Skip to main content
NCBI home page
Cellular and Molecular Bioengineering logoLink to Cellular and Molecular Bioengineering
. 2021 Dec 3;15(2):207–217. doi: 10.1007/s12195-021-00714-8

LINC00852 Regulates Cell Proliferation, Invasion, Migration and Apoptosis in Hepatocellular Carcinoma Via the miR-625/E2F1 Axis

Shi Chen 1,✉
PMCID: PMC8938543  PMID: 35401844

Abstract

Objective

This study investigates the function and regulatory mechanism of lncRNA LINC00852 in hepatocellular carcinoma (HCC) cells.

Methods

The effects of LINC00852 and E2F1 on HCC cell proliferation, invasion, migration and apoptosis were measured by MTT assay, Transwell invasion and migration assays and TUNEL staining, respectively. The apoptosis of HCC cells was further determined by the expression levels of apoptosis-related proteins (Bax and Bcl2). Dual-luciferase reporter assays verified the targeting relationships among LINC00852, miR-625 and E2F1.

Results

Overexpression of LINC00852 was positively associated with HCC cell proliferation, invasion and migration while negatively associated with the cell apoptosis. LINC00852 bound miR-625 which further targeted E2F1. Overexpressing miR-625 or down-regulating E2F1 reversed the oncogenic effects of LINC00852.

Conclusion

LINC00852 regulates HCC cell activities via the miR-625/E2F1 axis.

Keywords: Hepatocellular carcinoma, LINC00852, miR-625, E2F1, Proliferation, Invasion, Migration

Introduction

The disease burden of liver cancer has dramatically increased over the years, which may be largely attributed to the changing population age structure and population growth.12 Liver cancer consists of a heterogeneous group of malignant tumors including hepatocellular carcinoma (HCC), intrahepatic cholangiocarcinoma (iCCA), mixed hepatocellular cholangiocarcinoma, fibrolamellar HCC and pediatric neoplasm hepatoblastoma, among which HCC accounts for 90% of all primary liver cancer cases.21 HCC is usually caused by infection with hepatitis B virus or chronic hepatitis C virus, or it develops under the background of alcoholic liver disease, non-alcoholic fatty liver disease and metabolic disorders.3 Accumulation of somatic genomic alterations in passenger and driver genes as well as epigenetic modifications gives rise to the development of HCC and also results in the molecular heterogeneity of this cancer.11 Therefore, the molecular patterns of HCC are of clinical value for this heterogeneous cancer.

Advanced techniques for RNA-sequencing have contributed to the discovery of numerous RNAs without protein-coding potential during the transcription of genomes.1 Increasing evidence has suggested these non-coding RNAs as versatile orchestrators of cellular activities. Long non-coding RNAs (lncRNAs) are transcripts > 200 nucleotides in length and can regulate cancer phenotypes via various intracellular signaling networks.20 LncRNA MCM3AP-AS1,23 PDPK2P19 and FAL1,6 to name only a few, have been reported to function in HCC. LncRNA LINC00852 is a newly discovered non-coding transcript. Cox regression analysis showed that LINC00852 had significant prognostic value for the recurrence of cervical cancer.27 Another study demonstrated that high expression of LINC00852 might predict low risk of recurrent colon adenocarcinoma and long patient survival.16 However, there has been no report of LINC00852-mediated events in HCC.

LncRNA controls the function of target mRNA by acting as a sponge of microRNA (miRNA). MiRNA-625 (miR-625) has been previously reported to attenuate the mobility of HCC cells by regulating the expression of IGF2BP1.29 Apart from the regulation in HCC, miR-625 also suppressed the malignant behaviors of tumor cells in breast cancer,30 esophageal cancer22 and melanoma.8 Nevertheless, whether there is crosstalk between LINC00852 and miR-625 remains unknown. E2F1 is a transcription factor that contributes to the G1/S transition in cell cycles, and it can also induce transcription of genes involved in apoptosis.4 Available data indicate that E2F1 induces both cell proliferation and apoptosis in HCC, but the proliferative effect of E2F1 seems to surpass the apoptotic one.10

Based on multiple database analysis and experiment verification, we identified the targeting relationships among LINC00852, miR-625 and E2F1. This study elucidates the role of LINC00852 in HCC and how it regulates the activities of HCC cells via the miR-625/E2F1 axis.

Materials and Methods

Tissue Samples

HCC tissues and adjacent normal tissues were obtained from 21 HCC patients enrolled at Hunan Cancer Hospital from 2019 to 2020 with informed consent of all patients or their families. The tissues were immediately placed into liquid nitrogen and preserved at − 80 °C. Experiments of this study were approved by the ethics committee of Hunan Cancer Hospital.

Cell Culture

Normal human liver cell line (LO2) and HCC cell lines (HepG2, Hep3B and Huh-7) were obtained from the cell bank of Chinese Academy of Sciences (Shanghai, China). Human high metastatic HCC cells (HCC-LM9 and HCC-LM3) were purchased from Beyotime (Shanghai, China). All cells were cultured in high-glucose DMEM (Gibco, NY, USA) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, and the culture environment was maintained at 37 °C in 5% CO2 and 95% humidity. Cells grown at logarithmic phase were selected for the following experiments.

Cell Transfection

HepG2 cells at logarithmic phase were cultured in a 6-well plate (2 × 105 cells/well) for 24 h. The cells were transfected with pcDNA3.1 (2 μg), si-NC (2 μg), mimics NC (2 μg), pcDNA3.1-LINC00852 (2 μg), si-LINC00852 (2 μg), pcDNA3.1-E2F1 (2 μg), si-E2F1 (2 μg), miR-625 mimics (2 μg), pcDNA3.1-LINC00852 (2 μg) + miR-625 mimics (2 ug), or pcDNA3.1-LINC00852 (2 μg) + si-E2F1 (final concentration of 100 nM) (Genechem, Shanghai, China). The plasmids were transfected via Lipofectamine 2000 (Invitrogen, NY, USA) following the instruction.

Immunohistochemistry (IHC)

Tissue sections were placed into boiling EDTA buffer (pH = 9.0) for antigen retrieval for 10 min, followed by natural cooling and three PBS washes. The tissues were then incubated with 3% H2O2 solution for inactivation of endogenous peroxidases for another 10 min, followed by three PBS washes. After serum blocking for 30 min, the tissues were incubated with primary antibodies against hepatocyte growth factor (HGF, ab83760, 1:400, abcam, Cambridge, MA, USA), α-fetoprotein (AFP, ab46799, 1:400, abcam) and transforming growth factor β1 (TGF-β1, ab215715, 1:400, abcam) at 4 °C overnight. After three PBS washes, the tissues were incubated with secondary goat anti rabbit IgG (1:5000, Solarbio, Beijing, China) at room temperature for 0.5 h. After another round of PBS washes, the tissues were treated with DAB solution and then hematoxylin for nuclear staining for 3 min. The tissues were immersed in 1% hydrochloric acid-alcohol solution for 1 ~ 3 s, and washed with running water. After that, the tissues were immersed in 0.6% ammonia solution and again washed with running water. Finally, the tissues were dehydrated in gradient alcohol, transparentized by xylene and mounted with neutral balsam.

qRT-PCR

An ultramicro-spectrophotometer NanoDrop 2000 (Thermo Fisher, MA, USA) was used for measurement of the concentration and purity of RNA that was extracted from tissues or cells by TRIzol reagent (Life Technologies, NY, USA). cDNA templates were synthesized through reverse transcription reaction in a PCR amplifier. A fluorescent quantitative PCR analyzer (CFX Connect, Bio-rad, California, USA) was used for real-time quantitative RT-PCR experiments. The expression levels of mRNA and miRNA were normalized to those of GAPDH and U6, respectively. The reaction procedures consisted of 10 min at 95 °C followed by 40 cycles of 10s at 95 °C, 20 s at 60 °C and 34 s at 72 °C. Data were analyzed by the 2-ΔΔCt method.2 ΔΔCt = [Ct(target gene) − Ct(reference gene)]experimental group − [Ct(target gene) − Ct(reference gene)]control group. Amplification primers of each gene and their sequences are shown in Table 1.

Table 1.

Primer sequences.

Name of primer Sequences
LINC00852-F AGGGAGAGCAGTTGGGTTTC
LINC00852-R GACAGTTGGGGTAATGCCCA
miR-625-F GGAGATGGGTGGTGATCAGG
miR-625-R GTGTGCGCGAATCTGTGTTC
Bax-F CGGGTTGTCGCCCTTTTCTA
Bax-R GGGGGTTGATACCACGATCC
Bcl-2-F GGAGGATTGTGGCCTTCTTT
Bcl-2-R TCACTTGTGGCTCAGATAGGC
E2F1-F TACCTTTTCCTGGATGGCGG
E2F1-R AGGTCTCTTCTGGCCTCACT
U6-F TCGCTTCGGCAGCACATATAC
U6-R GCGTGTCATCCTTGCGCAG
GAPDH-F AGGTCCACCACTGACACGTT
GAPDH-R GCCTCAAGATCATCAGCAAT
Open in a new tab

F, forward; R, reverse

Western Blot

Cells were rinsed with precooled PBS for three times and added into 6-well plates. About 150 ~ 250 μL of RIPA lysis buffer (Solarbio, Beijing, China) was added into each well. Every 1 ml of RIPA was added with 10 μL of PMSF to make the final concentration of PMSF 1 mM in the lysis buffer. A pipette was used to blow the cells to make them disperse in the lysis buffer. BCA kits (Vazyme, Nanjing, China) were used to measure the concentration of proteins in the supernatant of cell lysates that were centrifuged at 12,000×g for 5 min. The proteins (30 μg per lane) were separated by 10% SDS-PAGE and transferred onto a polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA). β-actin was used as a loading control herein. After being blocked in 5% non-fat milk at room temperature for 1 h, the membrane was placed into an incubation box and added with rabbit anti human antibodies against GAPDH (3683S, 1:1000), β-actin (4970S, 1:1000), E2F1 (3742S, 1:1000), Bax (5023S, 1:1000), Bcl2 (4223S, 1:1000) (Cell Signaling Technology, Boston, USA), cyclin D1 (ab16663, 1:1000), cyclin E1 (ab33911, 1:1000), CDK2 (ab32147, 1:1000), CDK4 (ab108357, 1:1000), p16 (ab51243, 1:1000) or p27Kip1 (ab32034, 1:1000) (abcam, Cambridge, MA, USA). The antibodies were incubated with the membrane at 4 °C overnight. The membrane was washed with TBST for 3 × 10 min, and then added with horseradish peroxidase-marked goat anti rabbit IgG antibody (1:5000, Solarbio, Beijing, China). The secondary antibody was incubated with the membrane for 1 h, after which the membrane was washed with TBST for 3 × 10 min. Gene expression was visualized and analyzed by a chemiluminiscence imaging system (Tanon Science & Technology, Shanghai, China).

MTT Assay

Transfected cells were added with MTT (5 mg/mL, 20 μL/well, Sigma-Aldrich, Darmstadt, Germany) after cultivation for 24, 48, 72 and 96 h. The culture solution was discarded after incubation for 4 h. The culture plate was then added with DMSO solution (150 μL/well) and gently shaken for 10 min to accelerate crystal dissolution. Optical density (OD) and time were plotted on the Y-axis and X-axis in MTT graphs. OD (540 nm) of each group was measured for three times and averaged.

Transwell Assay

Polyethylene terephthalate (PET) and BD Matrigel-based Transwell inserts (8 μm) were used for migration and invasion assays, respectively. Serum-free cell suspension (2 × 104 cells) was added into sterile 0.6 ml-EP tubes and added with DMEM to reach a total volume of 200 μL. The 24-well plate was added with 800 μL of DMEM containing 15% FBS, and fitted with the Transwell inserts. The upper compartment was added with 200 μL of cell suspension. After 48 h, the Transwell inserts were taken out and the culture medium was discarded. Cells in the plate were washed twice with PBS and fixed by 100% methanol for 10 min. The methanol was discarded before the cells were incubated with Giemsa staining solution for over 40 min. The staining solution was washed off, and noninvasive cells in the upper compartment were removed using a cotton swab. The wells were left air-dried and photographed. The migration and invasion abilities of HCC cells were measured by taking the average number of cells from selected areas and dividing it by the number of control cells. Assays were independently conducted for three times.

TUNEL Staining

Cell apoptosis was revealed by TUNEL assay kits (Thermo Fisher Scientific, Waltham, MA, USA). Three microscopic fields of a slide were imaged, and TUNEL positive cell numbers of these fields were normalized by Abercrombie’s correction factor and averaged.

Dual-Luciferase Reporter Assay

The binding sites of LINC00852, miR-625 and E2F1 were predicted by starBase. Mutated and wild sequences of the binding sites in the 3’untranslated region (UTR) of LINC00852 and E2F1 (MT-LINC00852, WT-LINC00852, MT-E2F1 and WT-E2F1) were designed and synthesized according to the online prediction. The sequence fragments were cloned and inserted into pGL3-Basic vectors (Promega, Madison, USA). The vectors were co-transfected with miR-625 mimic, miR-625 inhibitor or corresponding negative control into HEK293T cells. After 48 h, the luciferase intensity was detected by a dual-luciferase reporter assay kit (Beijing Yuanpinghao Biotechnology Co., Ltd., Beijing, China).

Statistical Analysis

Statistics were analyzed by GraphPad Prism 6.0 (GraphPad Software Inc., La Jolla, CA). Each experimental datum was obtained from three independent experiments, and presented as mean ± standard deviation. T test and one-way analysis of variance were applied to compare differences between two groups or among multiple groups. P < 0.05 was deemed statistically significant.

Results

LINC00852 is HIGHLY Expressed in HCC Tissues

IHC experiments showed that the expression level of HGF was reduced while those of AFP and TGF-β1 were increased in the tumor tissues collected from 21 HCC patients (Figs. 1a–1c, p < 0.05), identifying these samples as HCC tissues. qRT-PCR detected that LINC00852 was highly expressed in the HCC tissues compared with the normal tissues (Fig. 1d, p < 0.05). Moreover, LINC00852 was upregulated in HepG2, Hep3B, Huh-7, HCC-LM3 and HCC-LM9 cell lines compared with the LO2 cell line (Fig. 1e, p < 0.05). The elevation of LINC00852 expression was particularly evident in the HepG2 cell line among these five HCC cell lines. Therefore, HepG2 cell line was chosen to be the subject for this study.

Figure 1.

Figure 1

Open in a new tab

LINC00852 is highly expressed in HCC tissues. HCC tissues and adjacent normal tissues were obtained from 21 HCC patients enrolled at Hunan Cancer Hospital from 2019 to 2020. Immunohistochemistry detected the expression levels of HGF (a), AFP (b) and TGF-β1 (c) in the HCC tissues and adjacent normal tissues; qRT-pCR detected the expression of LINC00852 in the HCC and normal tissues (d) and in HepG2, Hep3B, Huh-7, HCC-LM3, HCC-LM9 and LO2 cell lines (e). *p < 0.05, **p < 0.01, ***p < 0.001. HCC, hepatocellular carcinoma; HGF, hepatocyte growth factor; AFP, α-fetoprotein; TGF-β1, transforming growth factor β1.

LINC00852 Promotes Malignant Behaviors of HCC Cells and Inhibits Cell Apoptosis

pcDNA3.1, pcDNA3.1-LINC00852, si-NC or si-LINC00852 was introduced into HepG2 cells. qRT-PCR detected that the expression of LINC00852 was elevated in the pcDNA3.1-LINC00852 group while reduced in the si-LINC00852 group (Fig. 2a, p < 0.05, vs. the pcDNA3.1 group or si-NC group), indicating successful cell transfection. MTT assay showed that the proliferation of HepG2 cells was promoted in the pcDNA3.1-LINC00852 group while inhibited in the si-LINC00852 group (Fig. 2b, p < 0.05, vs. the pcDNA3.1 group or si-NC group). Transwell assays demonstrated that the invasion and migration of HepG2 cells were also enhanced in the pcDNA3.1-LINC00852 group while repressed in the si-LINC00852 group (Fig. 2c, p < 0.05, vs. the pcDNA3.1 group or si-NC group). Apoptosis-related protein Bax was down-regulated while Bcl2 was up-regulated in the pcDNA3.1-LINC00852 group in comparison with the pcDNA3.1 group (Figs. 2d and 2e, p < 0.05). TUNEL assay further demonstrated that the apoptotic cells were reduced in the pcDNA3.1-LINC00852 group compared with the pcDNA3.1 group (Fig. 2f, p < 0.05). The analysis of flow cytometry showed that overexpression of LINC00852 promoted the G1/S phase transition of HepG2 cells (Fig. 2g, p < 0.05), which was supported by increased expression of cyclin D1, cyclin E1 and CDK2/4 as well as decreased expression of p27Kip1 (Fig. 2h, p < 0.05). Therefore, LINC00852 overexpression-induced increase in HepG2 cells was not entirely due to the decrease in apoptosis, but also due to accelerated cell cycle and proliferation. The above experiment results indicate that LINC00852 promotes the malignant behaviors of HepG2 cells, and inhibits the cell apoptosis.

Figure 2.

Figure 2

Open in a new tab

LINC00852 promotes malignant behaviors of HCC cells and inhibits cell apoptosis. LINC00852 was overexpressed or silenced in HepG2 cells by transfection of pcDNA3.1-LINC00852 or si-LINC00852. (a) qRT-PCR detected the expression of LINC00852 in HepG2 cells transfected with pcDNA3.1, pcDNA3.1-LINC00852, si-NC or si-LINC00852; MTT assay (b) and Transwell assays (c) were used to assess the effect of LINC00852 overexpression or silencing on the proliferation, migration and invasion of HepG2 cells; qRT-PCR (d) and western blotting (e) analyzed the mRNA and protein expression levels of Bax and Bcl2 in HepG2 cells overexpressing LINC00852; (f) TUNEL assay assessed the apoptosis of HepG2 cells overexpressing LINC00852; (g) flow cytometry analyzed the G1/S phase transition of HepG2 cells overexpressing LINC00852; (h) western blotting detected the expressions of cyclin D1, CDK4, p16, cyclin E1, CDK2 and p27Kip1 proteins in HepG2 cells overexpressing LINC00852. *p < 0.05, **p < 0.01. HCC, hepatocellular carcinoma.

LINC00852 Binds miR-625 Which Further Targets E2F1

StarBase analysis showed that LINC00852 had 57 targeted binding sites, and the 3’-UTR of LINC00852 could bind miR-625. The binding sites between LINC00852 and miR-625, and mutated sequence of the binding site of LINC00852 are shown in Fig. 3a. qRT-PCR detected that miR-625 was lowly expressed in HCC tissues (Fig. 3b, p < 0.05). The luciferase intensity was decreased by miR-625 mimic while increased by miR-625 inhibitor in cells transfected with WT-LINC00852 (Fig. 3c, p < 0.05). Both miR-625 mimic and miR-625 inhibitor had no influence to the luciferase intensity in cells transfected with MT-LINC00852 (Fig. 3c, p < 0.05). The above experiment results indicate that LINC00852 can bind miR-625.

Figure 3.

Figure 3

Open in a new tab

LINC00852 binds miR-625 which further targets E2F1. (a) StarBase predicted the binding sites between LINC00852 and miR-625; and the mutated site on LINC00852 was accordingly designed for dual-luciferase reporter assay. (b) qRT-PCR detected the expression of miR-625 in HCC tissues and adjacent normal tissues obtained from 21 HCC patients. (c) Dual-luciferase reporter assay verified the binding between LINC00852 and miR-625, in which HEK-293T cells were transfected with WT-LINC00852 or WT-LINC00852 and miR-625 mimic, mimic NC, miR-625 inhibitor or inhibitor NC. (d) Starbase, PITA, RNA22 and Targetscan analyzed the potential binding targets of miR-625. (e) GEPIA database profiled the expressions of the predicted miR-625-binding genes (PPP2R1A, E2F1, PXMP4, IGF2, CBFA2T3 and PTGIS) in HCC. (f) qRT-PCR detected the expressions of PPP2R1A, E2F1 and PXMP4 mRNAs in miR-625 overexpressing or underexpressing HCC cells. (g) StarBase predicted the binding sites between miR-625 and E2F1; and the mutated site on E2F1 was accordingly designed for dual-luciferase reporter assay. (h) qRT-PCR detected the expression of E2F1 mRNA in HCC tissues and adjacent normal tissues obtained from 21 HCC patients. (i) Dual-luciferase reporter assay verified the binding between miR-625 and E2F1, in which HEK-293T cells were transfected with WT-E2F1 or WT-E2F1 and miR-625 mimic, mimic NC, miR-625 inhibitor or inhibitor NC. (j) qRT-PCR detected the expression of miR-625 in LINC00852 overexpressing or underexpressing HEK-293T cells. qRT-PCR detected the expressions of miR-625 (k) and E2F1 mRNA (l), and western blotting (m) detected the expression of E2F1 protein in HEK-293T cells transfected with miR-625 mimic or mimic NC. *p < 0.05, **p < 0.01. HCC, hepatocellular carcinoma.

StarBase together with PITA, RNA22 and Targetscan further analyzed the downstream targets of miR-625. The online database analysis suggested that miR-625 had 94 targeted binding sites (Fig. 3d). GEPIA database showed that PPP2R1A, E2F1 and PXMP4 were up-regulated while IGF2, CBFA2T3 and PTGIS were down-regulated in HCC tissues (Fig. 3, p < 0.05). Given that LINC00852 acted as a competing endogenous RNA for miR-625, we analyzed the expressions of the up-regulated genes and found that E2F1 expression was correspondingly down-regulated or up-regulated in response to the introduction of miR-625 mimic or miR-625 inhibitor (Fig. 3f, p < 0.05). StarBase predicted the binding sites between miR-625 and E2F1 (Fig. 3g). qRT-PCR revealed high expression of E2F1 in HCC tissues (Fig. 3h, p < 0.05). Dual-luciferase reporter assay showed that the luciferase intensity was decreased by miR-625 mimic while increased by miR-625 inhibitor in the presence of WT-E2F1 (Fig. 3i, p < 0.05). Both miR-625 mimic and miR-625 inhibitor had no influence to the luciferase intensity in cells transfected with MT-E2F1 (Fig. 3i, p < 0.05). The above experiment results demonstrate E2F1 as a downstream target of miR-625.

The targeting relationships among LINC00852, miR-625 and E2F1 were further verified in vitro. HEK-293T cells were given pcDNA3.1-LINC00852, pcDNA3.1, si-LINC00852, si-NC, miR-625 mimic or mimic NC. miR-625 was down-regulated in the pcDNA3.1-LINC00852 group while up-regulated in the si-LINC00852 group (Fig. 3j, p < 0.05, vs. the pcDNA3.1 group or si-NC group). The expression of miR-625 was successfully elevated after the transfection of miR-625 mimic (Fig. 3k, p < 0.05). The expression level of E2F1 was decreased in the miR-625 mimic group compared with the mimic NC group (Figs. 3l–3m, p < 0.05).

E2F1 Exerts Oncogenic Effects in HCC Cells

pcDNA3.1-E2F1, pcDNA3.1, si-E2F1 or si-NC were introduced into HepG2 cells to investigate the function of E2F1. qRT-PCR and western blotting detected that E2F1 was up-regulated in the pcDNA3.1-E2F1 group while down-regulated in the si-E2F1 group (Figs. 4a and 4b, p < 0.05, vs. the pcDNA3.1 group or si-NC group), indicating successful cell transfection. MTT assay showed that the proliferation of HepG2 cells was promoted in the pcDNA3.1-E2F1 group while inhibited in the si-E2F1 group (Fig. 4c, p < 0.05, vs. the pcDNA3.1 group or si-NC group). Transwell assays demonstrated that the invasion and migration of HepG2 cells were also enhanced in the pcDNA3.1-E2F1 group compared with the pcDNA3.1 group (Fig. 4d, p < 0.05). The expression level of Bax was reduced while that of Bcl2 was elevated in the pcDNA3.1-E2F1 group compared with the pcDNA3.1 group (Figs. 4e and 4f, p < 0.05). In contrast, the expression level of Bax was increased while that of Bcl2 was decreased in the si-E2F1 group compared with the si-NC group (Figs. 4e and 4f, p < 0.05). TUNEL assay further demonstrated that the apoptotic cells were reduced in the pcDNA3.1-E2F1 group while increased in the si-E2F1 group (Fig. 4g, p < 0.05, vs. the pcDNA3.1 group or si-NC group). The above experiment results indicate that E2F1 promotes the malignant behaviors of HepG2 cells, and inhibits the cell apoptosis.

Figure 4.

Figure 4

Open in a new tab

E2F1 exerts oncogenic effects in HCC cells. HepG2 cells were transfected with pcDNA3.1-E2F1, pcDNA3.1, si-E2F1 or si-NC. qRT-PCR (a) and western blotting (b) detected the mRNA and protein expression levels of E2F1 in the transfected HepG2 cells; (c) MTT assay assessed the proliferative ability of the transfected HepG2 cells; (d) Transwell assays tested the migration and invasion abilities of the transfected HepG2 cells; qRT-PCR (e) and western blotting (f) analyzed the expression levels of Bax and Bcl2 in the transfected HepG2 cells; (g) TUNEL assay assessed the apoptosis of the transfected HepG2 cells. *p < 0.05, **p < 0.01. HCC, hepatocellular carcinoma.

LINC00852 Regulates HCC Cell Activities via the miR-625/E2F1 Axis

To investigate the regulation of LINC00852 on E2F1, we transfected HepG2 cells with pcDNA3.1, pcDNA3.1-LINC00852, pcDNA3.1-LINC00852 + miR-625 mimic or pcDNA3.1-LINC00852 + si-E2F1. miR-625 was up-regulated in the pcDNA3.1-LINC00852 + miR-625 mimic group while remained unchanged in the pcDNA3.1-LINC00852 + si-E2F1 group compared with the pcDNA3.1-LINC00852 group (Fig. 5a, p < 0.05). E2F1 expression was down-regulated in the pcDNA3.1-LINC00852 + miR-625 mimic group and pcDNA3.1-LINC00852 + si-E2F1 group compared with the pcDNA3.1-LINC00852 group (Figs. 5b and 5c, p < 0.05). MTT assay showed that the proliferation of HepG2 cells was suppressed in the pcDNA3.1-LINC00852 + miR-625 mimic group and pcDNA3.1-LINC00852 + si-E2F1 group compared with the pcDNA3.1-LINC00852 group (Fig. 5d, p < 0.05). Transwell assays demonstrated that the invasion and migration of HepG2 cells were also inhibited in the pcDNA3.1-LINC00852 + miR-625 mimic group and pcDNA3.1-LINC00852 + si-E2F1 group compared with the pcDNA3.1-LINC00852 group (Fig. 5e, p < 0.05). The expression level of Bax was increased while that of Bcl2 was decreased in the pcDNA3.1-LINC00852 + miR-625 mimic group and pcDNA3.1-LINC00852 + si-E2F1 group compared with the pcDNA3.1-LINC00852 group (Figs. 5f–5g, p < 0.05). TUNEL positive cells were increased in the pcDNA3.1-LINC00852 + miR-625 mimic group and pcDNA3.1-LINC00852 + si-E2F1 group compared with the pcDNA3.1-LINC00852 group (Fig. 5h, p < 0.05). Overexpressing miR-625 or down-regulating E2F1 reversed the oncogenic effects of LINC00852 in HCC cells. LINC00852 exerts its function by up-regulating the expression of E2F1 via targeting miR-625.

Figure 5.

Figure 5

Open in a new tab

LINC00852 regulates HCC cell activities via the miR-625/E2F1 axis. HepG2 cells were transfected with pcDNA3.1, pcDNA3.1-LINC00852, pcDNA3.1-LINC00852 + miR-625 mimic or pcDNA3.1-LINC00852 + si-E2F1. qRT-PCR detected the expressions of miR-625 (a) and E2F1 mRNA (b), and western blotting detected the expression of E2F1 protein (c) in the transfected HepG2 cells; (d) MTT assay assessed the proliferative ability of the transfected HepG2 cells; (e) Transwell assays tested the migration and invasion abilities of the transfected HepG2 cells; qRT-PCR (f) and western blotting (g) analyzed the expression levels of Bax and Bcl2 in the transfected HepG2 cells; (h) TUNEL assay assessed the apoptosis of the transfected HepG2 cells. *p < 0.05, **p < 0.01. HCC, hepatocellular carcinoma.

Discussion

The incidence of HCC has dramatically increased over the past decades, and the overall 5-year survival of HCC patients remains at an unfavorable stage. Patients with HCC are most often diagnosed at an advanced stage, and not many therapeutic options are currently available for patients with advanced HCC. Therefore, novel strategies for improving the early detection of HCC are needed to achieve better outcomes. Biomarkers are a group of easily detectable and non-invasive molecules that can be used for disease diagnosis and prognosis, but no single ideal marker has been found in HCC despite numerous efforts.5 This study identified lncRNA LINC00852 as a novel biomarker in HCC, and further uncovered the function and mechanism of LINC00852 in the development of HCC.

LINC00852 was overexpressed in the tumor tissues as well as in five HCC cell lines. An exosome-mediated positive feedback loop between AXL and LINC00852 was found to benefit osteosarcoma cells.17 Liu et al. reported that LINC00852 promoted spinal metastasis of lung adenocarcinoma by stimulating MAPK signaling.18 Consistent with the collected evidence, experimental results of this study indicated that LINC00852 positively regulated the growth and mobility of HCC cells. Moreover, LINC00852 reduced the apoptosis rate of HCC cells. The expression level of pro-apoptotic protein Bax was decreased whereas the expression of anti-apoptotic protein Bcl2 was increased after overexpression of LINC00852 in HCC cells. Subsequently, we investigated the molecules that were regulated by LINC00852 in HCC.

Online database analysis showed that LINC00852 had 57 binding sites. We found that miR-625 could bind to the 3’-UTR of LINC00852 and it was down-regulated in the HCC tissues. miR-625 has been reported to function as a potent regulator in many cancers. miR-625 sensitized gastric cancer cells to multiple chemotherapies by directly repressing the expression of ALDH1A1.13 LINC00958 promoted the growth and metastasis of cervical cancer cells by up-regulating LRRC8E via sponging miR-625-5p.24 On the other hand, miR-625-3p facilitated the migration and invasion of thyroid cancer cells9 and colorectal carcinoma cells.28 The effect of miR-625 seems to depend on which arm it is derived from the precursor of miR-625.

Furthermore, we investigated the binding sites of miR-625 based on multiple database analysis. GEPIA database showed that there were three up-regulated genes and three down-regulated genes in HCC. Among these three up-regulated genes, E2F1 was dysregulated in response to overexpression or inhibition of miR-625. E2F1 was experimentally verified to be a downstream target of miR-625. Abundant expression of E2F1 is observed in late G1/S phase of cell cycle during which it induces transcription of the genes required for DNA synthesis such as CDC2, CDC25A, Cyclin D1 and Cyclin E.7 In addition to the regulation in cell proliferation, E2F1 triggers apoptosis through activation of apoptotic genes as well as inhibition of survival signals.25 Due to the potent mediation of cellular activities, E2F1 has been extensively investigated for its role in tumorigenesis. The beneficial effect of E2F1 seems to be more pronounced than the apoptotic one. For example, SET7/9 promoted the proliferative and invasive abilities of HCC cells by increasing E2F1 abundance.14 The oncogenic effect of E2F1 has also been observed in gastric cancer26 and breast cancer.15

In this study, E2F1 was demonstrated to enhance the proliferative and mobile potential of HCC cells. Also, it inhibited the apoptosis of HCC cells, reflected by reduced expression of Bax and increased expression of Bcl2. Moreover, overexpressing miR-625 or down-regulating E2F1 reversed the oncogenic effects of LINC00852 in HCC cells.

In summary, LINC00852 promotes the malignant behaviors of tumor cells, and suppresses the apoptosis in HCC via the miR-625/E2F1 axis. This study uncovers the role of LINC00852 in HCC, and elucidates a novel molecular axis involved in HCC progression. These findings give new insights into the biomarkers of HCC, and broaden the avenue of molecule targeted therapy for this heterogeneous cancer.

Acknowledgments

Author Contributions

CS conceived the ideas; designed the experiments; performed the experiments; analyzed the data; provided critical materials; wrote the manuscript; supervised the study.All the authors have read and approved the final version for publication.

Funding

This research didn’t receive any funding.

Conflict of interest

The authors report no relationships that could be construed as a conflict of interest.

Ethics Approval and Consent to Participate

Experiments of this study were approved by the ethics committee of Hunan Cancer Hospital.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Beermann J, Piccoli MT, Viereck J, Thum T. Non-coding RNAs in development and disease: Background, mechanisms, and therapeutic approaches. Physiol Rev. 2016;96:1297–1325. doi: 10.1152/physrev.00041.2015. [DOI] [PubMed] [Google Scholar]
  • 2.Burja B, et al. Olive leaf extract attenuates inflammatory activation and DNA damage in human arterial endothelial cells. Front Cardiovasc Med. 2019;6:56. doi: 10.3389/fcvm.2019.00056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Castelli G, Pelosi E, Testa U. Liver cancer: molecular characterization, clonal evolution and cancer stem cells. Cancers (Basel) 2017;9:127. doi: 10.3390/cancers9090127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Chen HZ, Tsai SY, Leone G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 2009;9:785–797. doi: 10.1038/nrc2696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.De Stefano F, et al. Novel biomarkers in hepatocellular carcinoma. Dig. Liver Dis. 2018;50:1115–1123. doi: 10.1016/j.dld.2018.08.019. [DOI] [PubMed] [Google Scholar]
  • 6.Du WW, et al. A circular RNA circ-DNMT1 enhances breast cancer progression by activating autophagy. Oncogene. 2018;37:5829–5842. doi: 10.1038/s41388-018-0369-y. [DOI] [PubMed] [Google Scholar]
  • 7.Ertosun MG, Hapil FZ, Osman-Nidai O. E2F1 transcription factor and its impact on growth factor and cytokine signaling. Cytokine Growth Factor Rev. 2016;31:17–25. doi: 10.1016/j.cytogfr.2016.02.001. [DOI] [PubMed] [Google Scholar]
  • 8.Fang W, et al. microRNA-625 inhibits tumorigenicity by suppressing proliferation, migration and invasion in malignant melanoma. Oncotarget. 2017;8:13253–13263. doi: 10.18632/oncotarget.14710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Fang L, Kong D, Xu W. MicroRNA-625-3p promotes the proliferation, migration and invasion of thyroid cancer cells by up-regulating astrocyte elevated gene 1. Biomed Pharmacother. 2018;102:203–211. doi: 10.1016/j.biopha.2018.03.043. [DOI] [PubMed] [Google Scholar]
  • 10.Farra R, et al. The role of the transcription factor E2F1 in hepatocellular carcinoma. Curr Drug Deliv. 2017;14:272–281. doi: 10.2174/1567201813666160527141742. [DOI] [PubMed] [Google Scholar]
  • 11.Forner A, Reig M, Bruix J. Hepatocellular carcinoma. Lancet. 2018;391:1301–1314. doi: 10.1016/S0140-6736(18)30010-2. [DOI] [PubMed] [Google Scholar]
  • 12.Global Burden of Disease Liver Cancer Collaboration et al. The burden of primary liver cancer and underlying etiologies from 1990 to 2015 at the global, regional, and national level: results from the global burden of disease study 2015. JAMA Oncol. 1990;3(1683–1691):2017. doi: 10.1001/jamaoncol.2017.3055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gong X, Xu B, Zi L, Chen X. miR-625 reverses multidrug resistance in gastric cancer cells by directly targeting ALDH1A1. Cancer Manag Res. 2019;11:6615–6624. doi: 10.2147/CMAR.S208708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gu Y, et al. SET7/9 promotes hepatocellular carcinoma progression through regulation of E2F1. Oncol Rep. 2018;40:1863–1874. doi: 10.3892/or.2018.6621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hollern DP, et al. E2F1 drives breast cancer metastasis by regulating the target gene fgf13 and altering cell migration. Sci Rep. 2019;9:10718. doi: 10.1038/s41598-019-47218-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Jin L, Li C, Liu T, Wang L. A potential prognostic prediction model of colon adenocarcinoma with recurrence based on prognostic lncRNA signatures. Hum Genomics. 2020;14:24. doi: 10.1186/s40246-020-00270-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Li Q, et al. Exosome-transmitted linc00852 associated with receptor tyrosine kinase AXL dysregulates the proliferation and invasion of osteosarcoma. Cancer Med. 2020;9:6354–6366. doi: 10.1002/cam4.3303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Liu P, et al. LINC00852 promotes lung adenocarcinoma spinal metastasis by targeting S100A9. J Cancer. 2018;9:4139–4149. doi: 10.7150/jca.26897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Pan W, et al. lncRNA-PDPK2P promotes hepatocellular carcinoma progression through the PDK1/AKT/Caspase 3 pathway. Mol Oncol. 2019;13:2246–2258. doi: 10.1002/1878-0261.12553. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 20.Schmitt AM, Chang HY. Long noncoding RNAs in cancer pathways. Cancer Cell. 2016;29:452–463. doi: 10.1016/j.ccell.2016.03.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sia D, Villanueva A, Friedman SL, Llovet JM. Liver cancer cell of origin, molecular class, and effects on patient prognosis. Gastroenterology. 2017;152:745–761. doi: 10.1053/j.gastro.2016.11.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wang Z, et al. miR-625 down-regulation promotes proliferation and invasion in esophageal cancer by targeting Sox2. FEBS Lett. 2014;588:915–921. doi: 10.1016/j.febslet.2014.01.035. [DOI] [PubMed] [Google Scholar]
  • 23.Wang Y, et al. A novel lncRNA MCM3AP-AS1 promotes the growth of hepatocellular carcinoma by targeting miR-194-5p/FOXA1 axis. Mol Cancer. 2019;18:28. doi: 10.1186/s12943-019-0957-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wang L, et al. LINC00958 facilitates cervical cancer cell proliferation and metastasis by sponging miR-625-5p to upregulate LRRC8E expression. J Cell Biochem. 2020;121:2500–2509. doi: 10.1002/jcb.29472. [DOI] [PubMed] [Google Scholar]
  • 25.Wu Z, Zheng S, Yu Q. The E2F family and the role of E2F1 in apoptosis. Int J Biochem Cell Biol. 2009;41:2389–2397. doi: 10.1016/j.biocel.2009.06.004. [DOI] [PubMed] [Google Scholar]
  • 26.Xu TP, et al. E2F1 induces TINCR transcriptional activity and accelerates gastric cancer progression via activation of TINCR/STAU1/CDKN2B signaling axis. Cell Death Dis. 2017;8:e2837. doi: 10.1038/cddis.2017.205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zhang Y, et al. Identification of potential prognostic long non-coding RNA biomarkers for predicting recurrence in patients with cervical cancer. Cancer Manag Res. 2020;12:719–730. doi: 10.2147/CMAR.S231796. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zheng H, et al. MiR-625-3p promotes cell migration and invasion via inhibition of SCAI in colorectal carcinoma cells. Oncotarget. 2015;6:27805–27815. doi: 10.18632/oncotarget.4738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Zhou X, et al. miR-625 suppresses tumour migration and invasion by targeting IGF2BP1 in hepatocellular carcinoma. Oncogene. 2016;35:5078. doi: 10.1038/onc.2016.61. [DOI] [PubMed] [Google Scholar]
  • 30.Zhou WB, et al. miR-625 suppresses cell proliferation and migration by targeting HMGA1 in breast cancer. Biochem Biophys Res Commun. 2016;470:838–844. doi: 10.1016/j.bbrc.2016.01.122. [DOI] [PubMed] [Google Scholar]

Articles from Cellular and Molecular Bioengineering are provided here courtesy of Springer

RESOURCES