Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
editorial
. 1999 Sep;43(9):2333–2334. doi: 10.1128/aac.43.9.2333

Mechanisms of Quinolone Resistance in Clinical Isolates of Shigella dysenteriae

Jasimuddin Ahamed 1,2, Jayanti Gangopadhyay 1,2, Manikuntala Kundu 1,2,*, Ajay K Sinha 1,2
PMCID: PMC89476  PMID: 10577351

In gram-negative bacteria, gyrase and topoisomerase IV are primary and secondary targets, respectively, of the fluoroquinolones. In addition to the mutations in the genes encoding the target enzymes (1, 4), quinolone resistance may also be associated with increased efflux of the drugs (2, 5). Possible mechanisms of quinolone resistance were investigated in clinical isolates of Shigella dysenteriae obtained from the International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh (AK) and the National Institute of Cholera and Enteric Diseases, Calcutta, India (CI, DS, IPB, and IMC). The quinolone resistance-determining regions (QRDR) of gyrA and parC were amplified with the primer pairs 5′TACACCGG TCAACAT TGAGG3′-5′T TAATGAT TGCCGCCG TCGG3′ and 5′GTATGCGATGTCTGAACTGGGCCTG3′-5′CGACAACCGGGATTCGGTG3′, respectively. The Ser83→Leu substitution appeared sufficient to confer high-level nalidixic acid resistance (MIC > 250 μg/ml) as determined by standard methods (3) (Table 1). Four strains—DS-1, DS-2, CI-1, and CI-2—for which the norfloxacin MICs were 2 μg/ml and the ciprofloxacin MICs were between 0.5 and 1 μg/ml harbored the mutation Asp87→Gly in GyrA. None of the isolates examined had any mutations in the QRDR-encoding part of the parC gene.

TABLE 1.

Quinolone susceptibility, alterations in GyrA, and norfloxacin accumulation in clinical isolates of S. dysenteriaea

Strain(s) MIC (μg/ml)
Codon change at position:
Accumulation of NFLXb
NAL NFLX OFLX CFLX 83 87 Before addition of CCCP After addition of CCCP
AK19520 16 0.25 0.25 0.25 —c — 0.23 ± 0.01 0.34 ± 0.013
AK21104 >250 2 1 2 Ser (TTG)→Leu (TCG) — 0.22 ± 0.005 0.33 ± 0.012
AK27228 >250 2 2 2 Ser (TTG)→Leu (TCG) — 0.22 ± 0.005 0.33 ± 0.011
AK24467 >250 2 1 2 Ser (TTG)→Leu (TCG) — 0.22 ± 0.005 0.32 ± 0.013
AK21809 >250 2 1 4 Ser (TTG)→Leu (TCG) — 0.23 ± 0.010 0.33 ± 0.014
IPB32, IPB34, IMC118, IMC119 32 16 4 4 — — 0.10 ± 0.001 0.30 ± 0.012
IPB38 16 16 4 4 — — NDd ND
IMC67 16 16 4 4 — — 0.10 ± 0.001 0.30 ± 0.013
DS-1, DS-2 64 2 2 0.5 — Asp (GAC)→Gly (GGC) 0.25 ± 0.010 0.32 ± 0.014
CI-1, CI-2 64 2 2 1 — Asp (GAC)→Gly (GGC) 0.23 ± 0.010 0.33 ± 0.012
a

NAL, nalidixic acid; NFLX, norfloxacin; OFLX, ofloxacin; CFLX, ciprofloxacin. 

b

The data are means of three determinations ± standard deviations, expressed in micrograms per milligram (dry weight) of cells. 

c

—, identical to the codon in E. coli. 

d

ND, not determined. 

Accumulation of norfloxacin was studied as described by Ghosh et al. (2) by using carbonyl cyanide m-chlorophenylhydrazone (CCCP) (100 μM) as proton motive force (PMF) uncoupler. The DS, CI, and AK series (with the exception of AK 19520) showed steady-state levels of norfloxacin accumulation (both before and after addition of CCCP) similar to those for the susceptible strain AK19520 (Table 1)—evidence against involvement of a PMF-dependent efflux pump in resistance in these strains. Considering the DS and CI series, the mutation corresponding to Asp87→Gly therefore appeared sufficient to confer approximately 10-fold resistance to the fluoroquinolones in comparison with AK19520. On the other hand, the accumulation of norfloxacin at steady state (before addition of CCCP) was less in the IPB and IMC series in comparison with AK19520. Addition of CCCP increased the level of accumulation in these resistant strains to a level comparable to that of AK19520, suggesting a role of a PMF-dependent efflux pump in the development of resistance. Since these strains lacked gyrA or parC mutations in the QRDR, increased efflux pump activity appears likely to be sufficient to confer 20- to 80-fold resistance to the fluoroquinolones compared to AK19520. We have previously shown, using isogenic strains (2), that increased efflux of the fluoroquinolones may be a mechanism of development of fluoroquinolone resistance. The data obtained in this study with clinical isolates supports this notion. However, the possible involvement of gyrB or parE mutations in the decreased susceptibilities of the isolates to quinolones cannot be excluded.

Acknowledgments

We are grateful to M. John Albert and M. A. Salam of the International Centre for Diarrhoeal Disease Research, Bangladesh, for supplying the AK series of clinical isolates.

This work was supported in part by grants from the Council of Scientific and Industrial Research and the Department of Science and Technology, Government of India, to M.K.

REFERENCES

  • 1.Drlica K, Zhao X. DNA gyrase, topoisomerase IV, and the 4-quinolones. Microbiol Mol Biol Rev. 1997;61:377–392. doi: 10.1128/mmbr.61.3.377-392.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ghosh A S, Ahamed J, Chauhan K K, Kundu M. Involvement of an efflux system in high-level fluoroquinolone resistance of Shigella dysenteriae. Biochem Biophys Res Commun. 1998;242:54–56. doi: 10.1006/bbrc.1997.7902. [DOI] [PubMed] [Google Scholar]
  • 3.National Committee for Clinical Laboratory Standards. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. 2nd ed. 1990. Approved standard M7-A2. National Committee for Clinical Laboratory Standards, Wayne, Pa. [Google Scholar]
  • 4.Rahman M, Mauff G, Levy J, Coutrier M, Pulverer G, Glasdorff N, Butzler J P. Detection of 4-quinolone resistance mutation in gyrA gene of Shigella dysenteriae type 1 by PCR. Antimicrob Agents Chemother. 1994;38:2488–2491. doi: 10.1128/aac.38.10.2488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhanel G G, Karlowsky J A, Saunders M H, Davidson R J, Hoban D J, Hancock R E W, McLean I, Nicolle L E. Development of multiple-antibiotic resistance (Mar) mutants of Pseudomonas aeruginosa after serial exposure to fluoroquinolones. Antimicrob Agents Chemother. 1995;39:489–495. doi: 10.1128/aac.39.2.489. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES