ABSTRACT
5-Hydroxypicolinic acid (5HPA), an important natural pyridine derivative, is microbially degraded in the environment. Previously, a gene cluster, hpa, responsible for 5HPA degradation, was identified in Alcaligenes faecalis JQ135. However, the transcription regulation mechanism of the hpa cluster is still unknown. In this study, the transcription start site and promoter of the hpa operon was identified. Quantitative reverse transcription-PCR and promoter activity analysis indicated that the transcription of the hpa operon was negatively regulated by a TetR family regulator, HpaR, whereas the transcription of hpaR itself was not regulated by HpaR. Electrophoretic mobility shift assay and DNase I footprinting revealed that HpaR bound to two DNA sequences, covering the −35 region and −10 region, respectively, in the promoter region of the hpa operon. Interestingly, the two binding sequences are partially palindromic, with 3 to 4 mismatches and are complementary to each other. 5HPA acted as a ligand of HpaR, preventing HpaR from binding to promoter region and derepressing the transcription of the hpa operon. The study revealed that HpaR binds to two unique complementary sequences of the promoter of the hpa operon to negatively regulate the catabolism of 5HPA.
IMPORTANCE This study revealed that the transcription of the hpa operon was negatively regulated by a TetR family regulator, HpaR. The binding of HpaR to the promoter of the hpa operon has the following unique features: (i) HpaR has two independent binding sites in the promoter of the hpa operon, covering −35 region and −10 region, respectively; (ii) the palindrome sequences of the two binding sites are complementary to each other; and (iii) both of the binding sites include a 10-nucleotide partial palindrome sequence with 3 to 4 mismatches. This study provides new insights into the binding features of the TetR family regulator with DNA sequences.
KEYWORDS: Alcaligenes faecalis JQ135, 5-hydroxypicolinic acid, TetR-type transcriptional regulator, biodegradation, HpaR
INTRODUCTION
Pyridines, including from natural sources and artificial synthesis, are a kind of important nitrogen heterocyclic compound. Pyridines are widely found in coal and oil and also produced by plants and microorganisms as secondary metabolites; furthermore, pyridine compounds are widely used to produce denaturant, dye, drug, disinfectant, and various pesticides (1–4). However, most pyridine compounds are poisonous, carcinogenic, and biorefractory due to containing a very stable nitrogen heterocycle. Thus, it is of great significance to study the catabolism of pyridine compounds (5, 6). 5-Hydroxypicolinic acid (5HPA) is a typical natural pyridine derivative with an ortho-substituted carboxyl group and a meta-hydroxy group in the pyridine ring (7). 5HPA is produced either by the marine bacterium Nocardia species (8) or by microalgae (9). Recently, 5HPA was also found as a biologically active compound in several traditional Chinese medicines, including Hericium erinaceus, Gynura divaricata, and purslane (10–12).
Previously, we identified a gene cluster, hpa, responsible for the catabolism of 5HPA in Alcaligenes faecalis JQ135 (Fig. 1A) (7). Cluster hpa consists of 11 genes (AFA_18535 to AFA_18585) (Fig. 1B); the five successive genes AFA_18535, AFA_18540, AFA_18545, AFA_18550, and AFA_18555 were predicted to encode an ABC-type transporter, AFA_18575 (hpaM) encodes a monocomponent FAD-dependent monooxygenase that decarboxylatively hydroxylates 5HPA to 2,5-dihydroxypyridine (2,5DHP), AFA_18565 (hpaX) encodes a dioxygenase catalyzing the oxidation of 2,5DHP to N-formylmaleamic acid (NFM), AFA_18560 (hpaD) encodes a deformylase catalyzing the conversion of NFM to maleamic acid, and AFA_18570 (hpaF) encodes an amidohydrolase transforming maleamic acid to maleic acid (7). AFA_18585 (hpaR) was predicted to encode a TetR-type regulator. Reverse transcription-PCR (RT-PCR) results indicated that genes AFA_18535 to AFA_18575 (hpaM) form an operon (hpa operon), whereas AFA_18585 (hpaR) was separately transcribed.
FIG 1.
Promoter analysis of the hpa operon. (A) Steps of the 5HPA degradation pathway. (B) Organization of the cluster hpa. (C) DNA elements in the promoter of the hpa operon. The –35 and –10 regions are shown in boxes, the transcriptional start site (TSS) is shown in red and indicated with an arrow, and the hpa start codon is also indicated with an arrow. (D) Chromatograms display the partial sequences of the RACE products. The green letter A shown by an arrow indicates the TSS.
TetR proteins represent a large family of transcriptional regulators that are widely distributed among bacteria (13). TetR was originally named for controlling the expression of a tetracycline resistance (tet) gene (14). Members of the TetR family contain a conserved helix-turn-helix (HTH) DNA-binding motif. TetR proteins usually act as negative regulators controlling the transcription of genes involved in osmotic stress, solvent and antibiotic resistance, synthesis of antibiotics, and efflux pumping (13, 15, 16). Furthermore, it has been reported that TetR proteins are involved in the transcriptional regulation of genes or gene clusters responsible for the catabolism of many refractory toxic pollutants, such as resorcinol, cymene, biphenyl, halogenated alkane, and nicotine (17–20). However, the regulatory mechanism of catabolism of 5HPA by a TetR-type regulator remains unknown. In this study, we investigated how HpaR regulated the transcription of operon hpa in Alcaligenes faecalis JQ135.
RESULTS
Determination of the transcriptional start site of operon hpa.
In a previous study, the hpa operon (AFA_18535 to AFA_18575) was found to be responsible for 5HPA degradation in A. faecalis JQ135, and a putative TetR-family transcriptional regulator-encoding gene (AFA_18585, designated hpaR) is located downstream of the hpa operon. However, the promoter region of the hpa operon is still unknown. To determine the transcriptional start sites (TSS) of the hpa operon, 5′ rapid amplification of cDNA ends (5′RACE) using total RNA extracted from JQ135 cells grown in mineral salts medium (MSM) supplemented with 5HPA were carried out with the A at the 49th base upstream of the hpa operon start codon (ATG) as the TSS. The promoters (−10 and −35 regions) of the hpa operon then were predicted based on the identified TSS. A more detailed analysis of the promoter of the hpa operon is shown in Fig. 1.
HpaR negatively regulates the expression of the hpa operon in A. faecalis JQ135.
To investigate the role of hpaR, a deletion mutant (deletion region from Tyr66 to Tyr159) and its complementary strain, designated JQ135ΔhpaR and JQ135ΔhpaR/hpaR strains, respectively, were constructed. Quantitative RT-PCR results showed that when JQ135 was grown with 5HPA, the transcription of AFA_18535 and hpaM increased 51.9- and 18.7-fold, respectively, compared to that with growth with citrate (Fig. 2A). In contrast, regardless of citrate or 5HPA, the transcription of AFA_18535 and hpaM in JQ135ΔhpaR strain was much higher than that in JQ135 grown with citrate. Furthermore, the transcriptions of AFA_18535 and hpaM in the JQ135ΔhpaR/hpaR complementary strain were similar to that of wild-type JQ135. These results indicated that the transcription of the hpa operon in JQ135 was negatively regulated by HpaR. Furthermore, the activities of the hpa operon promoter were measured. The promoter region Phpa, a 216-bp fragment upstream of TSS, was cloned into shuttle plasmid pME6522, and then the recombinant plasmid pME6522-Phpa was introduced into JQ135 and JQ135ΔhpaR strains. In the absence of 5HPA, the Phpa–lacZ activity in JQ135ΔhpaR strain increased 7.8-fold compared with that in JQ135, and in the presence of 5HPA, the Phpa–lacZ activity in JQ135ΔhpaR strain increased 2.3-fold compared with that in JQ135 (Fig. 2B). We also compared the 5HPA degradation rates of JQ135, JQ135ΔhpaR, and JQ135ΔhpaR/hpaR strains. As shown in Fig. 3, the wide-type strain JQ135 and the complemented JQ135ΔhpaR/hpaR strain completely degraded 1.0 mM 5HPA in MSM within 7 h; in contrast, JQ135ΔhpaR mutant almost completely degraded 1.0 mM 5HPA within 2 h, indicating that the degrading rate of 5HPA in JQ135ΔhpaR strain was significantly higher than that in JQ135 and JQ135ΔhpaR/hpaR strain. These results further confirmed that HpaR indeed negatively regulates the transcription of the hpa operon and the degradation of 5HPA. However, it is interesting that the data in Fig. 2A and B indicated that the hpaR gene itself was constitutively transcribed at a low level and is not regulated by HpaR.
FIG 2.
Study on the transcriptional regulation of the hpa operon by HpaR. (A) Quantitative transcriptional analysis of AFA_18535, hpaM, and hpaR in strain JQ135, the hpaR knockout mutant (JQ135ΔhpaR), and the hpaR-complemented strain (JQ135ΔhpaR/hpaR) in the presence of 1.0 mM citrate or 1.0 mM 5HPA. The transcriptional level of the 16S rRNA gene was used as an internal standard, and the data in each column were calculated with the 2−ΔΔCT threshold cycle (CT) method using three replicates. The error bars indicate standard deviations. (B) β-Galactosidase activity measured from plasmid pME6522-Phpa in JQ135 and JQ135ΔhpaR strains cultured in the absence or presence of 5HPA. The empty vector pME6522 was used as a negative control. The data were derived from three independent measurements, and the error bars indicate standard deviations.
FIG 3.

Degradation of 5HPA by wild-type strain JQ135, the JQ135ΔhpaR hpaR knockout mutant strain, and the JQ135ΔhpaR/hpaR hpaR-complemented strain. The data were derived from three independent measurements, and the error bars indicate standard deviations.
Determination of the HpaR binding sites.
To further study the function of HpaR, hpaR gene was expressed in E. coli, and the recombinant HpaR was purified as a C-terminal His6-tagged protein by using Ni2+-nitrilotriacetic acid-agarose chromatography (see Fig. S1 in the supplemental material). SDS-PAGE analysis showed the production of an expected 26.3-kDa protein after isopropyl-β-d-thiogalactopyranoside (IPTG) induction, indicating the successful expression and purification of HpaR. The results of gel filtration chromatography indicated that HpaR was a dimer (Fig. S2).
To determine whether HpaR directly interacts with the promoter region of the hpa operon, electrophoretic mobility shift assay (EMSA) was performed using the promoter region sequence (−621 to +67 of the TSS) and HpaR. As shown in Fig. 4, HpaR could bind to the promoter region in a concentration-dependent manner and completely shifted the DNA fragment at a 12-fold molar excess. It is interesting that when the concentration of HpaR was less than 120 nM, two bands of HpaR-DNA complex appeared in the electrophoretogram, indicating that HpaR had two binding sites in the promoter region of the hpa operon. To determine the exact binding site, the promoter region was subdivided into 5 overlapping fragments (F1 to F5), and each fragment was used in EMSA. The results showed that HpaR could only bind to fragment F5 (Fig. 5C). The fragment F5 was further divided into F5a and F5b, and EMSA results showed that HpaR could bind with both of them (Fig. 5C), which confirmed that HpaR has two separate binding sites in the promoter of the hpa operon.
FIG 4.

EMSA using the Phpa-hpa fragment and purified HpaR. The lanes contain 10 nM DNA fragment and purified HpaR (0, 10, 20, 50, 80, 100, 120, 150, 180, 200, and 250 nM, respectively).
FIG 5.
Identification of HpaR binding sites in the promoter region of the hpa operon. (A) The binding sequences and their locations in the promoter of the hpa operon. The palindromic symmetry is indicated by inverted arrows, and the mismatch bases are indicated by red. The locations of fragments used for EMSA are shown below. (B) The complementary areas of site 1 and site 2 are marked by vertical lines, and the palindromic symmetry is indicated by inverted arrows. (C) EMSA of subfragments F1, F2, F3, F4, F5, F5a, and F5b with purified HpaR. The lanes contain the following: the DNA fragment (10 nM) alone (−) and the DNA fragment (10 nM) with purified HpaR (120 nM) (+). (D) DNase I footprinting assay of the HpaR binding site. A total of 400 ng (80 nM) of 6-carboxyfluorescein-labeled DNA probe was incubated without HpaR or with 0.5 μg HpaR (500 nM), and the molar ratio of DNA to HpaR is 0.16. The HpaR-protected region is shown in the dashed box, and the protected sequence is shown at the bottom.
The DNase I footprinting experiment was performed to identify the exact HpaR binding sequences. The results indicated that two DNA regions (site 1 and site 2), located in F5a and F5b, respectively, were protected by HpaR (Fig. 5A). The sequence of site 1 was 5′-ATTTTATTTATTGGCTAGTCAGTTAATAA-3′ (29 nucleotides [nt], −58 to −29 region), encompassing the −35 box, and the sequence of site 2 was 5′-CTAGAAATAATCAATCAGTTAATTAAAA-3′ (28 nt, −20 to +8 region), encompassing the −10 box (Fig. 5D). These two binding sequences were partially palindromic, with 3 to 4 mismatches (Fig. 5A), and were complementary to each other (Fig. 5B). To validate its role, EMSAs using site 1 (left wild-type, LW), site 2 (right wild-type, RW), and derived fragments with nucleotide changes in the palindrome were performed (Fig. S3). In site 1, no mutant binds to HpaR. In site 2, only the RM1-1 fragment could shift to form DNA-HpaR complex, while other mutant fragments could not bind to HpaR. The results indicated that the palindrome sequence of site 1, TTNANTGNCT, and the palindrome sequence of site 2, AANTAANNNA, are essential for HpaR binding.
5HPA prevents HpaR binding to the promoter region.
The effects of 5HPA and the intermediates generated during 5HPA catabolism on HpaR binding to the promoter region of the hpa operon were determined by EMSA. As shown in Fig. 6A, 5HPA prevented the binding of HpaR to DNA fragment F5, whereas intermediates 2,5DHP, NFM, maleamic acid, and maleic acid could not prevent the binding of HpaR to fragment F5. Figure 6B shows that the amount of HpaR–DNA complex decreased with the increased concentration of 5HPA, and the HpaR–DNA complex completely disappeared when the 5HPA concentration reached 12.0 mM. These results indicated that 5HPA could be regarded as a ligand of HpaR that interacted with HpaR and dissociated the binding of HpaR with the promoter of the hpa operon.
FIG 6.
Effects of 5HPA and the intermediates on the binding of HpaR to the promoter region of the hpa operon. (A) EMSA with promoter sequence (10 nM) and purified HpaR (120 nM) in the presence of 2.5 mM 5-hydroxypicolinic acid (5HPA), 2.5 mM 2,5-dihydroxypyridine (2,5DHP), 2.5 mM N-formylmaleamic acid (NFM), or 2.5 mM maleamic acid (MLA). The DNA used was fragment F5 in Fig. 4A. (B) EMSA with promoter sequence (10 nM) and purified HpaR (120 nM) in the presence of different concentrations of 5HPA.
DISCUSSION
Gene hpaR is located downstream of cluster hpa, and a BLAST search in NCBI shows that HpaR shares 36% identity with TetR family transcriptional regulator NicR2, which negatively regulates the catabolism of nicotine in Pseudomonas putida S16 (18), and very high identities (>98%) with some putative TetR-type proteins from Alcaligenes faecalis. In the phylogenetic tree of HpaR and some related TetR-type regulators, HpaR is clustered with TetR-type regulators and forms a subclade with the putative TetR-type regulators from Alcaligenes faecalis (Fig. S5). Furthermore, HpaR contained typical HTH DNA-binding domains of the TetR-type regulator (Fig. S6). This analysis indicated that HpaR is a TetR family transcriptional regulator. Bioinformation analysis indicated that the hpa gene clusters were widely distributed in genus Alcaligenes (39 of 51 strains with genome sequence available), including A. faecalis, A. pakistanensis, and Alcaligenes species strains (Fig. S4). Bacterial strains containing the hpa gene cluster other than genus Alcaligenes were also predicted, for example, Arenibaculum, Azospirillum, Bordetella, Chitinasiproducens, Eoetvoesia, Erwinia, Pseudorhodoplanes, Psudomonas, Telmatospirillum, Variovorax, and Xenophilus (Fig. S4). It is interesting that all the hpa clusters have a TetR family gene, and the sequences and gene arrangement of these hpa clusters are highly conserved. These results suggest that many bacteria generally have the ability and a similar regulation mechanism to degrade 5HPA.
Our results showed that HpaR regulates the transcription of the hpa operon, which was responsible for catabolism of 5HPA. The expression of the hpa operon was strongly induced by its substrate 5HPA, whereas hpaR itself was not induced by 5HPA but was constitutively transcribed alone at a low level. Deletion of the hpaR gene resulted in the constitutive expression of the hpa operon and a significant reduction in the lag period of 5HPA degradation, and complementation of the hpaR gene (in trans) restored repression and induction by 5HPA. EMSA and DNase I footprinting revealed that HpaR bound to the promoter sequence of the hpa operon, and in the presence of 5HPA, HpaR could not bind with the promoter sequence. Thus, based on the above-described analysis, we propose a model of transcription regulation of the hpa operon by HpaR: when 5HPA is absent, HpaR is bound to the hpa promoter to repress the transcription of the hpa operon; when 5HPA is added, it acts as a ligand of HpaR preventing HpaR from binding to the promoter region, which results in the high transcription of the hpa operon.
In previous studies, the binding sites of TetR-type regulators on promoter regions are usually approximately 20 to 30 nucleotides (nt) in length and contain a strict palindrome sequence to bind to the homodimer of the regulator (13, 21–25). In a few cases, the binding sites are partial palindromic sequences with 1 to 2 mismatches (26–28). TetR-type regulators generally have only one binding site at each promoter, which is located in the −35 region or −10 region (29–31). For example, NicR2 from Pseudomonas putida binds to a 28-bp sequence containing an 11-bp palindrome with one mismatch in the promoter of the nic2 operon (18). An exception is AlkX from Dietzia sp. strain DQ12-45-1b, which binds to an unusually long 48-bp sequence (5′-TGGACAAA-N11-TGTCTAGACA-N11-TTGTCTA-3′), which covers both −10 and −35 regions, upstream of the alkW1 gene (32). Furthermore, TetR-type regulators can bind to promoter regions of multiple operons or genes to regulate their transcription, e.g., AccR of Streptomyces avermitilis binds to the promoters of the accD1A1-hmgL-fadE4 operon, echA8, echA9, and fadE2, which are involved in the production and assimilation of acetyl- and propionyl-CoAs (33); MfsR of Pseudomonas knackmussii B13 binds to promoters of the mfsR and mfsABC operons, which code for an efflux pump system (34). The binding sites of TetR-type regulators to different promoters always share the same or similar palindrome sequences (24, 33, 34). Compared with previous studies, the binding of HpaR with the promoter of the hpa operon is unique. First, there is only one promoter upstream of the hpa operon; however, HpaR has two independent binding sites in the promoter area, covering the −35 region and −10 region, respectively (Fig. 4), and this binding form may inhibit the transcription of the hpa operon more thoroughly than the binding to only one site when substrate 5HPA is absent, saving more energy and nutrition, and facilitates the utilization of 5HPA by A. faecalis JQ135. Second, both binding sites include a 10-bp partial palindrome sequence. The palindrome sequence of site 1 is TTNANTGNCT, whereas the palindrome sequence of site 2 is AANTAANNNA. Each of them contains 3 to 4 mismatches, so many mismatches are rare in previous reports. Finally, it is interesting that the palindrome sequences of the two sites are neither identical nor similar but are complementary to each other; this feature was never reported in previous studies. However, further study is needed to elucidate why HpaR binds to two complementary partial palindrome sequences on the promoter region of the hpa operon.
MATERIALS AND METHODS
Chemicals and media.
5HPA (99%) and its structural analogs were purchased from J&K Scientific Ltd. (Shanghai, China). 2,5DHP (98%) was purchased from SynChem OHG (Altenburg, Germany). All other chemicals and solvents used for this experiment were commercially available. Enzymes used in this study were purchased from Vazyme Biotech Co., Ltd. (Nanjing, China). Mineral salts medium (MSM) consisted of the following components (g·liter−1): 1.0 NH4Cl, 1.0 NaCl, 1.5 K2HPO4, 0.5 KH2PO4, and 0.2 MgSO4·7H2O, pH 7.0; the carbon source was added as required. Luria-Bertani broth consisted of the following components (g·liter−1): 10.0 peptone, 5.0 yeast extract, and 10.0 NaCl at pH 7.0.
Bacterial strains, plasmids, and growth conditions.
Bacterial strains and plasmids used in this study are listed in Table 1. A. faecalis JQ135 was previously isolated from municipal wastewater and was capable of degrading a variety of pyridine compounds, such as 5HPA and picolinic acid. E. coli strains were grown at 37°C, while other strains were grown at 30°C. Media were supplemented with kanamycin (Km; 50 μg·mL−1), gentamicin (Gm; 50 μg·mL−1), streptomycin (Str; 50 μg·mL−1), or tetracycline (Tet; 40 μg·mL−1) as required.
TABLE 1.
Strains and plasmids used in this study
| Strain or plasmid | Description | Source |
|---|---|---|
| Strains | ||
| A. faecalis JQ135 | Strr, wild type, 5HPA-degrading strain, G– | 7 |
| JQ135ΔhpaR | Strr, hpaR-deletion mutant of JQ135 | This study |
| JQ135ΔhpaR/hpaR | Strr, Gmr, JQ135ΔhpaR containing pBBR-hpaR | This study |
| Escherichia coli DH5α | F− recA1 endA1 thi-1 hsrdR17 supE44 relA1 deoRΔ (lacZYA-argF) U169 φ80lacZΔM15 | Vazyme |
| HB101(pRK2013) | Helper strain for triparental mating | Lab stock |
| BL21(DE3) | F− ompT hsdS (rB− mB−) gal dcm lacY1 (DE3) | Vazyme |
| Plasmids | ||
| pET29a(+) | Kmr, expression plasmid | Lab stock |
| pJQ200SK | Gmr, mob+, orip15A, lacZα+, sacB, suicide plasmid | Lab stock |
| pBBR1MCS-5 | Gmr, broad-host-range cloning plasmid | Lab stock |
| pJQ-ΔhpaR | Gmr, hpaR gene deletion plasmid based on pJQ200SK | This study |
| pBBR-hpaR | Gmr, pBBR1MCS-5 harboring hpaR | This study |
| pET-hpaR | Kmr, NdeI-XhoI fragment containing hpaR inserted into pET29a(+) | This study |
| pME6522 | Tcr, shuttle vector for transcriptional lacZ fusion and promoter probing | 40 |
| pME6522-Phpa | Tcr, pME6522 containing a 216-bp fragment upstream of TSS of hpa | This study |
| pME6522-PhpaR | Tcr, 88-bp fragment, promoter region of hpaR, directionally cloned into pME6522 | This study |
| JQ135/pME6522-Phpa | Strr, Tcr, JQ135 containing pME6522-Phpa | This study |
| JQ135/pME6522-PhpaR | Strr, Tcr, JQ135 containing pME6522-PhpaR | This study |
| JQ135ΔhpaR/pME6522-Phpa | Strr, Tcr, JQ135ΔhpaR containing pME6522-Phpa | This study |
| JQ135ΔhpaR/pME6522-PhpaR | Strr, Tcr, JQ135ΔhpaR containing pME6522-PhpaR | This study |
| pMD19-T | TA cloning vector, Ampr | TaKaRa |
| pMD19T-hpa | 216-bp fragment, upstream of TSS of the hpa operon, directionally cloned into pMD19-T, Ampr | This study |
Gene deletion and complementation.
All primers used in this study are listed in Table 2. Deletion of the hpaR gene in A. faecalis JQ135 was performed via the two-step homologous recombination method using the suicide plasmid pJQ200SK (35). Two primer pairs (kohpaR-UF/kohpaR-UR and kohpaR-DF/kohpaR-DR) were used to amplify the homologous recombination-directing sequences. Both PCR fragments then were cloned into SacI/PstI-digested pJQ200SK using the ClonExpress MultiS one-step cloning kit (Vazyme Biotech Co., Ltd., Nanjing, China). The resulting plasmid, pJQ-ΔhpaR, was then introduced into A. faecalis JQ135 cells by triparental mating with E. coli HB101(pRK2013) as the helper. Single-crossover mutants were screened on LB plates containing Str (50 μg·mL−1) and Gm (50 μg·mL−1). A double-crossover mutant (JQ135ΔhpaR) was selected on LB plates containing Str (50 μg·mL−1) and 10% (wt/vol) sucrose.
TABLE 2.
Primers used in this study
| Primer | Sequence (5′–3′) | Description |
|---|---|---|
| kohpaR-UF | AGCTTGATATCGAATTCCTGCAGTGCAGATTCTGGAAGAAATACTGCCCG | To construct pJQ-ΔhpaR |
| kohpaR-UR | CTTCCCGTGTTCGCGCATCAAGGCCTTTGCGGGCGAAATGCTG | To construct pJQ-ΔhpaR |
| kohpaR-DF | GCATTTCGCCCGCAAAGGCCTTGATGCGCGAACACGGGAAGT | To construct pJQ-ΔhpaR |
| kohpaR-DR | AGGGAACAAAAGCTGGAGCTCAGTTGATCAAGGCTTGGGTCACAG | To construct pJQ-ΔhpaR |
| hpaR-F | GTGGCGGCCGCTCTAGAACTAGTTCAAGCCTTGCCAGGCAAG | To construct pBBR-hpaR |
| hpaR-R | TCGAATTCCTGCAGCCCGGGTCTTGCGTTGGGCCACACGTAA | To construct pBBR-hpaR |
| exphpaRF | TTTGTTTAACTTTAAGAAGGAGATATACATATGGGCCGTGTAACTTTGTCGTC | To construct pET-hpaR |
| exphpaRR | TCAGTGGTGGTGGTGGTGGTGAGCCTTGCCAGGCAAGACAA | To construct pET-hpaR |
| qRT-AFA-F | TCGGGCGTGTCCTCAAAAA | Transcriptional analysis |
| qRT-AFA-R | CCAGGGCTTCGATCTGGC | Transcriptional analysis |
| qRT-M-F | AGTGCACCGGGGTGTCGC | Transcriptional analysis |
| qRT-M-R | AATCAGGCATCTCATCAAAGGGC | Transcriptional analysis |
| qRT-R-F | TCCAAGTACGGCCTGTTT | Transcriptional analysis |
| qRT-R-R | GCTCGGTGTGCAAACGG | Transcriptional analysis |
| qRT-16S-F | CGCGGTAATACGTAGGGTG | Transcriptional analysis |
| qRT-16S-R | AACTTCACGCGTTAGCTGC | Transcriptional analysis |
| TSS1 | GCCATCCTGGGTTTCGGCTGCCACAAAAACACC | 5′ RACE |
| TSS2 | GCCGCCCCGGCCCCAGTCATCATTCACCCC | 5′ RACE |
| TSS3 | CGCCCGAGAGCAGGGGCACTTTGTACTTTTGCGCC | 5′ RACE |
| 5′ adaptor primer | GCTGTCAACGATACGCTACGTAACGGCATGACAGTGGGGGGGGGGGGG | 5′ RACE |
| 5′ RACE outer primer | GCTGTCAACGATACGCTACGTAAC | 5′ RACE |
| EMSA-F | GGAGTCGGGGTATTTGCAGC | EMSA |
| EMSA-R | CGTCATGAGCAACCCCATCG | EMSA |
| EMSAF1-F | GGAGTCGGGGTATTTGCAGC | EMSA |
| EMSAF1-R | TGATTTGACATCAGGCCCGCA | EMSA |
| EMSAF2-F | CGACTTCGTTCTTATGGAACATGGG | EMSA |
| EMSAF2-R | CCTCTTTCTGATGATGAAATTCCGCC | EMSA |
| EMSAF3-F | ATTTCAAGAAGGGAACTGCCACC | EMSA |
| EMSAF3-R | GGTGACAACACTCAAGTGCTATTTG | EMSA |
| EMSAF4-F | ATGTGCTGAGACATCGGGTTTTC | EMSA |
| EMSAF4-R | GCCAATAAATAAAATATAGGGAATTCCCTACAG | EMSA |
| EMSAF5-F | GGCCTCCATCATCCATGAAAACTAC | EMSA |
| EMSAF5-R | TTTGAAATATTATTAACTGACTAGCCAATAAATAAAAT | EMSA |
| EMSASite1-F | CCTTTGGTCTACCCTTCAAATAGCAC | EMSA |
| EMSASite1-R | TTTGAAATATTATTAACTGACTAGCCAATAAATAAAAT | EMSA |
| EMSASite2-F | TATTTCAAACTAGAAATAATCAATCAGTTAATT | EMSA |
| EMSASite2-R | ATTACGCTCTTTGACAGCCAACTTGG | EMSA |
| lacZ-hpa-EcoRI | ATCGGAATTCGGCCTCCATCATCCATGAAAACTAC | To construct pME6522-Phpa |
| lacZ-hpa-PstI | ATCGCTGCAGCTCAATAGCCAGTTCAACCTGTTTGC | To construct pME6522-Phpa |
| lacZ-hpaR-EcoRI | ATCGGAATTCGCGTCGCGTCGCCAATC | To construct pME6522-PhpaR |
| lacZ-hpaR-PstI | ATCGCTGCAG ATCCGACGACAAAGTTACACGG | To construct pME6522-PhpaR |
| RWF | CTAGAAATAATCAATCAGTTAATTAAAAACCAAGGAAGGAGATA | Point mutation |
| RM1-1F | CTAGCCATAATCAATCAGTTAATTAAAAACCAAGGAAGGAGATA | Point mutation |
| RM2-1F | CTAGAAAGCCTCACTCAGTTAATTAAAAACCAAGGAAGGAGATA | Point mutation |
| RM2-2F | CTAGAAATAATCAAGCAGGGCATTAAAAACCAAGGAAGGAGATA | Point mutation |
| RM1-2F | CTAGAAATAATCAATCAGTTAAGGAAAAACCAAGGAAGGAGATA | Point mutation |
| RM1F | CTAGAAAGCCTCAATCAGGGCATTAAAAACCAAGGAAGGAGATA | Point mutation |
| RM2F | CTAGCCATAATCACGCAGTTAAGGAAAAACCAAGGAAGGAGATA | Point mutation |
| RM1 + 2-1F | CTAGCCAGCCTCACTCAGTTAATTAAAAACCAAGGAAGGAGATA | Point mutation |
| RM1 + 2-2F | CTAGAAATAATCAAGCAGGGCAGGAAAAACCAAGGAAGGAGATA | Point mutation |
| RM1 + 2F | CTAGCCAGCCTCACGCAGGGCAGGAAAAACCAAGGAAGGAGATA | Point mutation |
| RR | ATTACGCTCTTTGACAGCCAACTTGG | Point mutation |
| LWR | TTATTAACTGACTAGCCAATAAATAAAATATAGGGAATTCCCTAC | Point mutation |
| LWF | TTATTAACTGACTAGCCACTCCATAAAATATAGGGAATTCCCTAC | Point mutation |
| LM1-1F | TTATTAACTGACTCTCACATAAATAAAATATAGGGAATTCCCTAC | Point mutation |
| LM2-1F | TTATTAACGTAAGAGCCAATAAATAAAATATAGGGAATTCCCTAC | Point mutation |
| LM2-2F | TTAGGACCTGACTAGCCAATAAATAAAATATAGGGAATTCCCTAC | Point mutation |
| LM1-2F | TTAGGACCTGACTAGCCACTACCTAAAATATAGGGAATTCCCTAC | Point mutation |
| LM1F | TTATTAACGTAAGCTCACATAAATAAAATATAGGGAATTCCCTAC | Point mutation |
| LM2F | TTATTAACTGACTCTCACACACCGCCAATATAGGGAATTCCCTAC | Point mutation |
| LM1 + 2-1F | TTAGGACCGTAAGAGCCAATAAATAAAATATAGGGAATTCCCTAC | Point mutation |
| LM1 + 2-2F | TTAGGACCGTAAGCTCACACACCGCCAATATAGGGAATTCCCTAC | Point mutation |
| LM1 + 2F | CCTTTGGTCTACCCTTCAAATAGCAC | Point mutation |
The plasmid pBBR-hpaR was constructed for gene complementation (36). hpaR was amplified using the primers hpaR-F and hpaR-R and then ligated to XhoI/HindIII-digested pBBR1MCS-5, generating pBBR-hpaR. The pBBR-hpaR plasmid was then transferred into the JQ135ΔhpaR mutant via biparental mating to generate the JQ135ΔhpaR/hpaR complemented strain.
RNA extraction and RT-PCR.
A. faecalis JQ135, JQ135ΔhpaR, and JQ135ΔhpaR/hpaR strains were cultured in LB with appropriate antibiotics to an optical density at 600 nm (OD600) of 0.8, harvested by centrifugation at 4,000 × g, washed twice with MSM, and then resuspended in MSM. The cell suspension (OD600 of 1.0) was transferred into a 50-mL flask containing 20 mL MSM supplemented with 1.0 mM substrate (5HPA or citrate). After incubation at 30°C until 40% to 60% of the substrate was degraded, cells were harvested by centrifugation at 12,000 × g. Total RNA was isolated using an RNA isolation kit (TaKaRa, Dalian, China). Reverse transcription-quantitative PCR (qRT-PCR) was conducted with a PrimeScript RT reagent kit (Vazyme Biotech, Nanjing, China) (37). The acquired cDNA was diluted 125-fold to serve as templates for quantitative PCR (qPCR). qPCR was performed in an Applied Biosystems 7300 real-time PCR system (Applied Biosystems, CA, USA) using ChamQ Universal SYBR qPCR master mix (Vazyme Biotech, Nanjing, China). The 16S rRNA gene was used as an internal standard, and relative expression was quantified using the 2−ΔΔCT threshold cycle (CT) method. All qRT-PCR primers are listed in Table 2. All samples were run in triplicate.
Cloning and expression of hpaR gene.
The hpaR sequence (excluding the stop codon) was PCR amplified with primers exphpaRF and exphpaRR and fused into the NdeI/XhoI-digested pET29a(+). The recombinant plasmid pET-hpaR was transformed into E. coli BL21(DE3). Cells of the recombinant were cultured in LB at 37°C to an OD600 of 0.5 and then induced at 16°C for 16 h via addition of 0.1 mM isopropyl-β-d-thiogalactopyranoside (IPTG). His-tagged protein was purified via Ni2+-nitrilotriacetic acid agarose chromatography (Novagen), eluted using 100 mM imidazole, and then dialyzed against phosphate-buffered saline (PBS) (50 mM, pH 7.0) at 4°C for 24 h. The purity and size of the protein were analyzed via 12.5% SDS-PAGE. The oligomeric state of the protein was determined via gel filtration chromatography (38). The oligomeric state of the native protein was determined via gel filtration chromatography (7). The HpaR was loaded onto a column of Superdex 2000 (GE Healthcare AKTA Prime liquid system) that was equilibrated with 10 mM PBS buffer (pH 7.4, with 0.1 M NaCl) at a flow rate of 1 mL·min−1. The standard proteins lactate dehydrogenase (140 kDa), β-galactosidase (116 kDa), phosphorylase b (97 kDa), bovine serum albumin (66 kDa), and ovalbumin (45 kDa) were used.
EMSA.
All DNA fragments, including nucleotides in the mutated promoter used in the EMSA, were PCR amplified from A. faecalis JQ135 genomic DNA using primers shown in Table 2 and purified with a DNA purification kit (Vazyme Biotech, Nanjing, China). An approximately 10 nM DNA fragment was mixed with 120 mM purified HpaR in a binding buffer (50 mM Tris-HCl [pH 7.0], 30 mM KCl, 5% [vol/vol] glycerol, 1.0 mM EDTA, and 5.0 mM dithiothreitol). The effects of 5HPA, 2,5DHP, NFM, or maleamic acid on the binding of HpaR to the promoter probes were evaluated by adding 2.5 mM concentrations of these substrates to the reaction system, respectively. The mixture was incubated at 25°C for 30 min and then separated by 6% (vol/vol) native polyacrylamide gel electrophoresis in 0.5× Tris-glycine-EDTA. The gel was stained with nucleic acid dyes (Sangon Biotech, Shanghai, China), and the DNA fragments were visualized under UV light.
DNase I footprinting.
The promoter region of cluster hpa was PCR amplified with the primer pair EMSAF5-F/R, listed in Table 2, and inserted into the plasmid pMD19-T to generate pMD19T-hpa. For preparation of fluorescent FAM-labeled probes, the promoter region was PCR amplified with 2× TOLO HIFI DNA polymerase premix (TOLO Biotech, Shanghai) from the plasmid pMD19T-hpa using primers of M13F-47 and M13R-48(FAM). The FAM-labeled probes were purified by the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and were quantified with a NanoDrop 2000C (Thermo, USA).
DNase I footprinting assays were performed as described by Zianni et al. (39). For each assay, 400 ng probe was incubated with different amounts of HpaR in a total volume of 40 μl. After incubation for 30 min at 25°C, 10 μl solution containing 0.015 U DNase I (Promega) and 100 nmol freshly prepared CaCl2 was added and further incubated at 37°C for 1 min. The reaction was stopped by adding 140 μl DNase I stop solution (200 mM unbuffered sodium acetate, 30 mM EDTA, and 0.15% SDS). Digested samples were first extracted with phenol-chloroform and then precipitated with ethanol, and the pellets were dissolved in 30 μL Milli-Q water. For both digested DNA fragments and sequencing products, each sample was added to HiDi formamide and GeneScan-LIZ500 size standards and was analyzed with an Applied Biosystems 3730 DNA analyzer. The final concentration of HpaR used in the DNase I footprinting results was 500 nM, and the molar ratio of DNA to HpaR in the DNA footprinting experiment was 0.16.
Construction of plasmids and promoter-lacZ transcriptional fusions.
Phpa-lacZ and PhpaR-lacZ plasmids were constructed. The gene regions were amplified from genomic DNA of strain JQ135 using the primers listed in Table 2. The PCR product was digested using EcoRI and PstI and ligated into the EcoRI/PstI-digested pME6522 to generate pME6522-Phpa and pME6522-PhpaR. The resulting vector containing Phpa-lacZ and PhpaR-lacZ fusions were transformed into A. faecalis JQ135 and JQ135ΔhpaR strains, respectively. Empty vector pME6522 was transformed into A. faecalis JQ135 and JQ135ΔhpaR strains as negative controls.
To perform the β-galactosidase assay, strain JQ135/pME6522-Phpa was inoculated into 50-mL flasks with 20 mL of MSM containing 1.0 mM 5HPA or 1.0 mM citrate and cultured at 30°C and 180 rpm. When exponential phase was reached, the cells were harvested by centrifugation at 4,000 × g. β-Galactosidase activity was determined using o-nitrophenyl-β-d-galactopyranoside (ONPG) as the substrate in 1 mL Z-buffer (0.246 g MgSO4·7H2O, 0.75 g KCl, 12.5 g Na2HPO4·12H2O, 6.2 g NaH2PO4·2H2O, 2.7 mL β-mercaptoethanol, and 1 liter H2O, pH 7.0) containing 100 μl chloroform and 50 μl SDS (0.1%) (40). β-Galactosidase activity was normalized to the optical density at 420 nm o-nitrophenol (ONP), and the cell density was measured to the optical density at 600 nm and expressed in Miller units (OD400 × 1,000/OD600 × V × T) (41). One Miller unit of enzyme activity is defined as the amount of enzyme required to catalyze ONPG to produce 1 μmol o-nitrophenol (ONP) per minute. All samples were tested in triplicate.
TSS detection of the hpa cluster.
A. faecalis JQ135 was cultured in LB with appropriate antibiotics to an OD600 of 0.8, harvested by centrifugation at 6,000 × g, washed twice with MSM, and then resuspended in MSM. The cell suspension (OD600 of 0.6) was transferred into a 50-mL flask containing 20 mL MSM supplemented with 1.0 mM 5HPA. After incubation at 30°C until 40% to 60% of the 5HPA was degraded, cells were harvested by centrifugation at 12,000 × g. Total RNA was isolated using an RNA isolation kit (TaKaRa, Dalian, China). The TSS of the hpa operon were determined by 5′RACE using 2 μg total RNA extracted from JQ135 cells. First-strand cDNA was synthesized with the primer TSS1 and then poly(C) tailed by terminal deoxynucleotidyl transferase (TdT). The poly(C)-tailed cDNA was subsequently used as a template for PCR. After amplification using the 5′ adaptor primer and TSS2, the resulting product was further amplified with the 5′RACE outer primer and TSS3 to generate the final PCR fragment. The final PCR product was purified by a gel extraction kit (Vazyme Biotech, Nanjing, China) and then ligated into pMD-19T vector (TaKaRa, Dalian, China) for sequencing using primers of M13F-47 and M13R-48. Sequencing results were analyzed with BioEdit, and the first base after 14 consecutive poly(C) or poly(G) is the TSS.
Bacterial degradation assay.
A. faecalis JQ135 and its derivates were inoculated into 250-mL flasks with 100 mL of LB and cultured at 30°C and 180 rpm. The initial OD600 was set at 0.01. When late exponential phase was reached, the culture was harvested by centrifugation at 4°C and 4,000 × g for 10 min, washed twice with MSM, and finally resuspended in MSM. The washed cells were then incubated at 30°C in MSM containing 1.0 mM 5HPA, with an initial cell density at an OD600 of 1.0. Samples were taken from the flasks periodically to measure the concentration of 5HPA. Determination of 5HPA was performed by high-performance liquid chromatography analysis as in our previous report (7). All experiments were conducted in triplicate.
ACKNOWLEDGMENTS
The study was financially supported by the National Natural Science Foundation of China (no. 31870092, 31970096, 32070092, and 32170128).
We declare no conflicts of interest.
Footnotes
Supplemental material is available online only.
Contributor Information
Jiguo Qiu, Email: qiujiguo@njau.edu.cn.
Jian He, Email: hejian@njau.edu.cn.
Maia Kivisaar, University of Tartu.
REFERENCES
- 1.Guan AY, Liu CL, Sun XF, Xie Y, Wang MA. 2016. Discovery of pyridine-based agrochemicals by using intermediate derivatization methods. Bioorg Med Chem 24:342–353. 10.1016/j.bmc.2015.09.031. [DOI] [PubMed] [Google Scholar]
- 2.Hamaker JW, Johnston H, Martin RT, Redemann CT. 1963. A picolinic acid derivative: a plant growth regulator. Science 141:363. 10.1126/science.141.3578.363. [DOI] [PubMed] [Google Scholar]
- 3.Banerjee A, Dubnau E, Quemard A, Balasubramanian V, Um K, Wilson T, Collins D, De Lisle G, Jacobs W. 1994. inhA, a gene encoding a target for isoniazid and ethionamide in Mycobacterium tuberculosis. Science 263:227–230. 10.1126/science.8284673. [DOI] [PubMed] [Google Scholar]
- 4.Kaiser JP, Feng YC, Bollag JM. 1996. Microbial metabolism of pyridine, quinoline, acridine, and their derivatives under aerobic and anaerobic conditions. Microbiol Rev 60:483–491. 10.1128/mr.60.3.483-498.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Tekle-Rottering A, Reisz E, Jewell KS, Lutze HV, Ternes TA, Schmidt W, Schmidt TC. 2016. Ozonation of pyridine and other N-heterocyclic aromatic compounds: kinetics, stoichiometry, identification of products and elucidation of pathways. Water Res 102:582–593. 10.1016/j.watres.2016.06.021. [DOI] [PubMed] [Google Scholar]
- 6.Brinkmann M, Maletz S, Krauss M, Bluhm K, Schiwy S, Kuckelkorn J, Tiehm A, Brack W, Hollert H. 2014. Heterocyclic aromatic hydrocarbons show estrogenic activity upon metabolization in a recombinant transactivation assay. Environ Sci Technol 48:5892–5901. 10.1021/es405731j. [DOI] [PubMed] [Google Scholar]
- 7.Qiu J, Liu B, Zhao L, Zhang Y, Dan C, Xin Y, Jiang J, Hong Q, Jian H. 2018. A novel degradation mechanism for pyridine derivatives in Alcaligenes faecalis JQ135. Appl Environ Microbiol 84:e00910-18. 10.1128/AEM.00910-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Makar'Eva TN, Kalinovskii AI, Stonik VA, Vakhrusheva EV. 1989. Identification of 5-hydroxypicolinic acid among the products biosynthesized by Nocardia sp. Chem Nat Compd 25:125–126. 10.1007/BF00596721. [DOI] [Google Scholar]
- 9.Yoshikuni Y, Wargacki AJ, Cooper SR, Raisner R, Gill A, Shital Tripathi A, Enquist-Newman MK. 2012. A method of producing 5-hydroxypyriding-2-carboxylic acid from alginate pA1. US patent WO.
- 10.Chen L, Song Z-Y, Wang J-J, Song H-T, Zhang G-G, Wang J-H. 2010. Studies on the chemical constituents from aerial parts of Gynura divaricata. Zhong Yao Cai 33:373–376. [PubMed] [Google Scholar]
- 11.Li G, Yu K, Li F, Xu K, Li J, He S, Cao S, Tan G. 2014. Anticancer potential of Hericium erinaceus extracts against human gastrointestinal cancers. J Ethnopharmacol 153:521–530. 10.1016/j.jep.2014.03.003. [DOI] [PubMed] [Google Scholar]
- 12.Tian J, Liang X, Gao p, Li L, Song S. 2015. Chemical constituents of Portulaca oleracea. Chem Nat Compd 51:760–1691. 10.1007/s10600-015-1403-8. [DOI] [Google Scholar]
- 13.Cuthbertson L, Nodwell JR. 2013. The TetR family of regulators. Microbiol Mol Biol Rev 77:440–475. 10.1128/MMBR.00018-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Tovar K, Ernst A, Hillen W. 1988. Identification and nucleotide sequence of the class E tet regulatory elements and operator and inducer binding of the encoded purified Tet repressor. Mol Gen Genet 215:76–80. 10.1007/BF00331306. [DOI] [PubMed] [Google Scholar]
- 15.Aramaki H, Sagara Y, Hosoi M, Horiuchi T. 1993. Evidence for autoregulation of camR, which encodes a repressor for the cytochrome P-450cam hydroxylase operon on the Pseudomonas putida CAM plasmid. J Bacteriol 175:7828–7833. 10.1128/jb.175.24.7828-7833.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Aramaki H, Sagara Y, Kabata H, Shimamoto N, Horiuchi T. 1995. Purification and characterization of a cam repressor (CamR) for the cytochrome P-450cam hydroxylase operon on the Pseudomonas putida CAM plasmid. J Bacteriol 177:3120–3127. 10.1128/jb.177.11.3120-3127.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Liang J-L, Nie Y, Wang M, Xiong G, Wang Y-P, Maser E, Wu X-L. 2016. Regulation of alkane degradation pathway by a TetR family repressor via an autoregulation positive feedback mechanism in a Gram-positive Dietzia bacterium. Mol Microbiol 99:338–359. 10.1111/mmi.13232. [DOI] [PubMed] [Google Scholar]
- 18.Wang L, Tang H, Yu H, Yao Y, Xu P. 2014. An unusual repressor controls the expression of a crucial nicotine-degrading gene cluster in Pseudomonas putida S16. Mol Microbiol 91:1252–1269. 10.1111/mmi.12533. [DOI] [PubMed] [Google Scholar]
- 19.Ohta Y, Maeda M, Kudo T. 2001. Pseudomonas putida CE2010 can degrade biphenyl by a mosaic pathway encoded by the tod operon and cmtE, which are identical to those of P putida F1 except for a single base difference in the operator-promoter region of the cmt operon. Microbiology (Reading) 147:31–41. 10.1099/00221287-147-1-31. [DOI] [PubMed] [Google Scholar]
- 20.Eaton RW. 1997. p-Cymene catabolic pathway in Pseudomonas putida F1: cloning and characterization of DNA encoding conversion of p-cymene to p-cumate. J Bacteriol 179:3171–3180. 10.1128/jb.179.10.3171-3180.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Zhao Y, Feng R, Zheng G, Tian J, Ruan L, Ge M, Jiang W, Lu Y. 2015. Involvement of the TetR-Type Regulator PaaR in the Regulation of Pristinamycin I Biosynthesis through an Effect on Precursor Supply in Streptomyces pristinaespiralis. J Bacteriol 197:2062–2071. 10.1128/JB.00045-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Hu B, Lidstrom M. 2012. CcrR, a TetR family transcriptional regulator, activates the transcription of a gene of the ethylmalonyl coenzyme a pathway in Methylobacterium extorquens AM1. J Bacteriol 194:2802–2808. 10.1128/JB.00061-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kojic M, Aguilar C, Venturi V. 2002. TetR family member PsrA directly binds the Pseudomonas rpoS and psrA promoters. J Bacteriol 184:2324–2330. 10.1128/JB.184.8.2324-2330.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Agari Y, Sakamoto K, Kuramitsu S, Shinkai A. 2012. Transcriptional repression mediated by a TetR family protein, PfmR, from Thermus thermophilus HB8. J Bacteriol 194:4630–4641. 10.1128/JB.00668-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Liu W, Zhang Q, Guo J, Chen Z, Li J, Wen Y. 2015. Increasing avermectin production in Streptomyces avermitilis by manipulating the expression of a novel TetR-family regulator and its target gene product. Appl Environ Microbiol 81:5157–5173. 10.1128/AEM.00868-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Alnaseri H, Kuiack RC, Ferguson KA, Schneider JET, Heinrichs DE, McGavin MJ. 2019. DNA binding and sensor specificity of FarR; a novel TetR family regulator required for induction of the fatty acid efflux pump FarE in Staphylococcus aureus. J Bacteriol 201:602–618. 10.1128/JB.00602-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Liu Y, Yan T, Jiang L, Wen Y, Song Y, Chen Z, Li J. 2013. Characterization of SAV7471, a TetR-family transcriptional regulator involved in the regulation of coenzyme a metabolism in Streptomyces avermitilis. J Bacteriol 195:4365–4372. 10.1128/JB.00716-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Xu D, Seghezzi N, Esnault C, Virolle MJ. 2010. Repression of antibiotic production and sporulation in Streptomyces coelicolor by overexpression of a TetR family transcriptional regulator. Appl Environ Microbiol 76:7741–7753. 10.1128/AEM.00819-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Xu Y, Ke M, Li J, Tang Y, Wang N, Tan G, Wang Y, Liu R, Bai L, Zhang L, Wu H, Zhang B. 2019. Negative involvement of the TetR-type regulator SLCG_2919 in the regulation of lincomycin biosynthesis in Streptomyces lincolnensis. Appl Environ Microbiol 85:713–721. 10.1128/AEM.02091-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Cheng M, Pei D, He X, Liu Y, Zhu P, Yan X. 2021. The operon encoding hydrolytic dehalogenation of 4-chlorobenzoate is transcriptionally regulated by the TetR-type repressor FcbR and its ligand 4-chlorobenzoyl coenzyme A. Appl Environ Microbiol 87:5143–5152. 10.1128/AEM.02652-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Li T, Zhao K, Huang Y, Li D, Jiang CY, Zhou N, Fan Z, Liu SJ. 2012. The TetR-type transcriptional repressor RolR from Corynebacterium glutamicum regulates resorcinol catabolism by binding to a unique operator, rolO. Appl Environ Microbiol 78:6009–6016. 10.1128/AEM.01304-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Liang J-L, Gao Y, He Z, Nie Y, Wang M, JiangYang J-H, Zhang XC, Shu W-S, Wu X-L. 2017. Crystal structure of the TetR family repressor, AlkX, from Dietzia sp. DQ12-45-1b implicated in biodegradation of n-alkanes. Appl Environ Microbiol 83:5123–5134. 10.1128/AEM.01447-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Lyu M, Cheng Y, Han X, Wen Y, Song Y, Li J, Chen Z. 2020. AccR, a TetR family transcriptional repressor, coordinates short-chain acyl-CoAs homeostasis in Streptomyces avermitilis. Appl Environ Microbiol 86:5078–5085. 10.1128/AEM.00508-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Pradervand N, Delavat F, Sulser S, Miyazaki R, van der Meer JR. 2014. The TetR-type MfsR protein of the integrative and conjugative element (ICE) ICEclc controls both a putative efflux system and initiation of ICE transfer. J Bacteriol 196:3971–3979. 10.1128/JB.02129-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Quandt J, Hynes MF. 1993. Versatile suicide vectors which allow direct selection for gene replacement in gram-negative bacteria. Gene 127:15–21. 10.1016/0378-1119(93)90611-6. [DOI] [PubMed] [Google Scholar]
- 36.Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM, Peterson KM. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175–176. 10.1016/0378-1119(95)00584-1. [DOI] [PubMed] [Google Scholar]
- 37.Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR. Methods 25:402–408. 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 38.Qiu J, Zhao L, Xu S, Chen Q, Chen L, Bin L, Qing H, Lu Z, He J. 2019. Identification and characterization of a novel pic gene cluster responsible for picolinic acid degradation in Alcaligenes faecalis JQ135. Appl Environ Microbiol 201:e00077-19. 10.1128/JB.00077-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Zianni M, Tessanne K, Merighi M, Laguna R, Tabita FR. 2006. Identification of the DNA bases of a DNase I footprint by the use of dye primer sequencing on an automated capillary DNA analysis instrument. J Biomol Tech 17:103. [PMC free article] [PubMed] [Google Scholar]
- 40.Ke Z, Zhou Y, Jiang W, Zhang M, Wang H, Ren Y, Qiu J, Cheng M, Hong Q. 2021. McbG, a LysR family transcriptional regulator activates the mcbBCDEF gene cluster involved in the upstream pathway of carbaryl degradation in Pseudomonas sp. XWY-1. Appl Environ Microbiol 87:e02970-20. 10.1128/AEM.02970-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Sambrook J, Fritsch FE, Maniatis T. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1 to S6. Download aem.02390-21-s0001.pdf, PDF file, 1.3 MB (1.3MB, pdf)




