish all of the steps as presented.

ETHICS STATEMENT

Human leprosy lesion biopsies were collected after signed informed consent under country approvals (CLTRFI/LWM-IEC 2015–004; NHRC 108/2015) which conform to the standards indicated by the Declaration of Helsinki. Mouse footpad tissues were obtained in accordance with the United States Public Health Service Policy on the Humane Care and Use of Laboratory Animals. The NHDP Institutional Animal Care and Use Committee (Assurance #D16–00019 [A3032–01]) reviewed and approved the protocol and experiments were conducted in accordance with The Guide to Care and Use of Laboratory Animals, Eighth Edition.