Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2022 Mar 22;88(6):e02239-21. doi: 10.1128/aem.02239-21

Characterization of GefA, a GGEEF Domain-Containing Protein That Modulates Vibrio parahaemolyticus Motility, Biofilm Formation, and Virulence

Xiaojun Zhong a,#, Zhong Lu a,#, Fei Wang a, Ning Yao a, Mengting Shi a, Menghua Yang a,
Editor: Charles M Dozoisb
PMCID: PMC8939336  PMID: 35108083

ABSTRACT

Vibrio parahaemolyticus is a significant foodborne pathogen that causes economic and public health problems worldwide and has a high capacity to adapt to diverse environments and hosts. The second messenger cyclic diguanylate monophosphate (c-di-GMP) allows bacteria to shift from a planktonic form to a communal multicellular lifestyle and plays an important role in bacterial survival and transmission. Here, we characterized single-domain c-di-GMP synthetases in V. parahaemolyticus and identified a novel GGEEF domain-containing protein designated GefA that modulates bacterial swarming motility, biofilm formation, and virulence. GefA inhibits swarming motility by regulating the expression of lateral flagella, while it enhances biofilm formation by controlling exopolysaccharide biosynthesis. Under high-c-di-GMP conditions caused by scrABC knockout, we found that GefA is bifunctional, as it has no effect on swarming motility, but retains the ability to regulate biofilm formation. Subsequent studies suggested that GefA regulates the expression of type III secretion system 1 (T3SS1), which is an important virulence factor in V. parahaemolyticus. Here, we also revealed that the flagella participate in the infection of V. parahaemolyticus. We found that both the T3SS1 and flagella contribute to the GefA-mediated virulence of V. parahaemolyticus in the zebrafish model. Our results expand the knowledge of the V. parahaemolyticus c-di-GMP synthetases and their roles in social behaviors and pathogenicity.

IMPORTANCE The c-di-GMP metabolic enzymes constitute one of the largest clusters of potential orthologues in Vibrio parahaemolyticus. However, the specific roles that these individual c-di-GMP metabolic enzymes play are largely unknown. Here, we identified a GGEEF domain-containing protein designated GefA that regulates bacterial behaviors and virulence. We also demonstrated that flagella participate in the infection of this bacterium, through which GefA regulates bacterial virulence. To our knowledge, the roles that c-di-GMP and flagella play in V. parahaemolyticus virulence have never been revealed. Our findings contribute to a better understanding of the function of c-di-GMP and its synthetases in V. parahaemolyticus.

KEYWORDS: Vibrio parahaemolyticus, c-di-GMP, GGDEF, swarming motility, biofilm formation, virulence

INTRODUCTION

To survive in complex external environments, bacteria have developed multiple strategies to synchronize their behaviors at the community level, which enable bacterial populations to solve problems that single bacterial cells cannot. The second messenger cyclic diguanylate monophosphate (c-di-GMP) plays a central role in regulating a wide spectrum of processes and phenotypic behaviors, such as cell morphology, antimicrobial tolerance, motility, biofilm formation, and virulence (1, 2). The intracellular concentration of c-di-GMP is controlled by the diguanylate cyclases (DGCs) and phosphodiesterases (PDEs) (2, 3). DGCs contain a GGD(/E)EF amino acid motif and produce c-di-GMP, while PDEs contain the EAL or HD-GYP domains and degrade c-di-GMP (13). The c-di-GMP metabolic enzymes constitute one of the largest clusters of potential orthologues in bacteria, and the cellular c-di-GMP homeostasis is dynamic and highly regulated (2, 4).

Vibrio parahaemolyticus is a Gram-negative, foodborne pathogen that thrives in warm climates within marine or estuarine environments (5, 6). It commonly causes acute gastroenteritis, which is associated with the consumption of raw or undercooked seafood (5). In rare cases, Vibrio parahaemolyticus septicemia has been reported (6). To adapt to fluctuating environmental conditions, V. parahaemolyticus must transition from a planktonic form to a communal multicellular lifestyle, which is directed by c-di-GMP and the surface colonization regulatory (Scr) program (7, 8). The Scr module is composed of ScrABC, and mutating scrABC increases cellular c-di-GMP (8). High levels of the second messenger c-di-GMP favor biofilm formation but inhibit swarming motility (810). Biofilm formation in V. parahaemolyticus requires exopolysaccharides (EPSs) to form an intercellular matrix (9, 11). The EPS synthesis cluster includes epsA to epsJ and is regulated by the c-di-GMP receptors, including CpsQ and CpsS (10, 12, 13). Swarming motility relies on the production of lateral flagella, which is regulated negatively by an increase in c-di-GMP levels (7, 14, 15). Although many c-di-GMP metabolic enzymes have been identified in V. parahaemolyticus genomes, their specific functions remain unexplored.

Although many virulence factors have been shown to contribute to the pathogenicity of V. parahaemolyticus, the pathogenesis remains incompletely understood, especially the mechanisms whereby the bacteria modulate gene expression according to external signals during infection (1619). c-di-GMP has been shown to regulate virulence gene expression and thus impact bacterial infection or transmission (20). In the late-stage infection of V. cholerae, the expression of several DGC and PDE genes is induced (21). Moreover, the VieSAB three-component system can regulate c-di-GMP concentration by the PDE VieA and further modulate bacterial virulence (2224). Therefore, c-di-GMP is an important external molecule to regulate bacterial infection. However, the role that c-di-GMP plays in V. parahaemolyticus virulence remains unclear.

As the GGD(/E)EF and EAL domains often reside in the same protein and many GGD(/E)EF or EAL domain-containing proteins have a regulatory domain, such as GAF and PAS, these hybrid proteins are multifunctional and their activity is frequently modulated by various mechanisms (2, 3, 25). To rapidly screen the c-di-GMP metabolic enzymes that contribute to the maintenance of c-di-GMP levels in V. parahaemolyticus, we carried out systematic research of the DGCs that contain only the GGD(/E)EF domain in the present study. We identified a novel GGEEF domain-containing protein designated GefA, which can synchronize bacterial behaviors and regulate V. parahaemolyticus virulence. These findings contribute to a better understanding of the specific roles that the individual c-di-GMP metabolic enzymes play in the regulation of c-di-GMP homeostasis and the behaviors of V. parahaemolyticus.

RESULTS

Identification of the single-domain DGCs that affect the swarming motility of V. parahaemolyticus.

Forty-four GGD(/E)EF family proteins were predicted in the V. parahaemolyticus genomes (https://www.ncbi.nlm.nih.gov/Complete_Genomes/c-di-GMP.html) (2, 4), and a further conserved domain analysis of these proteins revealed that only 11 proteins are single-domain DGCs (see Table S1 in the supplemental material). VP0699 and VP2076 are encoded on chromosome 1, while VPA0059, VPA0068, VPA0184, VPA0202, VPA0360, VPA0739, VPA0925, VPA1457, and VPA1478 are encoded on chromosome 2 (Fig. 1A). A further amino acid motif analysis confirmed that a conserved GGD(/E)EF domain exists in these DGCs except VPA0059, which contains a AGDEF motif (Fig. 1B and Fig. S1 in the supplemental material).

FIG 1.

FIG 1

Bioinformatics analysis of the single-domain DGCs in V. parahaemolyticus. (A) Distribution of the single-domain DGCs in the genomes of V. parahaemolyticus. The circular diagram depicts the location of 11 single-domain DGCs on the V. parahaemolyticus chromosome 1 and 2. Maps were established using the software CGView ServerBETA (http://cgview.ca/). (B) Protein sequence alignment of the single-domain DGCs. This area is part of Fig. S1. The red dotted line highlights the GGD(/E)EF motif.

To analyze the specific role that these single-domain DGCs play in the regulation of bacterial behaviors, we constructed gene deletion mutants of all these DGCs except for vp0699, vpa0739, and vpa0925. As lower levels of c-di-GMP favor the swarming motility of V. parahaemolyticus, we then compared the abilities of these mutants and the wild-type (WT) strain to swarm over solid agar. Δvpa0202 and Δvpa1478 strains exhibited a significantly increased swarming motility compared with that of the WT strain, while the swarming motility of the other mutant strains was not different compared with that of the WT strain (Fig. 2). These results suggested that both VPA0202 and VPA1478 were functional in V. parahaemolyticus and could regulate bacterial motility.

FIG 2.

FIG 2

Swarming motility of the WT and DGC gene mutant strains. The single swarming colony from the WT, Δvp2076, Δvpa0059, Δvpa0068, Δvpa0184, Δvpa0202, Δvpa0360, Δvpa1457, and Δvpa1478 strains. The migration diameter of the swarming colonies was measured by using ImageJ software. The migration of at least 3 biological replicates of each strain of interest was analyzed. The unpaired two-tailed Student’s t test was used for statistical analysis (**, P < 0.01).

Both VPA0202 and VPA1478 inhibit swarming through the activity of diguanylate cyclase.

To confirm the regulation of the swarming motility by VPA0202 and VPA1478, we overproduced these proteins in the corresponding deletion mutant and WT strains from plasmid pBAD24 containing an arabinose inducible promoter and analyzed the effect on swarming motility. We found that the overexpression of either VPA0202 or VPA1478 had a noticeable effect on the swarming motility. The strains with the pBAD24-VPA0202 or pBAD24-VPA1478 had a significant decrease in swarming motility compared with that of the corresponding strain with the empty plasmid pBAD24 (Fig. 3A and B).

FIG 3.

FIG 3

Both VPA0202 and VPA1478 inhibit swarming motility and rely on the GGEEF domain. (A) The swarming colony and the migration diameter of WT::pBAD24, WT::pBAD24-VPA0202, Δvpa0202::pBAD24, and Δvpa0202::pBAD24-VPA0202 strains. (B) The swarming colony and the migration diameter of WT::pBAD24, WT::pBAD24-VPA1478, Δvpa1478::pBAD24, and Δvpa1478::pBAD24-VPA1478 strains. (C) The swarming colony and the migration diameter of WT::pBAD24-VPA0202, WT::pBAD24-VPA0202GGAAA, Δvpa0202::pBAD24-VPA0202, and Δvpa0202::pBAD24-VPA0202GGAAA strains. (D) The swarming colony and the migration diameter of WT::pBAD24-VPA1478, WT::pBAD24-VPA1478GGAAA, Δvpa1478::pBAD24-VPA1478, and Δvpa1478::pBAD24-VPA1478GGAAA strains. (E) The swarming colony and the migration diameter of WT::pBAD24, WT::pBAD24-VPA0202, Δvpa1478::pBAD24, and Δvpa1478::pBAD24-VPA0202 strains. (F) The swarming colony and the migration diameter of WT::pBAD24, Δvpa0202::pBAD24, Δvpa0202::pBAD24-VPA1478, and Δvpa0202::pBAD24-VPA1478GGAAA strains. The migration diameter of the swarming colonies was measured by using ImageJ software. The migration of at least 3 biological replicates of each strain of interest was analyzed. The unpaired two-tailed Student’s t test was used for statistical analysis (*, P < 0.05; **, P < 0.01; ***, P < 0.001).

Bioinformatics analysis showed that a conserved GGEEF domain exists in the C terminus of VPA0202 and VPA1478 (see Fig. S2 in the supplemental material). To evaluate whether the GGEEF motif contributes to the function of VPA0202 and VPA1478, we constructed the pBAD24-VPA0202GGAAA and pBAD24-VPA1478GGAAA plasmids in which the GGEEF amino acids were changed to GGAAA. We observed that the strain with the GGAAA variant plasmid had a significant increase in swarming motility compared with that of the strain with the WT plasmid (Fig. 3C and D). In addition, we replenished vpa0202 to the gene native locus of the Δvpa0202 strain and created the CΔvpa0202WT and CΔvpa0202GGAAA strains, and the results of the swarming motility of these strains were consistent with that of Fig. 3C (see Fig. S3 in the supplemental material). Therefore, the GGAAA variant motif disturbed the function of VPA0202 and VPA1478. These results suggested that both VPA0202 and VPA1478 carry an active DGC and the GGEEF domain is essential for their mediated swarming motility.

To investigate the relationship between VPA0202 and VPA1478 in modulating cellular c-di-GMP levels, the Δvpa0202 and Δvpa1478 strains were introduced with pBAD24-VPA1478 and pBAD24-VPA0202, respectively, and analyzed by swarming motility assays. We found that the swarming ability was significantly decreased in the Δvpa1478 strain when the VPA0202 protein was overproduced, and the VPA1478 protein exhibited the same function in the Δvpa0202 strain (Fig. 3E and F). These results indicated that VPA0202 and VPA1478 contribute equally to mediating swarming motility in V. parahaemolyticus. We then designated VPA0202 as GGEEF family protein A (GefA) and performed a series of assays to assess its specific roles and the underlying mechanisms in V. parahaemolyticus.

GefA inhibits swarming motility by regulating the expression of lateral flagella.

V. parahaemolyticus has two different flagellar morphologies, including polar flagellum and lateral flagellum (15). To investigate if the polar or the lateral flagellum is affected by GefA to regulate the swarming motility, we first generated the polar flagellum mutant strain ΔflgE and the lateral flagellum mutant strain ΔlfgB. We found that deletion of flgE, which encodes the hook protein of polar flagellum, caused a significant defect in V. parahaemolyticus swarming motility and swimming decreased compared with the WT strain (Fig. 4A and B). In contrast, by knocking out lfgB, which encodes the lateral flagellar basal body protein, the swarming motility significantly decreased in this mutant while the swimming motility was intact (Fig. 4A and B). The motility phenotypes of ΔflgE and ΔlfgB indicate that the polar flagellum is critically employed for swimming motility, yet facilitates swarming motility to some extent, and the lateral flagellum is employed primarily in swarming motility.

FIG 4.

FIG 4

GefA inhibits swarming motility and regulates the expression of lateral flagella. (A) The swarming colony and the migration diameter of WT, ΔgefA, ΔlfgB, ΔlfgBΔgefA, ΔflgE, and ΔflgEΔgefA strains. (B) The swimming colony and the migration diameter of WT, ΔgefA, ΔlfgB, ΔlfgBΔgefA, ΔflgE, and ΔflgEΔgefA strains. The migration diameter of the colonies was measured by using ImageJ software. The migration of at least 3 biological replicates of each strain of interest was analyzed. (C) The expression level of lfgB was assessed by measuring luminescence in PlfgB-lux transcriptional fusion strains. (D) The expression level of fliM was assessed by measuring luminescence in PfliM-lux transcriptional fusion strains. Luminescence expression was calculated as the luminescence per unit of OD600. All data were presented as means ± SD deviation of triplicate samples from three independent experiments. The unpaired two-tailed Student’s t test was used for statistical analysis (nonsignificant [ns], P > 0.05; **, P < 0.01; ***, P < 0.001).

To assess GefA activity in the ΔflgE or ΔlfgB background, we generated the double gene mutant strains of ΔflgEΔgefA and ΔlfgBΔgefA. We found that GefA could still inhibit swarming motility in the ΔflgE mutant which has the intact lateral flagellum but a dysfunctional polar flagellum; however, GefA could no longer modulate V. parahaemolyticus motility without LfgB (Fig. 4A). These results indicated that GefA regulates swarming motility depending on the lateral flagellum.

To further investigate the mechanism by which GefA modulates the function of the lateral flagellum, we then analyzed the expression of the lateral flagellum in the WT or ΔgefA strains by using a bioluminescence reporter, pBBR-lux, which contained the lateral flagellar gene promoters (PlfgB and PfliM). The promoter activities of PlfgB-lux and PfliM-lux were both increased significantly in the ΔgefA and CΔgefAGGAAA strains compared with those in the WT and CΔgefAWT strains (Fig. 4C and D). In addition, the expression of the polar flagellum was measured by using pBBR-lux containing the polar flagellar gene promoters (PflaD and PflaK), and the results showed that the activities of the promoters were both identical in the WT and gefA relevant mutant strains (see Fig. S4 in the supplemental material). Thus, GefA inhibits swarming motility by regulating the expression of lateral flagella in V. parahaemolyticus.

GefA modulates biofilm formation and EPS biosynthesis in V. parahaemolyticus.

Biofilms are complex communities of microorganisms, which contribute to bacterial environmental survival and transmission (26). The EPS is a key chemical component in the biofilm formation of V. parahaemolyticus, and the expression of EPS is mediated by the c-di-GMP level (1, 10, 11). To analyze if the absence of gefA could alter the biofilm formation of V. parahaemolyticus, the WT, ΔgefA, CΔgefAWT, and CΔgefAGGAAA strains were cultivated for 36 h and assayed using crystal violet staining. We found that ΔgefA and CΔgefAGGAAA strains exhibited a significant biofilm decrease compared with the WT and CΔgefAWT strains (Fig. 5A). This result indicated that GefA could modulate biofilm formation in V. parahaemolyticus.

FIG 5.

FIG 5

GefA modulates biofilm formation and EPS expression. (A) Biofilm formation of WT, ΔgefA, CΔgefAWT, and CΔgefAGGAAA strains. Biofilm formation was measured by using crystal violet staining and quantified by measuring OD595 at 36 h. (B) Schematic diagram showing the genetic organization of the EPS synthesis cluster in V. parahaemolyticus. The arrows indicate the direction of transcription. (C) The expression level of EPS was assessed by measuring luminescence in Peps-lux transcriptional fusion strains. (D) The expression level of cpsQ was assessed by measuring luminescence in PcpsQ-lux transcriptional fusion strains. All data were presented as means ± SD deviation of triplicate samples from three independent experiments. The unpaired two-tailed Student’s t test was used for statistical analysis (*, P < 0.05; **, P < 0.01; ***, P < 0.001).

The EPS synthesis cluster includes mainly epsA to epsJ in V. parahaemolyticus (Fig. 5B) (1113). We then evaluated if the expression of EPS could be affected by GefA. The promoter region of epsA to epsJ was ligated with bioluminescence reporter pBBR-lux, which was further introduced into WT, ΔgefA, CΔgefAWT, and CΔgefAGGAAA strains. The promoter activity of Peps-lux was significantly decreased in ΔgefA and CΔgefAGGAAA strains compared with that in the WT and CΔgefAWT strains (Fig. 5C).

Previous studies have demonstrated that CpsQ can bind the second messenger c-di-GMP and further mediate the bacterial EPS production (10, 14). We wanted to evaluate if the expression level of cpsQ could also be affected by GefA. Therefore, the promoter region of cpsQ was ligated with bioluminescence reporter pBBR-lux and then introduced into the WT, ΔgefA, CΔgefAWT, and CΔgefAGGAAA strains. We found that the promoter activity of PcpsQ-lux was significantly decreased in ΔgefA and CΔgefAGGAAA strains compared with that in the WT and CΔgefAWT strains (Fig. 5D), which was consistent with that of Peps-lux. These results suggested that GefA may modulate biofilm formation by controlling EPS biosynthesis in V. parahaemolyticus.

GefA plays different roles in swarming and biofilm formation in high-c-di-GMP strain.

Previous studies have indicated that the deletion of scrABC increases biofilm formation but inhibits swarming motility, which is due to the increased cellular c-di-GMP levels (8, 27). As GefA contains a GGEEF motif and belongs to a DGC, we then evaluated the relationship between GefA and ScrABC in regulating swarming and biofilm formation in V. parahaemolyticus. Both ΔgefAΔscrABC and ΔscrABC strains almost lost their swarming ability compared with the WT strain (Fig. 6A). By testing the expression of the lateral flagellum in the scrABC deleted strains, we found that the promoter activity of PlfgB-lux was decreased significantly in both ΔgefAΔscrABC and ΔscrABC strains compared with that in WT and ΔgefA strains (Fig. 6B). These results indicated that GefA does not affect swarming under the high-c-di-GMP conditions caused by scrABC knockout in V. parahaemolyticus.

FIG 6.

FIG 6

GefA plays different roles in swarming and biofilm formation under the scrABC knockout background. (A) The swarming colony and the migration diameter of WT, ΔgefA, ΔscrABC, and ΔgefAΔscrABC strains. The migration diameter of the swarming colonies was measured by using ImageJ software. (B) The expression level of lfgB was assessed by measuring luminescence in PlfgB-lux transcriptional fusion strains. (C) Biofilm formation of WT, ΔgefA, ΔscrABC, and ΔgefAΔscrABC strains. Biofilm formation was measured by using crystal violet staining and quantified by measuring OD595 at 36 h. (D) The expression level of EPS was assessed by measuring luminescence in Peps-lux transcriptional fusion strains. (E) The expression level of cpsQ was assessed by measuring luminescence in PcpsQ-lux transcriptional fusion strains. All data were presented as means ± SD deviation of triplicate samples from three independent experiments. The unpaired two-tailed Student’s t test was used for statistical analysis (ns, P > 0.05; *, P < 0.05; **, P < 0.01; ***, P < 0.001).

We then tested whether GefA regulates biofilm formation in an scrABC knockout background, and we found that without ScrABC, GefA could still enhance biofilm formation in V. parahaemolyticus (Fig. 6C). The promoter activities of Peps-lux and PcpsQ-lux were both increased significantly in ΔscrABC strains compared with that in the ΔgefAΔscrABC strain (Fig. 6D and E). These results indicated that for biofilm formation in V. parahaemolyticus which is enhanced by c-di-GMP, GefA plays an important role in this biological process regardless of ScrABC function.

GefA regulates the virulence of V. parahaemolyticus via type III secretion system 1 (T3SS1) and flagella.

Previous studies have shown that c-di-GMP can regulate bacterial virulence, but this information remains unclear in V. parahaemolyticus (20, 28, 29). We used a zebrafish model to evaluate if GefA regulates the virulence of V. parahaemolyticus (30). We found that the zebrafish infected by the ΔgefA strain showed an obvious lower survival rate (0%) than zebrafish infected by the WT strain (20%) and the complemented strain CΔgefAWT (30%) (Fig. 7A and Fig. S5 in the supplemental material). In addition, the zebrafish in the group challenged by phosphate-buffered saline (PBS) or the heated WT strain had a 100% survival rate (Fig. 7A and C). These results suggested that GefA regulates the virulence of V. parahaemolyticus in the zebrafish model.

FIG 7.

FIG 7

GefA regulates the virulence of V. parahaemolyticus via T3SS1 and flagella. (A, C, and D) Survival curves of zebrafish infected with WT, WT-heat, ΔgefA, CΔgefAWT, Δt3ss1, ΔgefAΔt3ss1, ΔflgEΔlfgB, and ΔgefAΔflgEΔlfgB strains. Groups containing 15 zebrafish each were challenged with the indicated strains at a dose of 2.0 × 107 CFU/fish and monitored until 72 h postinfection. The negative-control group was challenged with an equal volume of sterile PBS. (B) The mRNA levels of T3SS1 and T3SS2 in WT and ΔgefA strains as determined by qRT-PCR. The results of qRT-PCR are expressed as means ± SD from three independent experiments. The qRT-PCR data were analyzed using the unpaired two-tailed Student’s t test, and survival data were analyzed using the log-rank (Mantel-Cox) test. Asterisks indicate significant differences (ns, P > 0.05; *, P < 0.05; **, P < 0.01).

Previous studies indicated that the two type III secretion systems (T3SS1 and T3SS2) play important roles in the pathogenicity of V. parahaemolyticus (18, 31) and the c-di-GMP signaling pathway is involved in the regulation of T3SS expression (29, 32). We then evaluated if GefA affects the expression level of T3SS1 and T3SS2 by reverse transcription- quantitative PCR (qRT-PCR) analysis, and the results showed that the mRNA levels of T3SS1 were significantly higher in the ΔgefA strain than those in WT strain, whereas the mRNA levels of T3SS2 were identical in these strains (Fig. 7B). A further zebrafish survival assay showed that T3SS1 involved the GefA-mediated virulence of V. parahaemolyticus, as the zebrafish infected by the ΔgefAΔt3ss1 strain exhibited a higher survival rate (30%) than the zebrafish infected by the ΔgefA strain (0%) (Fig. 7C).

The flagellum is considered an important virulence factor in different pathogenic bacteria (33). However, this information remains unknown in V. parahaemolyticus. As GefA inhibits swarming motility, we wanted to determine whether flagella regulated by GefA participate in the virulence of V. parahaemolyticus. We found that zebrafish infected by the ΔflgEΔlfgB strain showed a higher survival rate (60%) than the zebrafish infected by the WT strain (20%), and the zebrafish infected by the ΔgefAΔlfgBΔflgE strain exhibited an obvious higher survival rate (50%) than the zebrafish infected by the ΔgefA strain (0%) (Fig. 7D). Therefore, flagella are also involved in the pathogenesis of ΔgefA strain infection. To better understand the effects of T3SS1 and flagella on the GefA-mediated infection of V. parahaemolyticus, we determined the bacterial load in infected zebrafish. We found that the bacterial loads from zebrafish challenged with the ΔgefAΔt3ss1 and ΔgefAΔlfgBΔflgE strains were both significantly reduced compared with those with the ΔgefA strain (see Fig. S6 in the supplemental material). These results indicated that both T3SS1 and flagella are important for in vivo bacterial proliferation and contribute to the GefA-mediated virulence of V. parahaemolyticus.

DISCUSSION

The ability of Vibrio species to initiate the colonization of host surfaces has been attributed to flagellar motility. Many different flagellar morphologies exist on the bacterial surface, such as polar flagellum and lateral flagellum (34). Previous studies showed that bacteria rely on the polar flagellum for swimming in liquid environments but employ the lateral flagellum for swarming on solid surfaces (15, 35). Here, we observed that in V. parahaemolyticus, the polar flagellum is employed critically for swimming motility and yet facilitates swarming motility to some extent, and the lateral flagellum is employed mainly in swarming motility. As flagellar motility is one of the high energy-utilizing cellular processes in bacteria, the genes responsible for the flagellar synthesis are tightly regulated (36). It has been shown that c-di-GMP plays a crucial role in the regulation of swarming motility in V. parahaemolyticus (10, 24). A high concentration of c-di-GMP in V. parahaemolyticus suppresses swarming motility, while a low concentration of c-di-GMP does the opposite. In this study, we found that GefA regulates swarming motility only when the strains contain an intact lateral flagellum regardless of whether the polar flagellum is functional or not. In addition, we observed that the gefA deletion induced lateral flagella formation and cell elongation of V. parahaemolyticus by transmission electron microscopy (see Fig. S7 in the supplemental material). Previous studies indicated that surface recognition, including second signals, affects swarmer cell differentiation, which has an elongated cell body and produces more lateral flagella (37). As c-di-GMP participates in the surface recognition of V. parahaemolyticus, it makes sense that the intracellular concentration of c-di-GMP could modulate the transformation between the swimmer and swarmer cell. In this study, we found that GefA inhibits swarming motility by repressing the expression of lateral flagellar genes, and overexpressing GefA caused a significant swarming defect which depends on the GGEEF motif of GefA. This evidence indicates that GefA acts as a diguanylate cyclase whose product could increase the concentration of the c-di-GMP pool of V. parahaemolyticus.

After colonization of a surface, bacteria begin to form biofilms, which can protect the encased microbial cells from environmental stressors (9). Previous studies have shown that c-di-GMP tends to promote biofilm formation in Vibrio species (3, 9, 15, 20). Here, we observed that the ΔgefA strain exhibited a significant biofilm decrease compared with the WT and CΔgefAWT strains. The EPSs are the most prevalent component of biofilms. In V. cholerae, the transcription of EPS genes and the regulators vpsR are regulated by c-di-GMP (38). We evaluated the transcription of EPS genes in the ΔgefA strain, and our data suggest that GefA controls EPS biosynthesis in V. parahaemolyticus. In addition, CpsQ is the positive transcriptional regulator of EPS and has c-di-GMP binding ability in V. parahaemolyticus. Previous studies indicated that CpsQ contributes to EPS expression when c-di-GMP levels are high, and thus, it is the primary driver of biofilm formation (10). Here, we found that GefA also regulates CpsQ expression. Therefore, GefA may modulate biofilm formation by controlling EPS biosynthesis in V. parahaemolyticus, and the expression of EPS may be regulated directly by CpsQ and c-di-GMP.

The second messenger c-di-GMP was found to be ubiquitous across the bacterial kingdom (3). It is synthesized by DGCs containing a GGD(/E)EF domain and degraded by PDEs carrying either an EAL or HD-GYP domain (1, 3). In V. parahaemolyticus, there are 28 GGDEF-containing proteins, 13 EAL-containing proteins, 16 proteins with both GGDEF and EAL domains, and 5 HD-GYP-containing proteins (2, 4). Among these enzymes, the Scr proteins direct bacterial surface colonization by controlling the c-di-GMP homeostasis in V. parahaemolyticus. ScrC and ScrG are GGDEF-EAL proteins, whereas ScrJ and ScrL are GGEEF proteins. ScrC acts to synthesize c-di-GMP by itself, whereas it has c-di-GMP-degrading activity in the presence of ScrA and ScrB (8, 27). ScrG feeds into the Scr circuit to impact c-di-GMP and plays a similar role as ScrC (39). ScrJ and ScrL were identified recently as potent DGCs that participate in the Scr surface colonization regulatory network (40). As for the other the c-di-GMP metabolic enzymes in V. parahaemolyticus, their functions are largely unknown. Here, we identified 11 DGCs that contain only the GGD(/E)EF domain and found that 2 novel DGCs of VPA0202 and VPA1478 contribute to the swarming motility of V. parahaemolyticus. As lower levels of c-di-GMP favor the swarming motility, these DGCs may contribute to the modulation of the global c-di-GMP pool. We designated VPA0202 as GefA and further explored the relationship between GefA and Scr in the regulation of bacterial behaviors. Our results showed that GefA plays different roles in swarming and biofilm formation under a scrABC knockout background. As the deletion of the scrABC increases the cellular c-di-GMP levels, it is possible that the activity of GefA is disturbed under high-c-di-GMP conditions. Therefore, the activity of the gefA promoter in the ΔgefA and ΔscrABC strains was evaluated by using the bioluminescence reporter pBBR-lux. However, the results showed that the expression of GefA was not affected by the cellular c-di-GMP (see Fig. S8 in the supplemental material). The underlying mechanism requires further exploration.

Although many virulence factors have been characterized in V. parahaemolyticus, such as thermostable direct hemolysin (TDH), TDH-related hemolysin (TRH), T3SS1, and T3SS2 (4143), the pathogenesis of this bacterium remains incompletely understood. Previous studies indicated that c-di-GMP can regulate virulence factor expression and thus contributes to bacterial pathogenicity (20, 29). However, it has not been elucidated in V. parahaemolyticus. In this study, we found that both flagella and T3SS1 are involved in the virulence of V. parahaemolyticus in a zebrafish model (Fig. 7). We also found that the deletion of the gefA gene increased the virulence of V. parahaemolyticus in the same model. To our knowledge, the relationship between c-di-GMP and V. parahaemolyticus virulence has never been revealed before. We then explored the mechanisms by which GefA contributes to virulence by evaluating whether GefA regulates T3SS expression. We found that GefA affects the mRNA levels of T3SS1 but not T3SS2, and a further zebrafish infection assay showed that T3SS1 is involved in the GefA-mediated virulence of V. parahaemolyticus. The previous study has indicated that ExsA (VP1699) could positively regulate the transcription of T3SS1 genes in V. parahaemolyticus by interacting directly with the promoter sequences of T3SS1 genes (44). Here, we found that the expression of exsA is regulated negatively by GefA and ExsA is involved in the GefA-mediated virulence of V. parahaemolyticus (see Fig. S9 in the supplemental material). However, by testing the promoter activity of T3SS1 regulated by GefA, we found that the promoter activity of these genes clusters was all identical in ΔgefA and WT strains (see Fig. S10 in the supplemental material). This result suggests that GefA may regulate the mRNA levels of T3SS1 through a posttranscriptional way.

Flagella play diverse roles in bacterial pathogenesis, such as reaching the host/target site, colonization or invasion, maintenance at the infection site, and dispersal to new hosts (33, 45). In the present study, we demonstrated that flagella participate in the virulence of V. parahaemolyticus. In the zebrafish animal model, we observed that the zebrafish infected by the ΔgefAΔlfgBΔflgE strain exhibited an obviously higher survival rate (50%) than zebrafish infected by the ΔgefAΔt3ss1 strain (30%). This finding suggests that that GefA regulation of bacterial virulence relies primarily on the activity of flagella. Bacteria have evolved chemoreceptor systems in conjunction with their flagella, and thus the enhanced flagella enable bacteria to sense the external environment and move in favorable directions (33). After the pathogens arrive at the optimal host site, flagella often continue to play roles in the interactions between the pathogens and their hosts during the establishment and progression of an infection (33). However, the molecular mechanisms whereby the GefA-mediated flagellar formation contributes to the pathogenicity of V. parahaemolyticus remain unclear.

In summary, we carried out systematic research of the DGCs that contain only the GGD(/E)EF domain and identified a novel GGEEF domain-containing protein designated GefA that can synchronize bacterial behaviors and regulate V. parahaemolyticus virulence. These findings will contribute to a better understanding of the function of these DGCs in V. parahaemolyticus. However, the underlying mechanisms whereby GefA functions under high-c-di-GMP conditions or regulates virulence remain unknown and require further exploration.

MATERIALS AND METHODS

Bacterial strains, culture conditions, and plasmids.

The bacterial strains and plasmids used in this work are listed and described in Table 1. V. parahaemolyticus was grown at 37°C in Luria-Bertani (LB) broth with 3% NaCl modified LB (MLB) containing appropriate antibiotics. Escherichia coli strains DH5α and CC118λpir were grown in LB broth with 1% NaCl at 37°C. When required, the culture medium was supplemented with 50 μg/mL streptomycin, 5 μg/mL chloromycetin, or 10% sucrose.

TABLE 1.

Bacterial strains and plasmids used in this study

Strains or plasmids Description Source
Bacterial strains
 RIMD 2210633 V. parahaemolyticus, WT Our laboratory
 Δvpa0202gefA) Deletion mutant of vpa0202 with WT background This study
 Δvpa0360 Deletion mutant of vpa0360 with WT background This study
 Δvp2076 Deletion mutant of vp2076 with WT background This study
 Δvpa0059 Deletion mutant of vpa0059 with WT background This study
 Δvpa1457 Deletion mutant of vpa1457 with WT background This study
 Δvpa0068 Deletion mutant of vpa0068 with WT background This study
 Δvpa0184 Deletion mutant of vpa0184 with WT background This study
 Δvpa1478 Deletion mutant of vpa1478 with WT background This study
 Δvpa0264lfgB) Deletion mutant of vpa0264 with WT background This study
 Δvp0778flgE) Deletion mutant of vp0778 with WT background This study
 ΔscrABC Deletion mutant of scrABC with WT background This study
 Δt3ss1 Deletion mutant of vp1696 with WT background This study
 ΔexsAvp1699) Deletion mutant of vp1699 with WT background This study
 CΔgefAWT (CΔvpa0202WT) Complement of gefA with ΔgefA background This study
 CΔgefAGGAAA (CΔvpa0202GGAAA) The GGEEF motif was changed to GGAAA with WT background This study
 ΔflgEΔgefA Deletion mutant of flgE and gefA with WT background This study
 ΔlfgBΔgefA Deletion mutant of lfgB and gefA with WT background This study
 ΔgefAΔscrABC Deletion mutant of gefA and scrABC with WT background This study
 ΔgefAΔt3ss1 Deletion mutant of gefA and vp1696 with WT background This study
 ΔflgEΔlfgB Deletion mutant of flgE and lfgB with WT background This study
 ΔgefAΔflgEΔlfgB Deletion mutant of gefA, flgE, and lfgB with WT background This study
 ΔgefAΔexsA Deletion mutant of gefA and vp1699 with WT background This study
 WT::pBAD24 WT with the plasmid pBAD24 This study
 WT::pBAD24-VPA0202 WT with the plasmid pBAD24-VPA0202 This study
 WT::pBAD24-VPA1478 WT with the plasmid pBAD24-VPA1478 This study
 WT::pBAD24-VPA0202GGAAA WT with the plasmid pBAD24-VPA0202GGAAA This study
 WT::pBAD24-VPA1478GGAAA WT with the plasmid pBAD24-VPA1478GGAAA This study
 Δvpa0202::pBAD24 Δvpa0202 with the plasmid pBAD24 This study
 Δvpa0202::pBAD24-VPA0202 Δvpa0202 with the plasmid pBAD24-VPA0202 This study
 Δvpa0202::pBAD24-VPA0202GGAAA Δvpa0202 with the plasmid pBAD24-VPA0202GGAAA This study
 Δvpa0202::pBAD24-VPA1478 Δvpa0202 with the plasmid pBAD24-VPA1478 This study
 Δvpa0202::pBAD24-VPA1478GGAAA Δvpa0202 with the plasmid pBAD24-VPA1478GGAAA This study
 Δvpa1478::pBAD24 Δvpa1478 with the plasmid pBAD24 This study
 Δvpa1478::pBAD24-VPA1478 Δvpa1478 with the plasmid pBAD24-VPA1478 This study
 Δvpa1478::pBAD24-VPA1478GGAAA Δvpa1478 with the plasmid pBAD24-VPA1478GGAAA This study
 Δvpa1478::pBAD24-VPA0202 Δvpa1478 with the plasmid pBAD24-VPA0202 This study
E. coli DH5α Cloning host for maintaining the recombinant plasmids 49
E. coli CC118λpir Mobilization of plasmids into V. parahaemolyticus 50
Plasmids
 pDS132 Suicide vector for V. parahaemolyticus mutagenesis 51
 pDS132-gefA Derived from pDS132 used to knock out gefA This study
 pDS132-vpa0360 Derived from pDS132 used to knock out vpa0360 This study
 pDS132-vp2076 Derived from pDS132 used to knock out vp2076 This study
 pDS132-vpa0059 Derived from pDS132 used to knock out vpa0059 This study
 pDS132-vpa1457 Derived from pDS132 used to knock out vpa1457 This study
 pDS132-vpa0068 Derived from pDS132 used to knock out vpa0068 This study
 pDS132-vpa0184 Derived from pDS132 used to knock out vpa0184 This study
 pDS132-vpa1478 Derived from pDS132 used to knock out vpa1478 This study
 pDS132-lfgB Derived from pDS132 used to knock out lfgB This study
 pDS132-flgE Derived from pDS132 used to knock out flgE This study
 pDS132-scrABC Derived from pDS132 used to knock out scrABC This study
 pDS132-vp1696 Derived from pDS132 used to knock out vp1696 This study
 pDS132-vp1699 Derived from pDS132 used to knock out vp1699 This study
 pDS132-gefAWT Derived from pDS132 for the complement of gefA with ΔgefA background This study
 pDS132-gefAGGAAA Derived from pDS132 used to make the GGAAA variant This study
 pBAD24 Arabinose-induced expression plasmid 52
 pBAD24-VPA0202 Derived from pBAD24 used to overexpress VPA0202 protein This study
 pBAD24-VPA0202GGAAA Derived from pBAD24-VPA0202 used to overexpress VPA0202GGAAA variant protein This study
 pBAD24-VPA1478 Derived from pBAD24 used to overexpress VPA1478 protein This study
 pBAD24-VPA1478GGAAA Derived from pBAD24-VPA1478 used to overexpress VPA1478GGAAA variant protein This study
 pBBR-lux The bioluminescence reporter containing luxCDABE operon of Vibrio harveyi 53
 PlfgB-lux pBBR-lux containing the promoter of lfgB This study
 PfliM-lux pBBR-lux containing the promoter of fliM This study
 PflaD-lux pBBR-lux containing the promoter of flaD This study
 PflaK-lux pBBR-lux containing the promoter of flaK This study
 Peps-lux pBBR-lux containing the promoter of epsA-J This study
 PcpsQ-lux pBBR-lux containing the promoter of cpsQ This study
 PgefA-lux pBBR-lux containing the promoter of gefA This study
 Pvp1667-lux pBBR-lux containing the promoter of vp1667 This study
 Pvp1668-lux pBBR-lux containing the promoter of vp1668 This study
 Pvp1676-lux pBBR-lux containing the promoter of vp1676 This study
 Pvp1682-lux pBBR-lux containing the promoter of vp1682 This study
 PvtrA-lux pBBR-lux containing the promoter of vtrA This study
 PvtrB-lux pBBR-lux containing the promoter of vtrB This study

Bioinformatics analysis.

The complete collection of c-di-GMP metabolic enzymes were sourced from the website https://www.ncbi.nlm.nih.gov/Complete_Genomes/c-di-GMP.html, which shows the numbers of c-di-GMP-related domains in representative complete genomes from all bacterial and archaeal species (2, 4). The protein conserved domain was further analyzed by the Conserved Domain Database (CDD; available from the NCBI website). The BProm program (SoftBerry) was used to predict the promoter region.

Recombinant DNA techniques.

Standard procedures for DNA amplification and DNA assembly were used, and the primers used for PCR amplification are listed in Table 2. All restriction and DNA-modifying enzymes were purchased from APExBIO or New England BioLabs and performed according to the supplier instruction.

TABLE 2.

Primers used in this study

Primer Primer sequence (5′–3′)
vpa0202 deletion P1: GCTCTAGAGTAAAATTCACATTGTAAAATTTTTG
P2: ACGTAGACAAAGCTTCTTTTGGTGTGGCAG
P3: CCAAAAGAAGCTTTGTCTACGTAGGTATAC
P4: TGTAGCATGCTTGGCAGTTGAGCGCCTTTTGGC
vpa0360 deletion P1: GCTCTAGATTCACCATGGGGTTTCCGAA
P2: TCTGTCGTCATTCTGCCAAACATCGAAGAC
P3: GATGTTTGGCAGAATGACGACAGATTGATGTT
P4: CGAGCTCCCTTTGCATCATAACGGATG
vp2076 deletion P1: GCGTCTAGAGCAGAGCTTGGCGCGCGCGG
P2: GATAGAGCGTTAGATATTGAAGGGATGAAGCAC
P3: CCCTTCAATATCTAACGCTCTATCGATACGCGA
P4: GCGGAGCTCTAGGTGAGCATTTTTTTGAG
vpa0059 deletion P1: GCTCTAGATAAGAATGGGCTGCAAATTT
P2: GACGAGAAAACATGCTGGTGAGCTGCGCAA
P3: CACCAGCATGTTTTCTCGTCGAGCGGATAT
P4: GCTCTAGACAGGAATATCGCGCCAAACA
vpa1457 deletion P1: CGAGCTCAAGGCAATACGCTATCCGCC
P2: CGCCATTTTTGAAAATTTCGACCACTTGTATCA
P3: GGTCGAAATTTTCAAAAATGGCGATCGCGT
P4: GCTCTAGAGCAATGGATGGCGAAGACATCT
vpa0068 deletion P1: GCTCTAGACCAAGACAAAGAGCTCTACA
P2: GCTCGCAAATGTTGAGTCCTCAGACGTCGA
P3: TGAGGACTCAACATTTGCGAGCAATAAAGA
P4: TGTAGCATGCAAATTAGGTGGCTTTATTGT
vpa0184 deletion P1: GCTCTAGACGTCATTATTTATGGTGAAAC
P2: ATCTATGCTATTACCCGAGCCGACGAAGCA
P3: CGGCTCGGGTAATAGCATAGATACAAGAAA
P4: TGTAGCATGCTGCCTTGATTTACCCAGCAGGT
vpa1478 deletion P1: AAAACTGCAGTCAAAGACCATGAAGACAGCA
P2: TAATACCGATGGATTCACGGCTGGTGGACGCAA
P3: CACCAGCCGTGAATCCATCGGTATTACACTCCA
P4: AAAACTGCAGAGCGGTTGGTTCGCTTGAACT
lfgB deletion P1: GCTCTAGATGAACATTAAATTTTATTTTTGTACTCGAT
P2: AAACGTCAGGCTAACGCGAAAATTGAGTGC
P3: AATTTTCGCGTTAGCCTGACGTTTCTCAAC
P4: CGAGCTCGTGTATTTGCCCGGCTTTAAGCCAAGCTCT
flgE deletion P1: GCTCTAGAGTAGAAAGTGATAAGCCGCTTAGTGCGGAG
P2: CAGGATATTTTGTTGTAGGGACAAACCGCTTAAAGA
P3: TCTTTAAGCGGTTTGTCCCTACAACAAAATATCCTGCAG
P4: CGAGCTCTTGAAGGTCAATCAGCGCGGTCATTTCACC
scrABC deletion P1: CGAGCTCCCCCCGTTTTACCCATGAAGCCAACTGCGT
P2: ACAAGCTCGACAACGCCATGTGGATTATCT
P3: CATGGCGTTGTCGAGCTTGTGCTACACCTG
P4: GCTCTAGAGATCGCCAAGATGGTTGCCATCGGTCCATG
vp1696 deletion P1: GAATTCCTGCAGCCCGGGGGATCCGTGTGGTTTCGATGTCGTCTAATTC
P2: GTTTACAAAGCGCGCCGAACAGTTCGCATGTTC
P3: CTGTTCGGCGCGCTTTGTAAACGTGCAGTACTG
P4: CTAAAGGGAACAAAAGCTGGAGCTCGCTGATCCTTTGTTGCTACTTGG
vp1699 deletion P1: GCTCTAGATACTTGTGACTGCTGCTCGTTCAGTG
P2: CTCATATTGTTGTCTCTTACTTTACTCAAAGCTATCG
P3: TAAAGTAAGAGACAACAATATGAGATTGGTCTGAGTG
P4: GCGGAGCTCTCAAGCTGGGAAAGGAGAAATGAAAGTG
pBAD24-VPA0202 P1: GCTCTAGATTAGATAGGCATCACTCGGTTTCG
P2: GGGGTACCAAATGACTGACGAGTTTAAGAAAT
pBAD24-VPA0202GGAAA P1: GCTCTAGATTAGATAGGCATCACTCGGTTTCG
P2: GCTTCGGCGGCGCGGCGGCGGCGTTAATTGTG
P3: CGCCGCCGCCGCGCCGCCGAAGCGGTATGC
P4: GGGGTACCAAATGACTGACGAGTTTAAGAAAT
pBAD24-VPA1478 P1: GGGGTACCAATGGAACTACTGCTTAGCA
P2: GCTCTAGATTAAAGTTCGGTACAGACTT
pBAD24-VPA1478GGAAA P1: GGGGTACCAATGGAACTACTGCTTAGCA
P2: ACAAGTGCTGCTGCACCACCAAATCGCACG
P3: CGTGCGATTTGGTGGTGCAGCAGCACTTGTAATTCTTG
P4: GCTCTAGATTAAAGTTCGGTACAGACTT
gefA complement P1: GCTCTAGAGTAAAATTCACATTGTAAAATTTTTG
P2: TGTAGCATGCTTGGCAGTTGAGCGCCTTTTGGC
GGAAA variant P1: GCTCTAGAGTAAAATTCACATTGTAAAATTTTTG
P2: GCTTCGGCGGCGCGGCGGCGGCGTTAATTGTG
P3: CGCCGCCGCCGCGCCGCCGAAGCGGTATGC
P4: GCTCTAGATTGGCAGTTGAGCGCCTTTT
PlfgB-lux P1: CGAGCTCGTTGGACTTGGCTACGCGGTCTACTTC
P2: CGGGATCCGCATCTTTCCTTACAGTCGGCTCGAAT
PfliM-lux P1: CGAGCTCTTAATTACCTATTCTGAAATACTTAAATTG
P2: CGGGATCCTTATATTTTACCGTGCGTTAACAAACTAAG
PflaD-lux P1: CGAGCTCTTTGGCCCTCTCGGCTCAATTTGTAGAAAC
P2: CGGGATCCGGTGATTTCTCCAATTGATTTTCCGATGTA
PflaK-lux P1: CGGGATCCAAGTAAGAATGATTGCCTTTATTTTAGGTG
P2: GACTAGTTAATCAAAACAATGCTTTAGGATCGACTTA
PgefA-lux P1: CGGGATCCTTCTGCGATGTTACTAGCAAAATG
P2: CGAGCTCGCTAAATGTACTGATTTGTTTTACG
Peps-lux P1: GCGGAGCTCCTTTTCCTCATCCCTGCTTA
P2: GCGGGATCCGACCTAGTTTCCCTTCTAGCA
PcpsQ-lux P1: GCGGAGCTCAGATCACTCTATAGAGATGG
P2: GCGGGATCCACTTTCATTAACTTAAGATTCTTAATT
Pvp1668-lux P1: GCGGAGCTCATCCATTCCGGACCGATGCAT
P2: GCGGGATCCTGTAAAAAATATGCGCAATGA
Pvp1667-lux P1: GCGGAGCTCGGATCAAACGCGTTTGTTTG
P2: GCGGGATCCTCACTTGCACTCCTTTCGTA
Pvp1676-lux P1: GCGGAGCTCCCAGGATGAGAAACTACAAT
P2: GCGGGATCCTTGTTAAGTATAACTTAACAGTCA
Pvp1682-lux P1: GCGGAGCTCTCGATAGCCACAAACTTGGT
P2: GCGGGATCCAATCTTTCCTCTTGTTTCCG
PvtrA-lux P1: CGGGATCCTTACCGATCTTGTGAGCCTAGACTAATC
P2: CGAGCTCATAACTCTTTTGATATGTATATTTCCTTTT
PvtrB-lux P1: CGGGATCCTAGTAAGTAGTTTCTTAACATCGCTGA
P2: CGAGCTCGCAATTATTTAAGGTCGATGACCAATATGCCGTCGC
vp1686-qRT-PCR P1: GCCGTGATAACCAATCACACCAG
P2: CAAATGTAGAACGCGATTACCGTGGG
vp1687-qRT-PCR P1: GATTGACCAAGACACGGCAATCACTG
P2: TAAACGGCTGGTGAGCCTTGAGTG
vp1696-qRT-PCR P1: AGCAAGACTGCCGTTGTATC
P2: CACACCGAGCTGACGTAAAT
vp1699-qRT-PCR P1: CACAGCGATCTTCTCATGAC
P2: GACTGTGCAGCAATAGAATCAGC
vpa1314 qRT-PCR P1: TTGCCTTTGAGCTTCCATCT
P2: TTGACCGGTGCATTGGTATTA
vpa1321-qRT-PCR P1: GTACGCCTCTTGGACAGTTT
P2: CCATTTACACCTCTTTGACCATTAG
vpa1332-qRT-PCR P1: CTTGTGTGAGCAACCAGGAA
P2: TGGGCTCTGATGTTACGAATTG
vpa1336-qRT-PCR P1: GAGATACGGTAGACGGTGAATTT
P2: AATGTCTCTGCTCTCGACTTTAC
16S rRNA-qRT-PCR P1: AAGCGTGGGGAGCAAACAG
P2: CGAAGGCACCAATCCATCTC

The plasmid pDS132 was used to delete the target gene from the bacterial genomes as described previously (13). Briefly, the upstream and downstream homology arms of the target gene were PCR amplified and assembled into the suicide plasmid pDS132 using specific primers with restriction enzyme sites. The recombinant plasmid was introduced into V. parahaemolyticus or E. coli by conjugation. The plasmid contains a chloromycetin resistance cassette and a sacB counter selectable marker, which could exchange genetic fragments twice with the genomes of V. parahaemolyticus by intermolecular recombination. A putative deletion mutant was identified using PCR and verified by sequencing. The CΔgefAWT strain was constructed based on the ΔgefA strain by replenishing gefA to the gene native locus, while the replenished gefA sequence has several synonymous mutations after the start codon. The CΔgefAGGAAA strain was constructed based on the ΔgefA strain by replenishing the gefAGGAAA sequence to the gene native locus. Additionally, the plasmid pBAD24 was used to overexpress the proteins and corresponding mutants as described previously (46).

The pBBR-lux reporter plasmid was used to identify the activity of the target gene promoter. The promoter-proximal region of each target gene was predicted by the BProm program (SoftBerry) and amplified using specific primers. The promoter sequence was subcloned into the plasmid pBBR-lux, which was further introduced into WT and mutant strains by conjugation.

Swarming motility assays.

Swarming plates were prepared with 2.5% brain heart infusion (BHI) broth (Bacto), 1.2% agar (Bacto), 1.5% NaCl, and 50 μg/mL streptomycin. As for the strains containing the plasmid pBAD24, chloromycetin and arabinose were added to a final concentration of 5 μg/mL and 0.02% in the plates, respectively. The swarm plates were left to dry for 3 h at room temperature, and all bubbles were removed carefully. The single colony of the strain of interest from the MLB plate was picked by a sterile toothpick. Each swarming plate was inoculated with the colony by the toothpick. The inoculated swarming plates were incubated at 37°C for approximately 12 h. The swarming areas were photographed, and the diameter of the digital images were measured by using ImageJ software. Each sample procedure was repeated at least three times.

Swimming motility assays.

Swimming motility plates were prepared with 2.5% BHI, 0.25% agar, 1.5% NaCl, and 50 μg/mL streptomycin. The swim plates were left to dry for 3 h at room temperature, and all bubbles were removed carefully. A single colony of each strain of interest from the MLB plate was inoculated onto the center of the swimming plate using a sterile toothpick. The plates were incubated at 37°C for 4 h, and the migration diameter of the swimming colonies was measured by using ImageJ software. Each sample procedure was repeated at least three times.

Biofilm quantification.

The overnight V. parahaemolyticus cultures were subcultured into fresh MLB and grown to the logarithmic phase with shaking at 37°C for 6 h. The strains were diluted 100 times with MLB, and 2 mL of cultures was added to three replicates of 5-mL borosilicate culture tubes and incubated statically at 37°C for 36 h. Subsequently, the free-floating bacteria and liquid medium were decanted, and the tubes containing biofilm-associated cells were washed carefully with phosphate-buffered saline (PBS). The tubes then were stained with 0.04% crystal violet for 20 min and washed with PBS again. After the tubes were air-dried for 1 h, the crystal violet was solubilized with 2 mL 30% dimethyl sulfoxide (DMSO). The solubilized biofilm optical density at 595 nm (OD595) was measured for three samples of each strain using the microplate reader (Biotek Instruments Inc.). Each sample procedure was repeated at least three times.

Bioluminescence reporter assay.

The overnight cultures of the strains harboring a recombinant bioluminescence plasmid (except PlfgB-lux and PfliM-lux) were subcultured at a dilution of 1:100 in fresh MLB, which were incubated statically at 37°C for 11 h. As for the strains containing PlfgB-lux or PfliM-lux, these strains were subcultured on swarming plates. Briefly, the swarming plate was inoculated with 10 μL of the strain and incubated at 37°C for 8 h, and then the strain was collected from the plates. The value of luminescence and OD600 were measured using a Bio-Tek Synergy HT spectrophotometer. The OD600 and luminescence of a clean MLB sample were used as a blank. Luminescence expression was calculated as the luminescence per unit of OD600. Each sample procedure was repeated at least three times.

Ethics statement and zebrafish infection assay.

The zebrafish experiments were approved by the Institutional Animal Care and Use Committee of Science Technology Department of Zhejiang Province (permit number SYXK-2018-0010) in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals.

Adult zebrafish (5 months old) were acclimated at room temperature for 1 week before infection treatment. To investigate the survival curves, zebrafish were anesthetized with 1% ethyl 3-aminobenzoate methane sulfonate (Sigma) first and then injected intraperitoneally with 20 μL of bacteria. A total of 15 zebrafish were challenged with the strains of interest at a dose of 2.0 × 107 CFU/fish, while another 15 zebrafish were injected with an equal volume of sterile PBS as a negative control. Survival rates were monitored for 72 h after challenge. For the bacterial burden assay, the zebrafish (8 zebrafish for each group) were challenged with the strains of interest at a dose of 1.0 × 106 CFU/fish and euthanized at 8 h postinfection. The full intestines were harvested and homogenized in PBS. The homogenized samples were serially diluted and plated onto MLB plates with 50 μg/mL streptomycin to enumerate CFU after overnight incubation.

qRT-PCR analysis.

The overnight V. parahaemolyticus strains were subcultured into fresh MLB and grown to the logarithmic phase with shaking at 37°C for 6 h. The strains were then harvested by centrifugation and washed three times with PBS. Total RNA was isolated using TRIzol reagent (Vazyme, China) according to the manufacturer’s instructions, and cDNA was synthesized using the cDNA synthesis kit (Vazyme). qRT-PCR analysis was performed in a 20-μL reaction by using ChamQ yniversal SYBR qPCR master mix (Vazyme). A housekeeping gene, 16S rRNA, was used as the internal reference (47). Relative mRNA levels were quantified using the threshold cycle (2−ΔΔCT) method (48). All primers used are listed in Table 2, and each sample procedure was repeated at least three times.

Transmission electron microscopy.

The flagella were observed by using transmission electron microscopy. The swarming plate was inoculated with 10 μL of the strain and incubated at 37°C for 8 h, and then the strain was collected from the plates. After being suspended in 50 μL monoethanolamine buffer, the samples were applied to carbon-coated copper grids and stood for 2 min at room temperature. Excess liquid was removed by filter paper, and the bacteria were stained with 10 μL of 0.5% phosphotungstic acid. The dried grids were examined using an H-7650 system (Hitachi) according to the manufacturer’s instructions. This experiment was performed independently three times.

Data analysis.

All data shown are representative of results from at least three independent experiments. The measurements of swarm diameter were prepared using ImageJ software. Statistical analyses were conducted using the unpaired two-tailed Student’s t test or the log-rank (Mantel-Cox) test with the GraphPad software package. For all tests, a P value of <0.05 was considered statistically significant.

ACKNOWLEDGMENTS

This work was funded by grants from the National Natural Science Foundation of China (grant numbers 32170174 and 31770151), the Science Development Foundation of Zhejiang A & F University (grant number 2013FR012), and the Natural Science Foundation of Zhejiang Province (grant number LZ20C010001) to M.Y. and is also supported by the Talent-Start project of Zhejiang A & F University (grant number 2020FR042) and the Natural Science Foundation of Zhejiang Province (grant number LQ22C180002) to X.Z.

We declare no conflict of interest.

Footnotes

Supplemental material is available online only.

Supplemental file 1
Table S1 and Fig. S1 to S10. Download aem.02239-21-s0001.pdf, PDF file, 1.5 MB (1.5MB, pdf)

Contributor Information

Menghua Yang, Email: yangmh@zafu.edu.cn.

Charles M. Dozois, INRS—Institut Armand-Frappier

REFERENCES

  • 1.Petchiappan A, Naik SY, Chatterji D. 2020. Tracking the homeostasis of second messenger cyclic-di-GMP in bacteria. Biophys Rev 12:719–730. 10.1007/s12551-020-00636-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Römling U, Galperin MY, Gomelsky M. 2013. Cyclic di-GMP: the first 25 years of a universal bacterial second messenger. Microbiol Mol Biol Rev 77:1–52. 10.1128/MMBR.00043-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Jenal U, Reinders A, Lori C. 2017. Cyclic di-GMP: second messenger extraordinaire. Nat Rev Microbiol 15:271–284. 10.1038/nrmicro.2016.190. [DOI] [PubMed] [Google Scholar]
  • 4.Chou SH, Galperin MY. 2016. Diversity of cyclic di-GMP-binding proteins and mechanisms. J Bacteriol 198:32–46. 10.1128/JB.00333-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ndraha N, Wong HC, Hsiao HI. 2020. Managing the risk of Vibrio parahaemolyticus infections associated with oyster consumption: a review. Compr Rev Food Sci Food Saf 19:1187–1217. 10.1111/1541-4337.12557. [DOI] [PubMed] [Google Scholar]
  • 6.Baker-Austin C, Oliver JD, Alam M, Ali A, Waldor MK, Qadri F, Martinez-Urtaza J. 2018. Vibrio spp. infections. Nat Rev Dis Primers 4:8. 10.1038/s41572-018-0005-8. [DOI] [PubMed] [Google Scholar]
  • 7.Gode-Potratz CJ, Kustusch RJ, Breheny PJ, Weiss DS, McCarter LL. 2011. Surface sensing in Vibrio parahaemolyticus triggers a programme of gene expression that promotes colonization and virulence. Mol Microbiol 79:240–263. 10.1111/j.1365-2958.2010.07445.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Boles BR, McCarter LL. 2002. Vibrio parahaemolyticus scrABC, a novel operon affecting swarming and capsular polysaccharide regulation. J Bacteriol 184:5946–5954. 10.1128/JB.184.21.5946-5954.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Yildiz FH, Visick KL. 2009. Vibrio biofilms: so much the same yet so different. Trends Microbiol 17:109–118. 10.1016/j.tim.2008.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Kimbrough JH, Cribbs JT, McCarter LL. 2020. Homologous c-di-GMP-binding Scr transcription factors orchestrate biofilm development in Vibrio parahaemolyticus. J Bacteriol 202:e00723-19. 10.1128/JB.00723-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Li W, Wang JJ, Qian H, Tan L, Zhang Z, Liu H, Pan Y, Zhao Y. 2020. Insights into the role of extracellular DNA and extracellular proteins in biofilm formation of Vibrio parahaemolyticus. Front Microbiol 11:813. 10.3389/fmicb.2020.00813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chen Y, Dai J, Morris JG, Jr, Johnson JA. 2010. Genetic analysis of the capsule polysaccharide (K antigen) and exopolysaccharide genes in pandemic Vibrio parahaemolyticus O3:K6. BMC Microbiol 10:274. 10.1186/1471-2180-10-274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zhong X, Lu R, Liu F, Ye J, Zhao J, Wang F, Yang M. 2021. Identification of LuxR family regulators that integrate into quorum sensing circuit in Vibrio parahaemolyticus. Front Microbiol 12:691842. 10.3389/fmicb.2021.691842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ferreira RB, Chodur DM, Antunes LC, Trimble MJ, McCarter LL. 2012. Output targets and transcriptional regulation by a cyclic dimeric GMP-responsive circuit in the Vibrio parahaemolyticus Scr network. J Bacteriol 194:914–924. 10.1128/JB.05807-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Khan F, Tabassum N, Anand R, Kim YM. 2020. Motility of Vibrio spp.: regulation and controlling strategies. Appl Microbiol Biotechnol 104:8187–8208. 10.1007/s00253-020-10794-7. [DOI] [PubMed] [Google Scholar]
  • 16.Prithvisagar KS, Krishna Kumar B, Kodama T, Rai P, Iida T, Karunasagar I, Karunasagar I. 2021. Whole genome analysis unveils genetic diversity and potential virulence determinants in Vibrio parahaemolyticus associated with disease outbreak among cultured Litopenaeus vannamei (Pacific white shrimp) in India. Virulence 12:1936–1949. 10.1080/21505594.2021.1947448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zheng Z, Li R, Aweya JJ, Yao D, Wang F, Li S, Tuan TN, Zhang Y. 2021. The PirB toxin protein from Vibrio parahaemolyticus induces apoptosis in hemocytes of Penaeus vannamei. Virulence 12:481–492. 10.1080/21505594.2021.1872171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hu M, Zhang Y, Gu D, Chen X, Waldor MK, Zhou X. 2021. Nucleolar c-Myc recruitment by a Vibrio T3SS effector promotes host cell proliferation and bacterial virulence. EMBO J 40:e105699. 10.15252/embj.2020105699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gu D, Zhang Y, Wang Q, Zhou X. 2020. S-nitrosylation-mediated activation of a histidine kinase represses the type 3 secretion system and promotes virulence of an enteric pathogen. Nat Commun 11:5777. 10.1038/s41467-020-19506-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Conner JG, Zamorano-Sánchez D, Park JH, Sondermann H, Yildiz FH. 2017. The ins and outs of cyclic di-GMP signaling in Vibrio cholerae. Curr Opin Microbiol 36:20–29. 10.1016/j.mib.2017.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Schild S, Tamayo R, Nelson EJ, Qadri F, Calderwood SB, Camilli A. 2007. Genes induced late in infection increase fitness of Vibrio cholerae after release into the environment. Cell Host Microbe 2:264–277. 10.1016/j.chom.2007.09.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Martinez-Wilson HF, Tamayo R, Tischler AD, Lazinski DW, Camilli A. 2008. The Vibrio cholerae hybrid sensor kinase VieS contributes to motility and biofilm regulation by altering the cyclic diguanylate level. J Bacteriol 190:6439–6447. 10.1128/JB.00541-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Mitchell SL, Ismail AM, Kenrick SA, Camilli A. 2015. The VieB auxiliary protein negatively regulates the VieSA signal transduction system in Vibrio cholerae. BMC Microbiol 15:59. 10.1186/s12866-015-0387-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Tischler AD, Lee SH, Camilli A. 2002. The Vibrio cholerae vieSAB locus encodes a pathway contributing to cholera toxin production. J Bacteriol 184:4104–4113. 10.1128/JB.184.15.4104-4113.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Chen HJ, Li N, Luo Y, Jiang YL, Zhou CZ, Chen Y, Li Q. 2018. The GDP-switched GAF domain of DcpA modulates the concerted synthesis/hydrolysis of c-di-GMP in Mycobacterium smegmatis. Biochem J 475:1295–1308. 10.1042/BCJ20180079. [DOI] [PubMed] [Google Scholar]
  • 26.Flemming HC, Wingender J, Szewzyk U, Steinberg P, Rice SA, Kjelleberg S. 2016. Biofilms: an emergent form of bacterial life. Nat Rev Microbiol 14:563–575. 10.1038/nrmicro.2016.94. [DOI] [PubMed] [Google Scholar]
  • 27.Ferreira RB, Antunes LC, Greenberg EP, McCarter LL. 2008. Vibrio parahaemolyticus ScrC modulates cyclic dimeric GMP regulation of gene expression relevant to growth on surfaces. J Bacteriol 190:851–860. 10.1128/JB.01462-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Groshong AM, Grassmann AA, Luthra A, McLain MA, Provatas AA, Radolf JD, Caimano MJ. 2021. PlzA is a bifunctional c-di-GMP biosensor that promotes tick and mammalian host-adaptation of Borrelia burgdorferi. PLoS Pathog 17:e1009725. 10.1371/journal.ppat.1009725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Jiao H, Li F, Wang T, Yam JKH, Yang L, Liang H. 2021. The pyocin regulator PrtR regulates virulence expression of Pseudomonas aeruginosa by modulation of Gac/Rsm system and c-di-GMP signaling pathway. Infect Immun 89:e00602-20. 10.1128/IAI.00602-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Nag D, Farr DA, Walton MG, Withey JH. 2020. Zebrafish models for pathogenic Vibrios. J Bacteriol 202:e00165-20. 10.1128/JB.00165-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Plaza N, Urrutia IM, Garcia K, Waldor MK, Blondel CJ. 2021. Identification of a family of Vibrio type III secretion system effectors that contain a conserved serine/threonine kinase domain. mSphere 6:e0059921. 10.1128/mSphere.00599-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Xie Y, Shao X, Deng X. 2019. Regulation of type III secretion system in Pseudomonas syringae. Environ Microbiol 21:4465–4477. 10.1111/1462-2920.14779. [DOI] [PubMed] [Google Scholar]
  • 33.Chaban B, Hughes HV, Beeby M. 2015. The flagellum in bacterial pathogens: for motility and a whole lot more. Semin Cell Dev Biol 46:91–103. 10.1016/j.semcdb.2015.10.032. [DOI] [PubMed] [Google Scholar]
  • 34.Zhu S, Kojima S, Homma M. 2013. Structure, gene regulation and environmental response of flagella in Vibrio. Front Microbiol 4:410. 10.3389/fmicb.2013.00410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Stewart BJ, McCarter LL. 2003. Lateral flagellar gene system of Vibrio parahaemolyticus. J Bacteriol 185:4508–4518. 10.1128/JB.185.15.4508-4518.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Ni B, Colin R, Link H, Endres RG, Sourjik V. 2020. Growth-rate dependent resource investment in bacterial motile behavior quantitatively follows potential benefit of chemotaxis. Proc Natl Acad Sci USA 117:595–601. 10.1073/pnas.1910849117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.McCarter L, Silverman M. 1990. Surface-induced swarmer cell differentiation of Vibrio parahaemolyticus. Mol Microbiol 4:1057–1062. 10.1111/j.1365-2958.1990.tb00678.x. [DOI] [PubMed] [Google Scholar]
  • 38.Hsieh ML, Waters CM, Hinton DM. 2020. VpsR directly activates transcription of multiple biofilm genes in Vibrio cholerae. J Bacteriol 202:e00234-20. 10.1128/JB.00234-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Kim YK, McCarter LL. 2007. ScrG, a GGDEF-EAL protein, participates in regulating swarming and sticking in Vibrio parahaemolyticus. J Bacteriol 189:4094–4107. 10.1128/JB.01510-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Kimbrough JH, McCarter LL. 2021. Identification of three new GGDEF and EAL domain-containing proteins participating in the Scr surface colonization regulatory network in Vibrio parahaemolyticus. J Bacteriol 203:e00409-20. 10.1128/JB.00409-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.de Souza Santos M, Salomon D, Orth K. 2017. T3SS effector VopL inhibits the host ROS response, promoting the intracellular survival of Vibrio parahaemolyticus. PLoS Pathog 13:e1006438. 10.1371/journal.ppat.1006438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Raghunath P. 2014. Roles of thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) in Vibrio parahaemolyticus. Front Microbiol 5:805. 10.3389/fmicb.2014.00805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Zhang L, Orth K. 2013. Virulence determinants for Vibrio parahaemolyticus infection. Curr Opin Microbiol 16:70–77. 10.1016/j.mib.2013.02.002. [DOI] [PubMed] [Google Scholar]
  • 44.Zhou X, Shah DH, Konkel ME, Call DR. 2008. Type III secretion system 1 genes in Vibrio parahaemolyticus are positively regulated by ExsA and negatively regulated by ExsD. Mol Microbiol 69:747–764. 10.1111/j.1365-2958.2008.06326.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Smith V, Josefsen M, Lindbäck T, Hegna IK, Finke S, Tourasse NJ, Nielsen-LeRoux C, Økstad OA, Fagerlund A. 2020. MogR is a ubiquitous transcriptional repressor affecting motility, biofilm formation and virulence in Bacillus thuringiensis. Front Microbiol 11:610650. 10.3389/fmicb.2020.610650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Yang M, Liu Z, Hughes C, Stern AM, Wang H, Zhong Z, Kan B, Fenical W, Zhu J. 2013. Bile salt-induced intermolecular disulfide bond formation activates Vibrio cholerae virulence. Proc Natl Acad Sci USA 110:2348–2353. 10.1073/pnas.1218039110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zhang W, Xie R, Zhang XD, Lee LTO, Zhang H, Yang M, Peng B, Zheng J. 2020. Organism dual RNA-seq reveals the importance of BarA/UvrY in Vibrio parahaemolyticus virulence. FASEB J 34:7561–7577. 10.1096/fj.201902630R. [DOI] [PubMed] [Google Scholar]
  • 48.Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402–408. 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 49.Hanahan D. 1983. Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166:557–580. 10.1016/s0022-2836(83)80284-8. [DOI] [PubMed] [Google Scholar]
  • 50.Yu Y, Fang L, Zhang Y, Sheng H, Fang W. 2015. VgrG2 of type VI secretion system 2 of Vibrio parahaemolyticus induces autophagy in macrophages. Front Microbiol 6:168. 10.3389/fmicb.2015.00168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Philippe N, Alcaraz JP, Coursange E, Geiselmann J, Schneider D. 2004. Improvement of pCVD442, a suicide plasmid for gene allele exchange in bacteria. Plasmid 51:246–255. 10.1016/j.plasmid.2004.02.003. [DOI] [PubMed] [Google Scholar]
  • 52.Guzman LM, Belin D, Carson MJ, Beckwith J. 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol 177:4121–4130. 10.1128/jb.177.14.4121-4130.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Hammer BK, Bassler BL. 2007. Regulatory small RNAs circumvent the conventional quorum sensing pathway in pandemic Vibrio cholerae. Proc Natl Acad Sci USA 104:11145–11149. 10.1073/pnas.0703860104. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Table S1 and Fig. S1 to S10. Download aem.02239-21-s0001.pdf, PDF file, 1.5 MB (1.5MB, pdf)


Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES