Isoquercitrin isolated from newly bred Green ball apple peel in lipopolysaccharide-stimulated macrophage regulates NF-κB inflammatory pathways and cytokines

Abstract

Apple peel has several bioactive properties. The fruit is grown worldwide, and its ingredients are used medicinally. However, its anti-inflammatory activities are poorly characterized. In this study, isoquercitrin isolated from newly bred Green ball apple peel from Korea showed anti-inflammatory effects. To confirm its anti-inflammatory effects, isoquercitrin was treated with lipopolysaccharide, which induces proinflammatory factors in Raw 264.7 macrophage cells. Proinflammatory effects were measured by real-time polymerase chain reaction and Western blotting as well as enzyme-linked immunosorbent assay. Cell viability was measured using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay to define the isoquercitrin concentration nontoxic to cells. Nitric oxide (NO) production, prostaglandin E₂, inducible NO synthase, cyclooxygenase-2 (COX-2), and nuclear factor-κB p65 protein expression decreased in a concentration-dependent manner by isoquercitrin. mRNA expression of tumor necrosis factor-α, interleukin (IL)-1β, IL-6, monocyte chemoattractant protein-1, and prostaglandin E synthase 2 (PTGES2) as proinflammatory factors significantly decreased. PTGES2, which was stimulated by COX-2 and involved in PGE₂ expression, was inhibited. Therefore, this study rendered isoquercitrin isolated from the newly bred Green ball apple peel as a potential pharmacological alternative to treat inflammation-related diseases.

Introduction

Screening biologically active materials present in medicinal plants, vegetables, and fruits and developing them as functional materials are beneficial and important in new material development (Yu et al. 2021). Most studies have been done on the whole apple or tree; the commonly studied compounds are carotene, phenolic compounds (viz., procyanidin, chlorogenic acid, caffeic acid, quercetin, and rutin), and flavonoids (Yun et al. 2007). Particularly, quercetin flavanol is an active ingredient in many plant medicines and is used in a variety of products (“Condition,” CJ HealthCare, Seoul, Korea; “Quercetin with bromelain,” iHerb, Moreno Valley, CA, USA). Apples have been researched extensively because they are rich in nutrients and have good biological activities. Apples are known to be good for health; however, in people—who suffer from gastritis—eat apples, the acid in the apples can make the inflammation worse. Because apple contains various useful ingredients, the fruit can be used in various fields. These positive effects are due to high dietary fiber and antioxidants, vitamins, and flavonoids in vegetables and fruits (Mignard et al. 2021; Wina et al. 2021). Flavonoids present abundantly in plants are beneficial in removing superoxide radicals and maintaining an endogenous antioxidant defense system (Lee et al. 2020a, b).

An inflammatory response is a normal defense mechanism against external stimuli to regenerate and repair damaged tissues. When inflammation is activated in the body, inflammatory cells, such as macrophages, secrete inflammatory mediator proteins, cytokines associated with inflammation, and inflammation transporters (Cho and An 2008; Sikora et al. 2020). Therefore, among chemokines, monocyte chemoattractant protein-1 (MCP-1) selectively induces monocytes, lymphocytes, and basophils as CC chemokines. Interleukin (IL)-1β, tumor necrosis factor-α (TNF-α; Kim et al. 2004a), low-density lipoprotein, and the like are produced in stromal cells (Cho et al. 2009), glomerular endothelial cells, tubular epithelial muscle cells, capillary endothelial cells, and smooth muscle cells and contribute to inflammation (Turan et al. 2018). Therefore, macrophages are thus responsible for the major defense mechanisms of the body’s immune system and are produced and transported from the bone marrow (Mahla et al. 2021). When a virus or foreign cell enters the body, macrophages produce substances, such as hydrogen peroxide and nitric oxide (NO), to specifically remove the foreign particle (Turan et al. 2018; Xu et al. 2020). Through the secretion of cytokines and enzymes, such as phosphatase, macrophages control inflammation and hematopoietic organs by regulating the body’s immune system (Sigola et al. 2016; Sikora et al. 2020).

Apple is a well-known fruit, but there is little research on the effects of apple peels (Kris-Etherton et al. 2002). There is also little information on the functional properties related to inflammatory regulation. Also, no studies have been conducted on the anti-inflammatory effects of Green ball apple isolated isoquercitrin. Therefore, this study investigated how Green ball apples affect antioxidant activity, and the anti-inflammatory effects of isoquercitrin isolated from the peel on inflammation-related factors activated by lipopolysaccharide (LPS) stimulation, such as cell oxidation, were verified.

Materials and methods

Materials

New breed varieties “Green ball” apple (Malus domestica Borkh.) used in this experiment were bred and developed using Golden Delicious and Fuji as a mating combination at the Apple Research Institute, National Institute of Horticultural and Herbal Science, Rural Development Administration. The variety was developed in 2008 and applied to the Korea Seed & Variety Service in 2009 (grant no. 3595; application no. 2009-15). Green ball apples were harvested from the Apple Research Institute on September 06, 2017, in Gunwi, Korea. Fruits that were flawless, rotten, or disease free were screened and harvested and immediately moved to the laboratory at Kyungpook National University (Daegu, Korea).

Extract preparation from Green ball apple peel

Green ball apple peel and whole apples were desiccated in a 45 °C dry oven for 24 h and ground to 40 meshes. To prepare the extract, 1 g sample powder was added to distilled water and 70% ethanol (100 mL), and extraction was performed for 24 h with a shaking incubator at room temperature. The extract was filtered using filter paper (Hyundai Micro, Seoul, Korea). This extract was used to measure the total phenolic content (TPC), hyaluronidase (HAase), and antioxidant. The samples to be used for separation and purification were added to 290 g sample powder to 5 L of 70% ethanol. The mixture was stirred and extracted for 24 h at 120 rpm using a shaker incubator. The extract was filtered, concentrated using a rotary vacuum evaporator (Eyela NE, Tokyo, Japan), and stored at − 20 °C after lyophilization.

TPC measurement in extracts

TPC was measured by referring to the method of Folin and Denis (1912). TPC was measured at 725 nm using an absorbance instrument (Optizen 3220UV, Mecasys, Daejeon, Korea). For the measurement, 1 N Folin-Ciocalteu reagent was used for color development, and the results were measured within 1 h. The expressed color was obtained by leaving it for 5 min, and 1 mL sodium carbonate (Na₂CO₃) was added. TPC was quantified using a gallic acid standard curve, and the isoquercitrin content was calculated.

Purification conditions by column chromatography

Green ball apple extract preparation and purification were performed according to the method of Lee et al. (2017). In brief, 70% ethanol (5 L) was added to 290 g apple peel powder, immersed, and extracted twice for 24 h. The extract was filtered using filter paper and concentrated in a rotary pressure concentrator (IKA RV 8; IKA, Breisgau, Germany). The powder extracted with 70% ethanol was controlled at medium-pressure liquid chromatography with ODS-SM-50B (50 μm; Yamazen, Japan). The compounds were separated into three fractions (Fr.1, Fr.2, and Fr.3) based on absorbability. A water/methanol (55:45) gradient system (0 → 100%) was used for elution at a flow velocity of 20 mL/min. Next, the eluted compound was identified by thin-layer chromatography. Finally, 36.75 mg isoquercitrin (compound 1) was isolated from the lyophilized solid powder (98 g; yield ratio of 0.0375%) and used in this experiment.

Identification of the chemical structure

The conditions for using a micromelting point were measured with a 1 mg sample. Infrared spectra were received by halogenated alkali purification. A 1 mg purely separated compound was composited to 100 mg KBr solid, and the mixture was pressurized to produce an isolated substance. ¹H and ¹³C nuclear magnetic resonance (NMR) spectra were obtained using AVANCE III HD 500 MHz NMR spectrometer (Bruker, Germany) at the KBSI Western Seoul Center. NMR spectra were obtained using proton magnetic resonance (300 MHz; Bruker AM-300, Japan) by the pulse Fourier transform method and dissolving 10 mg eluted pure refined 5% to 20% solvent [CDCl₃ + dimethyl sulfoxide (DMSO)-D6 + D₂O]. Tetramethylsilane [(CH₃)4Si] was used as reference material. Negative-ion fast atom bombardment-mass spectrometry (FAB-MS; Jeol JMS-PX 300, Tokyo, Japan) was measured using 1 mg powder at decompressed phase (10⁻⁴–10⁻⁶ mmHg) by the chemical analysis method.

Molecular structure modeling was visualized using the Avogadro-1.2.0n program (Minimal Mistakes, Inc., Buffalo, NY, USA; Fig. 1a).

Fig. 1.

MTT assay of isoquercitrin (6.25–100 μM) on cell viability in Raw 264.7 cells (5 × 10³ cells/mL). a Structure of the isolated biological compound (isoquercitrin) from Green ball apple peel. b The cell viability was assessed using the MTT reduction assay. The results are expressed as the percentage of surviving cells compared to the negative control group (no addition of isoquercitrin). c Cell morphological changes were monitored by inverted phase-contrast microscopy. Representative photomicrographs of the morphological changes are presented (magnification, × 200). d Cell numbers were counted in cell culture plates after incubation with isoquercitrin for 12 and 24 h. Data are the mean ± standard deviation (SD) of three independent experiments. #p < 0.05 compared to the negative control group; **p < 0.01 compared to the negative control group

HAase inhibitory effect assay

A 0.05 mL HAase solution (7900 U/mL) dissolved in 0.1 M acetate buffer (pH 3.5) and 0.1 mL extracts were mixed and incubated for 20 min at 37 ℃. Then, 12.5 mM calcium chloride (0.1 mL) was added, and hyaluronic acid (HA; 12 mg/mL) dissolved in 0.1 M acetate buffer (pH 3.5) was added as substrate. Next, 0.1 mL of 0.4 N potassium tetraborate and 0.1 mL of 0.4 N sodium hydroxide solutions were added to the reacted mixture and boiled in a water bath. Then, 3 mL ρ-dimethylaminobenzaldehyde—a color-forming reagent—was added to the cooled mixture and incubated for 20 min at 37 ℃. Absorbance was measured at 585 nm, and the inhibitory activity was calculated as reported previously (Reissig et al. 1955).

Cell line and cell culture

Raw 264.7 cells, which are macrophages derived from mice, were bought from the American Type Culture Collection (TIB-71™; Manassas, VA, USA). Cells were cultured in mixed Dulbecco’s modified Eagle’s medium (HyClone Laboratories, Inc., Logan, UT, USA) containing 10% fetal bovine serum (HyClone Laboratories) and 1% penicillin/streptomycin (100 units/mL; HyClone Laboratories) at 37 °C in a 5% CO₂ incubator for 24 h (Lee 2011).

Cell cytotoxicity determination by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay

Cytotoxicity was measured according to the protocol of Carmichael et al. (1987). Crude cells were seeded in 48-well plates at a density of 5 × 10³ cells/mL and cultured for 24 h at 37 °C in a 5% CO₂ hatchery. Then, 50 μL samples at different concentrations (isoquercitrin; 6.25–100 μM) were added and incubated for 24 h at 37 °C with 5% CO₂. Next, a 50 μL MTT solution (5 mg/mL; Sigma Chemical Co., St. Louis, MO, USA) was added and allowed to react for 4 h. After the medium of each well was removed, 500 μL DMSO was added and allowed to react for 30 min at room temperature. Absorbance was measured at 540 nm using an enzyme-linked immunosorbent assay (ELISA) reader (SPECTROstar Nano, BMG LABTECH, Ortenberg, Germany).

Determination of NO production

NO activity was measured using the Griess reaction kit (Griess reagent; Sigma Chemical). Cells were seeded in 96-well plates at a density of 5 × 10⁴ cells/mL. Then, cells were stimulated with 1 μg/mL LPS (Sigma Chemical), followed by adding 0.2 mL isoquercitrin (6.25–25 μM) after 1 h and cultured at 37 °C in a 5% CO₂ incubator. After 24 h, 0.1 mL supernatant was reacted with Griess reagent, and the absorbance at 540 nm was measured to determine NO production (Cho and An 2008; Ryu et al. 2003).

Determination of prostaglandin E₂ (PGE₂) production

Cells were seeded in 96-well plates at a density of 1 × 10⁶ cells/mL. The medium was removed, and all wells were stimulated with 1 μg/mL LPS, except for the negative control group. After 1 h, LPS-stimulated cells were treated with isoquercitrin and incubated for 24 h. The supernatant was collected. The PGE₂ production level was investigated using enzyme immunoassay (EIA) kits (R&D Systems, Inc., Minneapolis, MN, USA), according to the manufacturer’s instructions (Turan et al. 2018; Xu et al. 2020; Sigola et al. 2016; Namkoong et al. 2015).

Western blotting analysis

To investigate the expression of inducible NO synthase (iNOS), cyclooxygenase-2 (COX-2), and nuclear factor-κB (NF-κB) p65 protein, cells were seeded in six-well plates at a density of 5 × 10⁴ cells/mL. After stabilization, the medium was removed, and all wells were stimulated with 1 μg/mL LPS. After 1 h, 25 μM isoquercitrin from Green ball apple peel was dissolved in distilled water and cultivated for 24 h. After treatment for 24 h, cell morphological changes were photographed using a microscope at × 400 magnification (Nikon, Tochigi, Japan). After the medium was removed and washed twice in cold phosphate-buffered saline (PBS), the protein was eluted with 100 μL radioimmunoprecipitation assay buffer [50 mM Tris–HCl, 150 mM NaCl, 1% Triton X-100, 0.1% sodium dodecyl sulfate (SDS), 0.5% sodium deoxycholate, 1 mM EDTA, 10 mM NaF, 1 mM Na₃VO₄, and protease inhibitor], and cells were scraped into a precooled 1.5 mL tube and centrifuged at 16,000 × g at 4 °C for 20 min. The supernatant was retrieved, and the protein content was determined using the Bradford assay (Thermo Scientific, Rockford, IL, USA). According to the concentration, 20 μg protein from each group was loaded into the wells of 10% SDS–polyacrylamide gel electrophoresis. The gel was run for 90 min at 110 V, after which the proteins were transferred onto a polyvinylidene fluoride membrane. Next, 5% skim milk was used to block the membrane for 1 h at room temperature. Next, the membranes were incubated by diluting primary antibodies at 4 °C overnight. The primary antibodies were iNOS and β-actin (1:1000 in 5% skim milk; #sc-7271, and #sc-47778; Santa Cruz Biotechnology, Dallas, TX, USA); COX-2 (1:500 in 5% skim milk; #33345; Signalway Antibody, College Park, MD, USA); NF-κB p65 and p-NF-κB p65 (1:1000 in 5% skim milk; #6956 T and #3036S; Cell Signaling Technology, Danvers, MA, USA); and glyceraldehyde 3-phosphate dehydrogenase (1:1000 in 5% skim milk; #MA5-15738; Thermo Fisher Scientific). The membranes were washed with TBST and secondary antibodies mouse anti-rabbit IgG horseradish peroxidase (1:1000; sc-2357; Santa Cruz Biotechnology) and goat anti-mouse IgG (1:1000; 31430; Thermo Fisher Scientific) and reacted for 1 h. Finally, protein bands were detected using ECL solution (Millipore, Bedford, MA, USA) and images of the blots were captured by a Molecular Imager (Bio-Rad Laboratories, Inc.) on each band (Cho 2011).

Determination of proinflammatory cytokine level

Cells were seeded in 96-well plates at a density of 1 × 10⁶ cells/mL. The medium was removed, and all wells were treated with 1 μg/mL LPS. After 1 h, isoquercitrin was administered to cells and incubated for 24 h. Next, the supernatant of cells, in which the reaction was completed, was separated, and gene expression of proinflammatory cytokines (TNF-α, IL-1β, and IL-6) was confirmed by EIA kits (R&D Systems). The proinflammatory cytokine level was quantified according to the manufacturer’s manual, and gene expression of proinflammatory cytokines was calculated using standard curves obtained from the reactions of the reference materials (Turan et al. 2018; Xu et al. 2020; Sigola et al. 2016; Namkoong et al. 2015).

Gene expression of proinflammatory markers by real-time polymerase chain reaction (PCR)

Gene expression of proinflammatory markers in Raw 264.7 cells stimulated with LPS was determined by culturing 5 × 10⁶ cells/mL in a 100 × 20 mm culture dish. Cells were cultured for 24 h before treatment. Cells were treated with 1 μg/mL LPS and isoquercitrin (6.25–25 μM), recultured for 24 h, and washed with PBS. Total RNA was extracted using the GeneAll^® Ribospin RNA extraction kit (GeneAll Biotechnology Co., Seoul, Korea) to compare the mRNA expression of proinflammatory factors. cDNA was synthesized using qPCRBIO cDNA synthesis kit (PCR Biosystems, London, UK). Synthesized cDNA (1 µL), real-time PCR master mix (5 μL; GeneAll Biotechnology), primer (Macrogen, Seoul, Korea), and nuclease-free water (Promega, Madison, WI, USA) were used. Real-time mRNA expression of each gene was analyzed using a PCRmax Eco 48 real-time PCR system (PCRmax, Staffordshire, UK). Real-time PCR conditions and primer sequences are shown in Table 1.

Table 1.

Primer sequences of real-time PCR for proinflammatory activity

Factors	Accession	Primer	Sequence (5′–3′)	Amplicon (bp)
TNF-α	NM_001278601.1	Forward	TCTACTGAACTTCGGGGTGA	87
		Reverse	AGGGTCTGGGCCATAGAACT
IL-1β	NM_008361.4	Forward	CAACCAACAAGTGATATTCTCCATG	152
		Reverse	GATCCACACTCTCCAGCTGCA
IL-6	NM_031168.2	Forward	TAGTCCTTCCTACCCCAATTTCC	76
		Reverse	TTGGTCCTTAGCCACTCCTTC
MCP-1	NM_011333.3	Forward	TTCCTCCACCACCATGCAG	64
		Reverse	CCAGCCGGCAACTGTGA
PTGES2	NM_133783.2	Forward	CCGTGAGAAGGACTGAGATC	162
		Reverse	AAGTGATGACCTCTTCCAGG
β-Actin	NM_007393.4	Forward	CGTGCGTGACATCAAAGAGAA	137
		Reverse	GCTCGTTGCCAATAGTGATGA

Evaluation of Raw 264.7 cell morphology

Raw 264.7 cells were cultured and treated as described above. Cell morphological changes were photographed at × 200 and × 400 magnifications (Nikon).

Statistical analyses

All tests and experiments were done in triplicate (n = 3). Statistical analysis was conducted using a one-way analysis of variance in the SPSS 26 program (Statistical Package for the Social Sciences, Chicago, IL, USA). Duncan’s multiple range tests were performed to analyze differences. *p < 0.05 and **p < 0.01 indicated a significant difference.

Results

Biological activities of peel and whole apple extracts of newly bred Green ball apple

Plants produce various phytochemicals that are secondary metabolites of their defense mechanisms, and they are known to exert various biological activities (Lee et al. 2007; Park et al. 2018). The highest TPC was found in the ethanol extract of the peel (Table 2). Therefore, it was assumed that the Green ball apple peel extract would have greater biological activity than the whole extract. HAase is an enzyme that breaks down HA and makes the skin dry, which causes skin troubles or inflammation. Therefore, to evaluate the biological activity of Green ball apple peel and whole extract, this study evaluated the antioxidant effects (TBARs) and inhibitory activity against HAase. As shown in Table 2, the inhibitory activity on HAase and antioxidant effects of the Green ball apple peel extract was greater than the whole extracts.

Table 2.

TPC and HAase inhibition and antioxidant activity in water and ethanol extracts from the peel and whole Green ball apple

Source	TPC (mg/g)		HAase inhibition activity (%)		Antioxidant (TBAR) activity (%)
	Water extract	Ethanol extract	Water extract	Ethanol extract	Water extract	Ethanol extract
Whole	2.68 ± 0.04aα	3.49 ± 0.03aβ	7.96 ± 0.97aα	11.05 ± 0.78aβ	38.22 ± 4.60aα	43.66 ± 8.60aβ
Peel	5.30 ± 0.32bα	8.31 ± 0.20bβ	7.41 ± 0.77bα	20.78 ± 1.00bβ	60.29 ± 6.80bα	75.92 ± 8.14bβ

Means with different superscript letters (a, b, α, and β) are significantly different at p < 0.05 (Duncan’s multiple range tests)

Isolation and purification of active single ingredient from Green ball apple peel

The decontaminated compound was a colorless powder with a dissolving point of 234–236 °C, the point of turn [$[{\mathit{\alpha }]}_{\mathit{D}}^{25}$] was 19.5°, and the atomic weight at positive FAB-MS was 464. The active group of 3300 (OH) and 1650 (C=O) in the KBr IR spectrum (cm⁻¹) was determined (Table 3).

Table 3.

Spectroscopic data of the isolated anti-inflammation compound from the Green ball apple peel

Melting point (°C)	234–236
FAB-MS (m/z)	464.39
1H-NMR (600 MHz, MeOD)	7.86 (1H, brd, H-2′), 7.60 (1H, d, J = 6.0, H-6′), 6.87 (1H, d, J = 8.4, H-5′), 6.41 (1H, d, J = 1.8, H-8), 6.21 (1H, brd, H-6), 5.17 (1H, d, J = 7.8, anomeric),3.50–3.87 (sugar moiety)
13C-NMR (150 MHz, MeOD)	180.0 (C=O), 166.5 (C-7), 163.5 (C-9), 159.3 (C-5),158.9 (C-2), 150.4 (C-4′), 146.3 (C-3′), 136.3 (C-3),123.5 (C-6′), 123.4 (C-1′), 118.3 (C-5′), 116.6 (C-2′), 106.1 (C-10), 105.9 (C-1″), 100.4 (C-6), 95.2 (C-8),78.9 (C-3″), 77.7 (C-4″), 75.6 (C-2″), 73.7 (C-5″), 70.5 (C-6″)

Cell viability analysis after isoquercitrin treatment

Toxicity in the composition of isoquercitrin with interaction with macrophage Raw 264.7 cells was determined by the MTT assay. As shown in Fig. 1b, the isoquercitrin compound reaction on cell viability was concentration dependent. The viability of Raw 264.7 cells was significantly reduced at 50 and 100 µM concentrations. To determine whether cell viability is reduced by isoquercitrin treatment, the number of cells was measured at 0, 12, and 24 h after isoquercitrin treatment. As a result, when treated for 12 h as in Fig. 1d, the number of cells decreased at 50 and 100 μM treatment concentrations. Cell decrease was even more pronounced after 24 h (p < 0.01). Furthermore, isoquercitrin treatment of cells caused a change in cell morphology due to toxicity (Fig. 1c). The shape of normal Raw 264.7 cells was smooth and had rounded edges. However, when stimulated with LPS or activated toxicity, irregular polygonal shapes and thin and elongated pseudopodia were formed (Chon et al. 2009). Under normal conditions, most macrophages were small and round with smooth edges and surfaces (nontreated group). However, exposure to LPS significantly altered the morphology of macrophages, which acquired an irregular polygonal shape (LPS group, 50 and 100 μM). These changes indicated that LPS and high-concentration (50 and 100 μM) samples promoted inflammation or induced toxicity in Raw 264.7 cells. However, at low-concentration (6.25–25 μM) samples, the morphological change of macrophages did not occur; thus, toxicity to the cells did not occur. Therefore, Western blotting and real-time PCR experiments were conducted at isoquercitrin concentrations of ≤ 25 µM at > 80% cell viability.

Effect of isoquercitrin treatment on proinflammation cytokine production

Macrophages play a crucial role in regulating inflammatory and host defense mechanisms. When inflammation occurs, macrophages, which migrate to the inflammation site, recognize LPS. Toll-like receptor 4 is stimulated by LPS to activate Myd88, a universal adapter protein used to stimulate NF-κB (Turan et al. 2018). Through these pathways, activation of NF-κB and inflammatory-related factors increases the activity of cytokine genes, such as TNF-α, IL-6, and IL-1β, which are the most essential LPS receptors for signaling (Cho et al. 2009; Kim et al. 2004a). Therefore, this study determined whether isoquercitrin regulates the expression of cytokine, a factor involved in inflammation (Kim et al. 2004a). The activity of isoquercitrin as a proinflammatory cytokine inhibitory agent was measured by treatment with 6.25–25 μM concentrations in stimulated Raw 264.7 cells by LPS. In Fig. 2, LPS treatment resulted in significant increases in the production of TNF-α, IL-1β, and IL-6. In Fig. 2a–f, to confirm the effects of isoquercitrin on the cytokine (TNF-α, IL-1β, and IL-6), as a result of measuring with EIA kits and mRNA gene expression levels, production decreased depending on the treated concentration. In the mRNA expression level using real-time PCR, cytokine was slightly more significantly regulated, confirming that isoquercitrin regulates cytokine. Based on the above results, an experiment was conducted to confirm the effect of isoquercitrin on the expression of proinflammatory proteins (iNOS and COX-2) involved in cytokine production and factors produced by the activity of this protein.

Fig. 2.

Effects of isoquercitrin on TNF-α, IL-1β, and IL-6 in stimulated Raw 264.7 cells with LPS. Raw 264.7 cell lines have different TNF-α, IL-1β, and IL-6 expression patterns. Raw 264.7 cells were treated with LPS (1 µg/mL) and various concentrations (6.25–25 μM) of isoquercitrin and further incubated for 24 h. The proinflammatory markers (a and b) TNF-α, (c and d) IL-1β, and (e and f) IL-6 were measured by EIA kits and real-time PCR. Based on gene expression quantification of EIA kit analysis, relative mRNA gene expression was normalized to β-actin. Normal group (Nor) measurements were obtained in the absence of LPS. The negative control group (Con) was treated only with LPS. Data are the mean ± SD of three independent experiments. #p < 0.05 compared to Con; **p < 0.01 compared to the positive control group

Effect of isoquercitrin treatment on iNOS and NO production

In NOS in mammalian cells, there are three similar forms: endothelial NOS (eNOS), neuronal NOS (nNOS), and iNOS. Although eNOS and nNOS are always produced in the body, iNOS is induced by inflammatory factors (Nathan 1992). In particular, iNOS results in the imbalance of NO concentration, resulting in NO-activated guanylate cyclase and, ultimately, cell toxicity (Lee et al. 2007). Consequently, a reduction in the iNOS protein levels in macrophages stimulated with LPS is expected to yield an inflammation inhibitory effect. iNOS also defends against pathogens and is closely linked with inflammatory diseases, circulatory disorders, and cancers. When treated with 25 μM isoquercitrin, iNOS protein expression decreased by 62% in the positive control (Fig. 3a and b). As NO is a free radical, it is extremely unstable and transforms into more stable forms, such as NO₂, NO₃, NO₄, NO₂⁻, or NO₃⁻. Normally, the formation of NO is engaged in many uses in biological processes, such as the immune system, cytotoxic neurotransmitter system, and vascular relaxation (Kim et al. 2004b), but excess NO formation results in inflammation, gene mutations, and organ or nerve damage (McCartney-Francis et al. 1993; Moncada et al. 1991). To investigate whether isoquercitrin has anti-inflammatory effects in LPS-stimulated Raw 264.7 cells, this study examined its inhibitory effects on LPS-induced NO production. The positive control group stimulated with LPS showed threefold greater NO expression than the negative control group. The inhibitory effect against NO production was observed at concentrations between 6.25 and 25 μM (Fig. 3c). According to the above results, isoquercitrin was involved in producing NO and iNOS, which are free radicals. Reduction of NO production and suppression of iNOS gene expression may have therapeutic benefits in treating inflammation. Therefore, isoquercitrin was thought to affect the immune function, anti-inflammatory response in macrophages stimulated with LPS, and transcription of the expression factors involved. In addition, this study investigated the effects on COX-2 activated by NF-κB inflammatory pathways and the factors produced by COX-2 activity.

Fig. 3.

Effects of isoquercitrin on a and b iNOS, c NO production, and d morphological changes in stimulated Raw 264.7 cells with LPS. Raw 264.7 cells were treated with LPS (1 µg/mL) and various concentrations (6.25–25 μM) of isoquercitrin and further incubated for 24 h. Cell morphological changes were monitored by inverted phase-contrast microscopy. Representative photomicrographs of the morphological changes are presented (magnification, × 400). The normal group was obtained in the absence of LPS. The negative control group was treated only with LPS. Data are the mean ± SD of three independent experiments. #p < 0.05 compared to the negative control group; ** p < 0.01 compared to the positive control group

Effect of isoquercitrin treatment on COX-2, PGE₂, and PTGES2 production

COX-2 expression in monocytes augments the production of inflammation inhibitory factors, such as TNF-α, IL-1β, fibroblast growth factor, and phosphatidic acid. NO and PGE₂ are synthesized by iNOS and COX-2 in macrophages under inflammatory conditions, respectively. Additionally, COX-2 induces the inhibition of inflammation inhibitory factors, such as glucocorticoids, IL-4, and IL-13. Consequently, in Raw 264.7 macrophages, the anti-inflammatory effect can be achieved by decreasing the levels of the COX-2 protein (Kim et al. 2004a; Surh 2002). To confirm the anti-inflammatory effects of isoquercitrin on Raw 264.7 cells, some inflammatory-related factors were detected by Western blotting analysis and real-time PCR. Isoquercitrin (25 μM) decreased COX-2 protein expression by 82% (Fig. 4a and b). The inflammatory mediator as a PGE₂ was formed by the COX-2 enzyme process of an inflammatory reaction. COX-2 is a key enzyme for the biosynthesis of prostaglandins. In this process, PGH₂ produced by COX-2 is catalyzed by the downstream enzyme PTGES2 and converted to PGE₂, which increases blood flow and pain (Xu et al. 2020). COX-2 is an inducible enzyme contributing to prostaglandin production in the settings of inflammation and cancer. This study showed that isoquercitrin (25 μM) had a 27% PGE₂ inhibition rate (Fig. 4c), and the inhibitory activity declined in a concentration-dependent manner. Moreover, PTGES2, a synthase of PGE₂, was also regulated by isoquercitrin in the amount of mRNA. Therefore, this study determined that isoquercitrin regulates the expression of iNOS and COX-2 proteins. Next, this study examined the potential mechanism of the inhibitory effects of isoquercitrin on LPS-induced inflammation. The NF-κB signaling pathway is one of the most important signaling pathways that control the synthesis and release of inflammatory mediators in activated macrophages. Therefore, the expression level of NF-κB p65 protein, which is known to affect the activation of iNOS and COX-2 proteins, was further investigated in the nucleosol and cytosol of macrophages (Kim et al. 2007).

Fig. 4.

Effects of isoquercitrin on a and b COX-2, c PGE₂, and d PTGES2 production in stimulated Raw 264.7 cells with LPS. Raw 264.7 cells were treated with LPS (1 µg/mL) and various concentrations (6.25–25 μM) of isoquercitrin and further incubated for 24 h. The proinflammatory-related markers COX-2, PGE₂, and PTGES2 were measured by Western blotting, EIA kits, and real-time PCR. The normal group was obtained in the absence of LPS. The negative control group was treated only with LPS. Data are the mean ± SD of three independent experiments. #p < 0.05 compared to the negative control group; ** p < 0.01 compared to the positive control group

Effect of isoquercitrin treatment on NF-κB p65 and MCP-1 production

When stimulation, such as LPS, is given outside the cell, the signal is transferred into the cell, and phosphorylation of IκBα (inhibitor of NF-κB), an inhibitory protein of NF-κB, occurs. Phosphorylated IκBα is degraded, and NF-κB phosphorylation occurs. Subsequently, phosphorylated NF-κB migrates into the nucleus and proceeds with the transcription of NF-κB inhibition factors related to other proteins, such as iNOS, COX-2, and cytokines (Kim et al. 2011; Li and Verma 2002). Therefore, macrophages and NF-κB are considered important cellular and molecular screening targets for anti-inflammatory drugs. MCP-1 is a cytokine, a protein secreted by immune cells called chemokines. It regulates the migration of immune cells. In the early stages of inflammation, inflammatory cells, such as monocytes, play a role in gathering inflammation. MCP-1-mediated monocytes differentiate into macrophages and are expressed by the NF-κB p65 protein, thereby activating COX-2, secreting inflammatory cytokines (TNF-α, IL-6, and interferon), and exacerbating the inflammatory response (Lee 2011; Kim et al. 2016). In addition, the effects of isoquercitrin on the activation of NF-κB in LPS-stimulated Raw 264.7 cells were also analyzed by Western blotting using p-NF-κB p65/NF-κB p65 antibodies. Figure 5a and b shows that LPS significantly induced NF-κB p65 phosphorylation. NF-κB p65 protein and MCP-1 expression were reduced by 25 μM isoquercitrin (Fig. 5a–c). Therefore, isoquercitrin inhibited NF-κB protein and MCP-1 expression. These data indicated that isoquercitrin significantly inhibits LPS-induced production of the key inflammatory mediators in macrophages, which suggested that it is a potential inhibitor of the initial inflammatory response to LPS stimulation. The expression levels of iNOS and COX-2, which are phosphorylated and regulated by NF-κB signals, and NO produced by iNOS, and PGE₂ or PTGES2 mediated by COX-2, were also suppressed. According to the above results, isoquercitrin, an active ingredient isolated from Green ball apple peel, regulated inflammatory proteins, cytokines, and related factors generated by NF-κB inflammatory pathways stimulated by LPS. Therefore, it is considered suitable for the research and development of functional materials used in the food industry.

Fig. 5.

Effects of isoquercitrin on a and b NF-κB p65 and c MCP-1 production in stimulated Raw 264.7 cells with LPS. Raw 264.7 cells were treated with LPS (1 µg/mL) and various concentrations (6.25–25 μM) of isoquercitrin and further incubated for 24 h. The proinflammatory-related markers NF-κB p65 and MCP-1 were measured by Western blotting and real-time PCR. The normal group was obtained in the absence of LPS. The negative control group was treated only with LPS. Data are the mean ± SD of three independent experiments. #p < 0.05 compared to the negative control group; **p < 0.01 compared to the positive control group

Discussion

Western blotting analysis showed that isoquercitrin had an inhibitory effect on iNOS, COX-2, and NF-κB p65 protein, which are related to the induction of inflammation. Although isoquercitrin works in a dose-dependent manner, isoquercitrin showed inhibition of inflammatory processes in macrophages exposed to LPS by inhibiting iNOS, COX-2, and NF-κB p65 protein expression along with reduced cytokine (TNF-α, IL-1β, IL-6, PGE₂, PTGES2, and MCP-1) production. Based on Lee et al. (2018), this study investigated the inflammation-inducing factor similar to that of isoquercitrin. NO production, iNOS, COX-2, NF-κB p65 protein expression, and cytokine (TNF-α, IL-1β, and IL-6) production were measured. However, isoquercitrin showed similar or better results compared to the present results. Recently, the saucerneol D component of elicitor-treated Saururus chinensis reported by Lee and Cho (2021) showed an inhibitory effect on the cytokines (TNF-α, IL-1β, and IL-6) induced by LPS, thus reporting the potential for development as an anti-inflammatory agent. Therefore, isoquercitrin also showed a higher cytokine inhibitory effect, which showed potential as an excellent material. Isoquercitrin decreased the expression levels of COX-2 and iNOS, which are regulators involved in PGE₂ and NO expression. Therefore, the production of PGE₂ and NO was decreased. Additionally, the results demonstrated that NF-κB p65 expression levels decreased. Hong et al. (2021) and Lee et al. (2020a, b) studied the excellent effects on proinflammatory-related proteins and the factors involved in inflammation. Compared to recent studies, isoquercitrin was also effectively inhibited, which proved that it is an excellent material for inhibiting inflammation. NF-κB p65 was involved in the production of HA, one of the structural proteins of the skin. NF-κB p65 is an upstream regulator involved in inflammatory signaling. Therefore, isoquercitrin may affect the factors associated with inflammatory formation. In the functional food business, procyanidin, vitamins, phosphatidylserine, tricin, p-coumaric acid, proanthocyanidin, and ellagic acid have been certified as functional ingredients for antioxidants and skin health improvement and are widely used as ingredients. Therefore, by regulating the inflammatory pathways of isoquercitrin verified in this study, it was judged to be effective when used as a functional ingredient.

Conclusions

Inflammation inhibitory effects were measured by ELISA, Western blotting, and real-time PCR for inflammation-related factors utilizing isoquercitrin isolated from Green ball apple peel. As a result, NO expression was suppressed by isoquercitrin. iNOS, COX-2, and NF-κB p65 protein expressions were inhibited in a concentration-dependent manner. mRNA expression of proinflammatory markers TNF-α, IL-1β, IL-6, MCP-1, and PTGES2 was significantly suppressed. Besides, monocytes collected by MCP-1 were differentiated into macrophages and stimulated by inflammatory cytokines (TNF-α, IL-1β, and IL-6) and COX-2 involved in the inflammatory response, thereby inhibiting PTGES2 involved in PGE₂ expression (Fig. 6). Kim et al. (2007) reported that poncirin isolated from Poncirus trifoliata had inhibitory effects on iNOS, COX-2, NF-κB, and cytokines. Poncirin and Green ball apple from isoquercitrin were active ingredients in this study and acted as biomarkers that inhibited factors involved in inflammation. Cho et al. (2009) also suggested that zedoarondiol—an active ingredient isolated from Curcuma heyneana—acts on inflammatory cytokines (TNF-α, IL-1β, and IL-6). There are still many reports on the side effects of synthetic drugs. Therefore, to cope with this, the ingredients of natural materials should be thoroughly studied. Through various research results, materials that can be used for inflammation should be developed.

Fig. 6.

Isoquercitrin regulates NF-κB inflammatory signaling pathways and cytokines on LPS-stimulated macrophages

Abbreviations

COX-2

Cyclooxygenase-2

DMSO

Dimethyl sulfoxide

HA

Hyaluronic acid

HAase

Hyaluronidase

IL

Interleukin

iNOS

Inducible nitric oxide synthase

LPS

Lipopolysaccharide

MCP-1

Monocyte chemoattractant protein-1

MTT

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

NF-κB

Nuclear factor-κB

NO

Nitric oxide

PBS

Phosphate-buffered saline

PCR

Polymerase chain reaction

PGE₂

Prostaglandin E₂

PTGES2

Prostaglandin E synthase 2

TNF-α

Tumor necrosis factor-α

Author contributions

EL contributed to conceptualization, methodology, visualization, and writing––original draft. HP was involved in conceptualization, investigation, writing––review and editing. HJ contributed to validation and data curation. IK and BK were involved in visualization and formal analysis. YC contributed to supervision and writing––review and editing.

Funding

Not applicable.

Availability of data and materials

All data analyzed during this study are included in this published article.

Declarations

Conflict of interest

The authors declare that they have no competing interests.