Abstract
Agasicles hygrophila is a classical biological agent used to control alligator weed (Alternanthera philoxeroides). Previous research has indicated that the heat shock factor (HSF) is involved in regulating the transcriptional expression of Hsp70 in response to heat resistance in A. hygrophila. However, the regulatory mechanism by which AhHsf regulates the expression of AhHsp70 remains largely unknown. Here, we identified and cloned a 944 bp AhHsp70 promoter (AhHsp70p) region from A. hygrophila. Subsequent bioinformatics analysis revealed that the AhHsp70p sequence contains multiple functional elements and has a common TATA box approximately 30 bp upstream of the transcription start site, with transcription commencing at a purine base approximately 137 bp upstream of ATG. Promoter deletion analyses revealed that the sequence from −944 to −744 bp was the core regulatory region. A dual-luciferase reporter assay indicated that overexpressed AhHsf significantly enhanced the activity of AhHsp70p. Furthermore, qPCR showed that AhHsp70 expression increased with time in Spodoptera frugiperda (Sf9) cells, and AhHsf overexpression significantly upregulated AhHsp70 expression in vitro. Characterization of the upstream regulatory mechanisms demonstrated that AhHsf binds to upstream cis-acting elements in the promoter region of AhHsp70 from −944 to −744 bp to activate the AhHSF–AhHSP pathway at the transcriptional level to protect A. hygrophila from high temperature damage. Furthermore, we proposed a molecular model of AhHsf modulation of AhHsp70 transcription following heat shock in A. hygrophila. The findings of this study suggest that enhancing the heat tolerance of A. hygrophila by modulating the upstream pathways of the Hsp family can improve the biocontrol of A. philoxeroides.
Keywords: Agasicles hygrophila, transcription factor AhHsf, heat shock protein 70 promoter (Hsp70p), cell transfection, real-time quantitative PCR (RT-qPCR), inverse PCR (I-PCR)
1. Introduction
Insects are poikilothermal organisms that adapt to different environmental temperatures through a variety of physiological and biochemical responses, and this ability directly influences their population expansion and distribution [1,2]. Moreover, climatic adaptability can drive insect adaptive evolution, promoting population differentiation and even the formation of new species [3,4,5].
Organisms respond to the chemical and physiological stresses associated with elevated temperatures by increasing the synthesis of heat shock proteins (Hsps) [6,7,8,9,10], which protect cells from hyperthermic stress by binding to denatured proteins and facilitating their correct refolding [8,11,12]. Under normal conditions, the expression of Hsp is typically maintained at very low levels, although expression levels can be rapidly upregulated in response to stress conditions such as heat shock [13,14]. In terms of insect thermotolerance, Hsp70, a member of the highly conserved chaperone class of proteins, is a typical representative of the heat shock gene family [15,16]. The Hsp70 promoter has beenis used extensively in transgenic and gene therapy studies to drive the expression of exogenous genes [14,17], and numerous in vitro studies have sought to elevate its transcriptional activity for selected transgenes [18]. In this regard, the regulation of transcriptional gene expression via DNA elements such as promoters and enhancers playsan important role in controlling the expression of genes associated with stress resistance [19,20,21,22].
The heat shock response represents a typical case of inducible gene expression [15,23] that involves transcriptional activation mediated by the heat shock factor (HSF), which binds to specific elements in the heat shock gene [24,25,26,27]. Among the stress-related proteins, members of the most abundant and conserved Hsp70 family have frequently been proposed as potential biomarkers of cellular toxicity [28]. Li et al. found that AtHsf regulates the expression of stress-responsive genes (Hsps) to enhance tolerance to heat and other abiotic stresses in Arabidopsis by functional analysis of AtHsf knockout mutants and AtHsf overexpressing transgenic plants [25]. In Caenorhabditis elegans, Baird et al. found that HSF-1 modulates the calcium-binding protein PAT-10 to increase thermotolerance and longevity during thermal stress [23]. In addition, it has been reported that post-translational modifications of Hsp70 family proteins including phosphorylation, acetylation, ubiquitination, aminoylation, and ADP ribosylation play an important role in regulating Hsp70 activity [29].
The flea beetle Agasicles hygrophila Selman & Vogt, which is used as an important biological control agent for alligator weed (Alternanthera philoxeroides [Amaranthaceae]) is markedly influenced by temperature [30,31,32]. Previous field surveys in Hunan Province, China have revealed that the population density of A. hygrophila decreases sharply during mid-summer from July to September, thereby limiting the control of A. philoxeroides population growth at this time of the year [33,34]. The correlation between high temperatures (>36 °C and even above 39 °C) and the population decline of this beetle species indicates that extremely high temperatures may be the primary factor suppressing the control of alligator weed during mid-summer [35,36,37]. In addition, temperature data for Changsha City collected from 2003 to 2013 indicated that in July and August, the frequencies of extremely high temperatures exceeding 36 °C were 42.5% and 32.1%, respectively, and the daily maximum temperatures recorded were often above 39 °C [37]. (Supplementary Table S1; [China Meteorological Data, http://data.cma.gov.cn/, accessed on 6 August 2020]). Alternanthera philoxeroides (Mart.) Griseb., an aquatic amaranth native to South America [38], was introduced into China in the 1930s as a forage crop [39], and has spread throughout the southern regions of the country, becoming one of the most noxious weeds in China [39,40]. This alien species has been recognized as a serious aquatic pest problem threatening aquatic ecosystems worldwide and is currently listed as one of the 16 most serious invasive species in China [31,32,41].
In our efforts to elucidate the molecular mechanisms underlying the heat resistance of A. hygrophila, we previously demonstrated the importance of the AhHsp70 in the thermotolerance of this beetle [42] and subsequently isolated and identified a heat shock factor (AhHsf) and its putative downstream target gene, AhHsp70. Our findings provide evidence that AhHsf is involved in regulating the transcriptional expression of AhHsp70 in response to the thermotolerance of A. hygrophila [43]. However, the mechanism by which AhHsf regulates the expression of AhHsp70 remains poorly understood.
In the present study, we sought to verify our hypothesis that AhHsp70 plays a pro-active role in A. hygrophila stress resistance by interacting with AhHsf. To this end, we determined the sequence of the AhHsp70 promoter (AhHsp70p) using the inverse PCR (I-PCR) technique of chromosome walking, and performed subsequent bioinformatics analysis. In addition, we characterized the AhHsp70 core promoter region by promoter deletion analysis. Finally, using a dual-luciferase reporter (DLR) assay system, we determined the interaction between AhHsf and AhHsp70p and established that AhHsf directly targets the AhHsp70 core promoter region to activate the AhHSF–AhHSP70 signaling pathway by regulating the transcriptional expression of AhHsp70. These findings provide important insights into the regulatory mechanisms associated with the response of A. hygrophila to high external temperatures, and will potentially contribute to predicting the efficacy of biocontrol using this beetle in the face of ongoing climate change.
2. Results
2.1. Analysis of the AhHsp70p Sequence in A. hygrophila
In this study, we isolated and identified a 944-bp upstream promoter sequence of the AhHsp70 gene (AhHsp70p) from A. hygrophila using I-PCR which was deposited in the NCBI database (GenBank accession number: MZ351037) (Figure 1). Bioinformatics analysis revealed that the AhHsp70p sequence contains multiple functional elements including a common TATA box, which is a DNA sequence recognized by transcription factors, located approximately 30 bp upstream of the transcription start site. Berkeley Drosophila Genome Project: Neural network promoter prediction indicated that AhHsp70p transcription commences from a purine base approximately 137 bp upstream of the ATG coding region (Figure 1). Furthermore, JASPAR and Tfsitescan predictions indicated that AhHsp70p has transcription factor binding sites at approximately −850 bp (Figure 1), whereas MethPrimer analysis revealed that AhHsp70p does not contain CpG islands (Supplementary Figure S1).
Figure 1.
Schematic representation of the promoter sequence of the AhHsp70 gene (AhHsp70p) from Agasicles hygrophila based on bioinformatics analysis. The AhHsp70p sequence contains multiple functional elements and a common TATA box at approximately 30 bp upstream of the transcription start site. Transcription is believed to commence at a purine base approximately 137 bp upstream of the coding region of ATG. The blue circle on the left represents other unknown sequences upstream of the AhHsp70p. −944, 0, 1941, and 2049 refer to the cloned promoter sequence location, the start codon location, the end of the coding region sequence location, and the 3′-UTR sequence location, respectively.
2.2. Analysis of AhHsp70 Promoter Reporter Plasmid Activity
To determine the optimal co-transfection efficiency of the recombinant plasmid (pGL3-basic-AhHsp70p) and internal reference plasmid (PRL-TK), we assessed different ratios of the recombinant plasmid and the internal control vector plasmid used for co-transfection and established that the optimal transfection efficiency was obtained at a ratio of 10:1 (Supplementary Figure S2, F(144) = 48.01, p < 0.0001; F(344) = 425.03, p < 0.0001; F(544) = 44.49, p < 0.0001; F(744) = 124.66, p < 0.0001; F(944) = 133.42, p < 0.0001). Thereafter, we analyzed the activity of the AhHsp70p reporter plasmids in Spodoptera frugiperda (Sf9) cells using thea TransDetect® DLR assay system. The results indicated that, with the exception of pGL3-basic-AhHsp70p-144, the reporter plasmids showed significantly higher activity than the control plasmid (Figure 2, t(144) = −1.34, p = 0.2525; t(344) = −6.55, p = 0.0028; t(544) = −12.44, p = 0.0002; t(744) = −21.67, p < 0.0001; t(944) = −20.34, p < 0.0001). Moreover, with an increase in the length of the promoter sequence, we detected a corresponding gradual enhancement of reporter plasmid activity, with the pGL3-basic-AhHsp70p-944 plasmid showing the highest activity (Figure 2; t(944, 744) = −10.98, p = 0.0005; t(944) = −20.34, p < 0.0001). Together, these results indicate that the sequence from −744 bp to 0 bp may represent the basal promoter region, whereas that from −944 bp to −744 bp constitutes the core regulatory region.
Figure 2.
Analysis of the luciferase activity of truncated sequences of AhHsp70p. In this experiment, Spodoptera frugiperda (Sf9) cells were used for the stable expression of AhHsp70 in vitro. Sf9 cells were transfected with recombinant plasmids containing AhHsp70p sequences of differing deletion length or pGL3-Basic and pRL-TK as controls for 48–96 h and the cells were harvested for the luciferase activity assay. qdz represents the AhHsp70 promoter. All values are shown as the mean ± SD. The data were analyzed using the Student’s t-test. ** p < 0.01, extremely significant; *** p < 0.001, extremely extremely significant; ns, not significant.
2.3. Characterization of the Interaction between Transcription Factor AhHsf and AhHsp70p
Sf9 cells were co-transfected with an AhHsf overexpression vector (PIZ/V5-His-Hsf) (Figure 3C and Supplementary Figure S3F) and AhHsp70p expression vector, and a DLR assay was used to determine the influence of AhHsf overexpression on the activity of the target gene promoter AhHsp70p (Figure 3B). The DLR assay results revealed that compared to cells transfected with the control vector, AhHsf overexpression significantly enhanced the activity of AhHsp70p in vitro (Figure 3A, t(144) = −1.82, p = 0.1435; t(344) = 1.1, p = 0.3335; t(544) = 0.79, p = 0.4754; t(744) = −0.81, p = 0.4633; t(944) = −7.94, p = 0.0014).
Figure 3.
Overexpressed AhHsf enhanced the activity of AhHsp70p in vitro. In this experiment, Spodoptera frugiperda (Sf9) cells were used for the stable expression of AhHsp70 in vitro. (A) Characterization of the interaction between transcription factor AhHsf and AhHsp70p. Analysis of the luciferase activity of AhHsp70p in response to the overexpression of AhHsf based on a dual-luciferase reporter assay system. pGL3-Basic was used as a control. (B) Schematic diagram of Sf9 cells co-transfected with AhHsf and AhHsp70p luciferase reporter plasmids. (C) Agarose gel electrophoresis of the AhHsf sequence and double-enzyme digestion of the recombinant plasmid. M denotes a Trans DNA marker and lanes 1 and 2 show samples from duplicate analyses. All values are shown as the mean ± SD. The data were analyzed using the Student’s t-test. ** p < 0.01, extremely significant; ns, not significant.
2.4. Expression Levels of AhHsp70 Following In Vitro Transfection
The level of AhHsp70 mRNA expression following in vitro transfection was determined by RT-qPCRThe results indicated that the levels of AhHsp70 expression increased with the extension of Sf9 cell proliferation time from 48 to 96 h (F(5,12) = 128.51, p < 0.0001), although there was no significant difference between the expression levels at 72 hand 96 h (Figure 4, F = 0.86, p = 0.4067).
Figure 4.
Expression analysis of AhHsp70 gene at 48, 72, and 96 h after transfection in Spodoptera frugiperda (Sf9) cells. Relative mRNA levels were determined using the 2−ΔΔCt method and normalized to those of the β-actin. The figure shows data on the relative AhHsp70 gene expression levels analyzed using one-way ANOVA followed by the least significant difference (LSD) test and bars with different letters indicate significant differences (p < 0.05). All values are shown as the mean ± SD of three replicates and pGL3-Basic was used as a control.
2.5. Transcription Factor AhHsf Upregulates the Expression of AhHsp70 In Vitro
The expression of AhHsp70 and AhHsf in co-transfected cells was determined using RT-qPCR, and the results indicated that there was a significant increase in AhHsf and AhHsp70 expression compared to the control group (Figure 5, t(AhHsf) = −9.50, p = 0.0109; t(AhHsp70) = −7.16, p = 0.0020). These findings indicate that overexpression of AhHsf can significantly promote the expression of AhHsp70 and that this gene plays a regulatory role in the activation of AhHsp70.
Figure 5.
Effect of AhHsf overexpression on the level of AhHsp70 expression. Relative mRNA levels were determined using the 2−ΔΔCt method and normalized to those of the β-actin gene. The data were analyzed using the Student’s t-test. * p < 0.05, significant; ** p < 0.01, extremely significant; ns, not significant. All values are shown as the mean ± SD of three replicates and pGL3-Basic was used as a control.
2.6. A Simple Model for Regulation of Transcriptional Gene Expression Following Heat Shock
Based on the findings of the present study and the Kyoto Encyclopedia of Genes and Genomes pathways, we propose a model illustrating how gene transcription might be regulated following heat shock (Figure 6). In this model, an increase in environmental temperature initiates a signal transduction pathway that activates the transcription factor AhHsf and upregulates the expression of AhHsf target genes. Subsequently, AhHsf activates the expression of its target AhHsp70 thereby enhancing thermotolerance.
Figure 6.
Proposed hypothetical model of the heat shock-induced transcriptional regulation of AhHsp70 gene expression. (HSB-1: Heat shock factor binding protein 1; DDL: WAS protein family homolog).
3. Discussion
Heat shock factor 1 (Hsf1) plays an essential role in protecting cells from protein-damaging stress associated with protein misfolding [27]. Previous studies have indicated that Hsf’s plays a central role in remodeling the chromatin structure of Hsp promoters via constitutive interactions with a high-affinity binding site, the heat shock element (HSE) [44,45,46,47,48]. By binding to a gene promoter, transcription factors are typically assembled to form “transcriptional switches” that are capable of controlling gene expression [49].
In our previous study, based on RT-PCR and RNAi analyses, we found that the transcription factor AhHsf regulates the transcriptional expression of AhHsp70 and plays a key role in the thermotolerance of A. hygrophila [42,43]. In the present study, we isolated and determined the sequence of the promoter region of this gene (AhHsp70p) based on I-PCR. Subsequent bioinformatics analysis revealed that the sequence had certain characteristics common to promoter regions, although it appeared to be deficient in CpG islands. In contrast, other studies have found that some promoters contain CpG islands, which are believed to play an important role in the epigenetic regulation of these genes and are generically equipped to influence local chromatin structure and assist in the regulation of gene activity [50,51,52,53]. Moreover, promoters serve as key cis-acting elements that regulate gene expression, and it is generally believed that the cis- and trans-regulatory machinery in promoter regions are basic requirements for gene expression [54]. In 2020, Jia et al. identified six AhHsp70s (hsp70-1, hsp70-2, hsp70-3, hsp70-4, hsp70-5, hsp70-6) in A. hygrophila [55]; all six Hsp70s of A. hygrophila had a non-organellar consensus motif RARFEEL [56], and the C-terminal sequences included the EEVD motif for cytoplasmic localization.
Promoter deletion analysis is one of the primary and most widely used techniques employed to determine whether they are cis-acting elements or specific transcription factor binding sites within a promoter that are primarily responsible for the transcriptional regulation of a particular gene [49,57]. Luciferase (firefly and Renilla luciferases) genes have been used extensively as reporter genes because of their sensitivity and efficiency [18,54,58]. For example, Apriana et al. demonstrated the root-specific expression of an alkenal reductase gene (OsAER1) in Oryza sativa, based on the deletion analysis of the OsAER1 gene promoter [59]. Through deletion analysis in transgenic rice, Chen et al. reported that the OsHAK1 promoter (Dp3037 sequence) a potentially suitable candidate for regulating the expression of osmotic/drought stress-responsive transgenes [60]. Similarly, Yao et al. used deletion analysis to identify a 22-bp DNA cis-element in the SPHK1 promoter that plays an essential role in transcriptional activation [57]. In the present study, we used the same analytical approach and our results indicated that cis-acting elements controlling AhHsp70 transcriptional expression in response to heat stress are located within a promoter region between base pairs −944 and −744. However, to facilitate more accurate localization of these cis-element positions, we will need to conduct further deletion analysis that entails progressively finer truncations.
To elucidate the mechanisms by which the heat resistance in A. hygrophila is regulated, we previously identified a heat shock factor (AhHsf) and its downstream target gene AhHsp70 and established that they play important roles in the thermotolerance of A. hygrophila [43]. In the current study, we further demonstrated that transcription factor (AhHsf) binding to the AhHsp70p sequence (from −944 bp to −744 bp) activated its transcriptional expression in vitro based on promoter deletion, the DLR system, and RT-qPCR analyses. Collectively, the in vitro results obtained in the present study and in vivo results obtained from previous work [43] provide convincing evidence that AhHsf binds to AhHsp70p to activate the AhHSF–AhHSP signaling pathway, thereby promoting transcriptional expression of AhHsp70, which in turn contributes to the enhancement of heat tolerance in A. hygrophila. These findings are similar to those reported in Drosophila melanogaster and yeast, in which cooperative interactions between Hsf’s and its target binding sites (promoter and heat shock elements) regulate the transcriptional expression of heat shock protein genes [26,48,61]. Accordingly, we inferred that AhHsf acts directly on the AhHsp70 gene promoter to induce the transcriptional expression of AhHsp70, thereby enhancing the tolerance of A. hygrophila to high environmental temperatures. Nevertheless, we have established that overexpressed AhHsf can promote AhHsp70 gene expression at the transcriptional level, and further analyses will be needed to confirm whether our observations can be replicated at the protein level.
4. Materials and Methods
4.1. Experimental Insects and Host Plants
Adult A. hygrophila were collected in July 2018 from an alligator weed covered pond in Changsha (28°11′49″ N, 112°58′42″ E), Hunan Province, China, using a sweeping method. These specimens were maintained on alligator weed plants in a laboratory at the Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing, and the Langfang Experimental Station of the Chinese Academy of Agricultural Sciences, Hebei Province, under controlled conditions (temperature, 26 ± 2 °C; relative humidity, 75% ± 5%; photoperiod, 12:12 h light:dark regime) [62]. To eliminate maternal effects, the flea beetles were cultivated for three generations before commencing the experiments. Groups of five females and five males were each placed in circular containers of 8 cm diameter and 12 cm height containing fresh A. philoxeroides stems. The gender of the experimental insects was determined based on the presence of a groove at the end of the abdomen, which is present in males but absent in females [37].
Roots of A. philoxeroides were collected from standing water at the Institute of Plant Protection, Hunan Academy of Agricultural Sciences, and planted in plastic boxes (25 × 25 × 20 cm) containing sterilized soil. The plants were subsequently grown in a greenhouse at the Langfang Experimental Station, with daily watering.
4.2. Expression Vector and Cell Lines
In the DLR assay system (Transgen, Beijing, China) thea firefly (Photinus pyralis) luciferase gene vector pGL3-basic (Promega, Madison, WI, USA) was used as a reporter plasmid, with the Renilla (Renilla reniformi) luciferase gene vector pRL-TK (Promega) as an internal control plasmid. The plasmids were kindly donated by Professor Ganqiu Lan of the College of Animal Science and Technology, Guangxi University. One element of the pIZ/V5-His vector (catalog number: V8000-01, Invitrogen, Carlsbad, CA, USA), an insect overexpression vector used for the transcription factor, was purchased from Invitrogen, and the other was kindly donated by Professor Changyou Li of the Laboratory of Biological Control for Insect Pests, Center for Advanced Invertebrate Cell Culture and Cell Engineering, Qingdao Agricultural University. All vector sequences were confirmed by Sangon Biotech Co. Ltd. (Shanghai, China). Sf9, donated by Professor Changyou Li, were cultured in TNM-FH insect medium (Hyclone, Gibco, New York, NY, USA) supplemented with 10% fetal bovine serum (Gibco, New York, NY, USA) in humidified air containing 5% CO2 at 27 °C in a biochemical incubator (BPC-250F; Yiheng, China). These cells were sub-cultured at 3- to 5-day intervals and used for transfection experiments when cell densities reached approximately 80–85% confluence (at approximately five days) (Supplementary Figure S4).
4.3. Sample Collection and In Vitro Experiments
To determine the AhHsp70p sequence via reverse PCR, each group comprising five pairs of newly emerged (<12 h following eclosion) A. hygrophila adults was placed together in a circular container (12 cm in height and 8 cm in diameter) provisioned with fresh alligator weed leaves. The beetles were exposed daily to a temperature of 33 °C for a 4-h period (10:00 to 14:00) in a constant temperature incubator (RPX-450; Colin, Beijing, China). The sampled individuals were immediately frozen in liquid nitrogen for DNA or RNA extraction, or stored in a −80 °C freezer (DW-86L628; Haier, Tsingtao) until further analyses.
For the DLR assays, vectors with different AhHsp70p promoter lengths (pGL3-basic-AhHsp70p-144, pGL3-basic-AhHsp70p-344, pGL3-basic-AhHsp70p-544, pGL3-basic-AhHsp70p-744, and pGL3-basic-AhHsp70p-944) were used and the vector pIZ/V5-His-AhHsf was used to overexpress the transcription factor AhHsf. After transfection of the dual-luciferase reporter vector into Sf9 cells, the activity of AhHsp70p was analyzed using the DLR system, and the level of AhHsp70 expression was determined using qPCR. After co-transforming Sf9 cells with pIZ/V5-His-AhHsf and the AhHsp70p dual-luciferase reporter gene vector, the AhHsp70p activity was analyzed compared with that of a control group lacking the transcription factor overexpression vector, and the levels of AhHsp70 and AhHsf expression were determined based on RT-qPCR.
4.4. DNA or RNA Extraction and Reverse PCR
Agasicles hygrophila genomic DNA was extracted using the phenol–chloroform method and total RNA was extracted using TRIzol (Invitrogen) in accordance with the manufacturer’s instructions [63]. The isolated total RNA was either stored at −80 °C for further use or converted to first-strand cDNA, synthesized using a reverse transcription kit (TransScript® All-in-One First-Strand cDNA Synthesis SuperMix for qPCR [One-Step gDNA Removal], AT341-02, TransGen Biotech, China) for subsequent RT-qPCR. The isolated DNA was used to determine the AhHsp70p sequence by I-PCR (Supplementary Figure S5). To characterize the promoter by PCR, primers were designed using Primer 5.0 (Table 1), and the products were cloned into a pEASY-T3 vector (TransGen, Beijing, China) and then sequenced.
Table 1.
Sequences of oligonucleotide primers used in this study, designed using CE V1.04 and primer 5.0 software. Note: the underline sequences are cleavage sites of restriction enzyme and the bases underlined with a wavy line are the homologous arm sequence of the upstream terminal of the vector.
| Primers Name | Sequence (5′-3′) | Application | Enzyme |
|---|---|---|---|
| 1279F | CAGACATTTACAACATACGCAG | Inverse PCR | HindIII |
| 305R | TTTGGCTTACCACTCACG | Inverse PCR | |
| 51F | CGCAATCTAAGAACAAACC | Sequence verification | |
| 1106R | CAGCATCACCAAGAAGGC | Sequence verification | |
| −944F | atttctctatcgataggtaccAAAGTCACAAATGAATGCAGTTATTTAT | Cloning | KpnI |
| −944R | acttagatcgcagatctcgagTATTTTCCAAGTTTAATACTTCACAAATATATT | Cloning | XhoI |
| −744R | acttagatcgcagatctcgagATTCTCGGCGTAAATCGAAAAG | Cloning | XhoI |
| −544R | acttagatcgcagatctcgagAACTTCAAGAAAACAAATTGAATTTCC | Cloning | XhoI |
| −344R | acttagatcgcagatctcgagGGCACCGATCAGATCATGTTTT | Cloning | XhoI |
| −144R | acttagatcgcagatctcgagCTTTCATCCTGCTATCCAATATATCAT | Cloning | XhoI |
| q-AhHsp70-F | GCCACAGCTGGTGACACACA TCT | RT-qPCR | |
| q-AhHsp70-R | AGCTCTTTCGGCAGCAGTCC | RT-qPCR | |
| Q-AhHsp70-F | GGTAGCAATGAATCCCAG | RT-qPCR | |
| Q-AhHsp70-R | TTACCTTGGTCGTTGGCA | RT-qPCR | |
| Q-Hsf-F | TGCCAACGACCAAGGTAA | RT-qPCR | |
| Q-Hsf-R | ACACACCCACACAGGAATA | RT-qPCR | |
| β-actin-F | GGAATGGAAGCCTGTGGTATC | RT-qPCR | |
| β-actin-R | CATTCTGTCGGCAATACCTGG | RT-qPCR |
4.5. Relative Quantitative Real-Time PCR
The AhHsp70 and AhHsf expression levels were assessed via RT-qPCR using a TransStart Green qPCR SuperMix Kit (AQ141-04-p, Transgen, Beijing, China) and an ABI Prism 7500 Real Time PCR System (Applied Biosystems, New York, NY, USA). All PCR reactions were performed in triplicate using the primers listed in Table 1. Reactions were performed as 20 µL reaction mixtures comprising 10 µL of 2× TransStartR Tip Green qPCR SuperMix, 0.4 µL of Passive Reference Dye II, 0.4 µL of forward and reverse specific primers, 1 µL of cDNA template, and 7.8 µL of ddH2O. β-actin was used as an internal reference standard and relative expression levels were determined using the 2−ΔΔCt method with the following formula:
| ΔΔCt = (Cp target − Cp reference)treatment − (Cp target − Cp reference)control |
4.6. AhHsp70p Sequence Analysis
We used the Berkeley Drosophila Genome Project neural network promoter prediction (http://www.fruitfly.org/seq_tools/promoter.html/, accessed on 24 February 2021) to predict the 5′ end transcription start site of AhHsp70 gene, and AhHsp70p binding sites were predicted using JASPAR, a database of transcription factor binding profiles (http://jaspar.genereg.net/, accessed on 24 February 2021) and TargetScan (http://www.targetscan.org/mamm_31/, accessed on 24 February 2021). CpG islands in AhHsp70p were determined using the Methprimer online software (http://www.urogene.org /methprimer/, accessed on 26 February 2021).
4.7. Synthesis of AhHsp70p Insertion Fragments
To generate an AhHsp70p target luciferase reporter, we designed five deletion AhHsp70p specific primers (Table 1) using the CE V1.04 software. A KpnI restriction site sequence with approximately 15–25 bp homologous to the vector region was added to the 5ʹ end of the forward primer and an XhoI restriction site with approximately 15–25 bp homologous to the vector was added to the 5ʹ end of the reverse primer. The target fragment was obtained by PCR amplification using genomic DNA as a template. PCR amplification reactions were performed using a total reaction volume of 25 µL comprising 2.5 µL of 10× PCR buffer (10 µM), 0.5 µL of dNTPs (2.5 mM), 0.5 µL of Taq DNA polymerase (TransGen Biotech, China), 1 µL of each gene-specific primer pair, 0.5 µL of genomic DNA template, and 19 µL ddH2O. The PCR products were purified using an AxyPrepTM DNA Gel Extraction Kit (Axygen) and cloned into a pEASY-T3 vector (TransGen, Beijing, China). The veracity of the plasmids was confirmed using commercial sequencing (Sangon Biotech, Shanghai, China).
4.8. Construction of Luciferase Reporter Plasmids and AhHsp70p Luciferase Activity Assays
The target plasmids described in Section 4.5 were digested using KpnI and XhoI, and the resulting PCR products were subcloned into the KpnI and XhoI sites of the luciferase reporter vector pGL3-basic using a homologous one-step cloning kit (TreliefTM SoSoo Cloning Kit, TSV-S2; TsingKe Biotech, Shangai, China) according to the manufacturer’s instructions, with pRL-TK being used as a control vector. Digestion reactions were performed using a total reaction volume of 50 µL containing 1 µg of pGL3-basic vector or insert fragment plasmids, 5 µL of 10× Cutsmart buffer (NEB), 1 µL of KpnI-HF, and 1 µL of XhoI, made up to the final volume with ddH2O. Following activation, the mixture was incubated for 4 h at 37 °C, after which XhoI was inactivated at 65 °C for 20 min, and 5 µL 10× gel loading dye was added to inactivate KpnI-HF. Recombinant DNA was transformed into Escherichia coli DH5α cells (TsingKe), and plasmids were sequenced (Sangon Biotech, Shanghai, China).
Sf9 cells were co-transfected with 1.5 µg luciferase recombinant reporter plasmids (pGL3-basic-AhHsp70p-144, pGL3-basic-AhHsp70p-344, pGL3-basic-AhHsp70p-544, pGL3-basic-AhHsp70p-744, and pGL3-basic-AhHsp70p-944) (Supplementary Figures S3A,E and S6) and 150 ng of the pRL-TK internal control plasmid using Cellfectine® II Reagent (Invitrogen). At 48, 72, and 96 h post-transfection, cells were lysed, and the luminescence of firefly and Renilla luciferases was determined using a Multi-Mode Microplate Reader (Infinite M Plex; Tecan, SWIT) and a TransDetect® double-luciferase reporter assay system (FR201, TransGen Biotech, China), which enhanced the experimental accuracy, in accordance with the manufacturer’s protocol. AhHsp70 expression levels were determined using qPCR.
4.9. Assays for the Interaction between Transcription Factor AhHsf and AhHsp70p
To determine whether the transcription factor AhHsf directly regulates the expression of AhHsp70p in vitro, we constructed the overexpression vector pIZ/V5-His-AhHsf harboring AhHsf and co-transfected this into sf9 cells with AhHsp70p reporter plasmids. After co-transfection, AhHsp70p-related luciferase activity was measured using the DLR system following the manufacturer’s protocol, and AhHsp70 and AhHsf expression levels were determined based on RT-qPCR analysis.
4.10. Statistical Analysis
Statistical analyses were performed using SAS software v8 for Microsoft Windows and GraphPad Prism software (version 6.0; GraphPad Software Inc., San Diego, CA, USA). One-way analysis of variance (ANOVA; SAS Institute Inc., USA) was used to analyze the differences among treatments, followed by a least significant difference (LSD) test for multiple comparisons. AhHsp70 and AhHsf gene expression levels and AhHsp70p relative luciferase activity after co-transfection of cells with the AhHsf overexpression and AhHsp70p reporter plasmids were analyzed using the Student’s t-test. The results are presented as mean values ± standard deviation (SD); p-values of 0.05 or lower were considered significant (* p < 0.05; ** p < 0.01).
5. Conclusions
In summary, we isolated AhHsp70p from A. hygrophila, determined its sequence using I-PCR, and characterized its composition based on bioinformatics analysis. We subsequently examined the activity of AhHsp70p via cell transfection and promoter deletion analyses, and systematically studied the interaction between co-transfected AhHsf and AhHsp70p using a dual-luciferase reporter assay system, with the levels of AhHsp70 and AhHsf expression in co-transfected cells being determined based on RT-qPCR analysis. Our findings indicated that the upstream sequence of the AhHsp70 promoter may contain core functional regions between base pairs −944 and −744. The DLR assay system results revealed that overexpression of AhHsf could significantly enhance the activity of AhHsp70p, and qPCR assays indicated that the level of AhHsp70 expression increased with the extension of Sf9 cell proliferation time within a certain limit, which is conceivably attributable to the fact that Sf9 cells cease proliferating after reaching a certain density or that cells are subject to a certain extent of apoptosis. Moreover, we found that AhHsf overexpression significantly enhanced the expression of AhHsp70 in transfected cells. Collectively, the findings of this study enabled a preliminary characterization of upstream regulatory mechanisms underlying the transcriptional regulation of AhHsp70 expression, which entailed binding of the transcription factor AhHsf to upstream cis-acting elements (promoter region from −944 bp to −744bp) of AhHsp70 to activate the AhHSF–AhHSP signaling pathway at the transcriptional level, thereby enhancing the transcriptional expression of AhHsp70 to protect A. hygrophila from high-temperature damage.
Acknowledgments
We would like to thank Ganqiu Lan of the College of Animal Science and Technology, Guangxi University for donating the pGL3-basic and pRL-TK plasmids; Changyou Li of the Laboratory of Biological Control for Insect Pests, Center for Advanced Invertebrate Cell Culture and Cell Engineering, Qingdao Agricultural University for providing the Sf9 cell lines and a technical platform; and Chunhong Yang of the Laboratory of Insect Ecology and Molecular Biology, College of Plant Health and Medicine, Qingdao Agricultural University for providing the multi-mode microplate reader. All related cell biology experiments were performed by Li Changyou’s research group.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms23063210/s1.
Author Contributions
J.J., J.G., and F.W. conceived and designed the experiments; J.J., Y.P., and Y.L. conducted the experiments, bioinformatic analyses, and I-PCR, qPCR, cell transfection, and dual luciferase reporter assays; J.J., J.G., and X.L. contributed to the data analyses; J.J. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by programs of the National Natural Science Foundation of China (31572068) and the National Key Technology Research and Development Program of the Ministry of Science and Technology of China (2015BAD08B03).
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The data presented in this study are available on request from the corresponding author.
Conflicts of Interest
The authors declare that they have no conflicts of interest.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Bale J.S., Masters G.J., Hodkinson I.D., Awmack C., Bezemer T.M., Brown V.K., Butterfield J., Buse A., Coulson J.C., Farrar J., et al. Herbivory in global climate change research: Direct effects of rising temperature on insect herbivores. Glob. Chang. Biol. 2002;8:1–16. doi: 10.1046/j.1365-2486.2002.00451.x. [DOI] [Google Scholar]
- 2.Yu H., Wan F.H., Guo J.Y. cDNA Cloning of Heat Shock Protein Genes and Their Expression in an Indigenous Cryptic Species of the Whitefly Bemisia tabaci Complex from China. J. Integr. Agric. 2012;11:293–302. doi: 10.1016/S2095-3119(12)60013-6. [DOI] [Google Scholar]
- 3.Bowler K., Terblanche J.S. Insect thermal tolerance: What is the role of ontogeny, ageing and senescence? Biol. Rev. Camb. Philos. Soc. 2008;83:339–355. doi: 10.1111/j.1469-185X.2008.00046.x. [DOI] [PubMed] [Google Scholar]
- 4.Chevin L.M., Lande R., Mace G.M. Adaptation, plasticity, and extinction in a changing environment: Towards a predictive theory. PLoS Biol. 2010;8:e1000357. doi: 10.1371/journal.pbio.1000357. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Hoffmann A.A., Sgro C.M. Climate change and evolutionary adaptation. Nature. 2011;470:479–485. doi: 10.1038/nature09670. [DOI] [PubMed] [Google Scholar]
- 6.Wu C. Heat shock transcription factors: Structure and regulation. Annu. Rev. Cell Dev. Biol. 1995;11:441–469. doi: 10.1146/annurev.cb.11.110195.002301. [DOI] [PubMed] [Google Scholar]
- 7.Tatar M., Khazaeli A.A., Curtsinger J.W. Chaperoning extended life. Nature. 1997;390:30. doi: 10.1038/36237. [DOI] [PubMed] [Google Scholar]
- 8.Feder M.E., Hofmann G.E. Heat-shock proteins, molecular chaperones, and the stress response: Evolutionary and ecological physiology. Annu. Rev. Physiol. 1999;61:243–282. doi: 10.1146/annurev.physiol.61.1.243. [DOI] [PubMed] [Google Scholar]
- 9.Kristensen T.N., Rensen J.G.S., Loeschcke V. Mild heat stress at a young age in Drosophila melanogaster leads to increased Hsp70 synthesis after stress exposure later in Life. J. Genet. 2003;82:89–94. doi: 10.1007/BF02715811. [DOI] [PubMed] [Google Scholar]
- 10.Sørensen J.G., Kristensen T.N., Loeschcke V. The evolutionary and ecological role of heat shock proteins. Ecol. Lett. 2003;6:1025–1037. doi: 10.1046/j.1461-0248.2003.00528.x. [DOI] [Google Scholar]
- 11.Beckmann R.P., Mizzen L.A., Welch W.J. Interaction of Hsp70 with newly synthesized proteins: Implications for protein folding and assembly. Science. 1990;248:850–854. doi: 10.1126/science.2188360. [DOI] [PubMed] [Google Scholar]
- 12.Cotto J.J., Morimoto R.I. Stress-induced activation of the heat-shock response: Cell and molecular biology of heat-shock factors. Biochem. Soc. Symp. 1999;64:105–118. [PubMed] [Google Scholar]
- 13.Kimura R., Choudary P., Schmid C. Silk worm Bm1 SINE RNA increases following cellular insults. Nucleic Acids Res. 1999;27:3380–3387. doi: 10.1093/nar/27.16.3380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Uhlirova M., Asahina M., Riddiford L.M., Jindra M. Heat-inducible transgenic expression in the silkmoth Bombyx mori. Dev. Genes Evol. 2002;212:145–151. doi: 10.1007/s00427-002-0221-8. [DOI] [PubMed] [Google Scholar]
- 15.Lindquist A.S., Craig E.A. The heat shock proteins. Annu. Rev. Genet. 1988;22:631–677. doi: 10.1146/annurev.ge.22.120188.003215. [DOI] [PubMed] [Google Scholar]
- 16.Yu A., Li P., Tang T., Wang J., Chen Y., Liu L. Roles of Hsp70s in stress responses of microorganisms, plants, and animals. Biomed Res. Int. 2015;2015:510319. doi: 10.1155/2015/510319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Schmidt M., Heimberger T., Gruensfelder P., Schler G., Hoppe F. Inducible promoters for gene therapy of head and neck cancer: An in vitro study. Eur. Arch. Otorhinolaryngol. 2004;261:208–215. doi: 10.1007/s00405-003-0621-z. [DOI] [PubMed] [Google Scholar]
- 18.Zhang L., Zhao J., Zhai Z., Liang L., Liang R., Cui S. Cellular microRNA, miR-1343-5p, modulates IFN-I responses to facilitate feline panleukopenia virus replication by directly targeting IRAK1 gene. Vet. Microbiol. 2020;245:108691. doi: 10.1016/j.vetmic.2020.108691. [DOI] [PubMed] [Google Scholar]
- 19.Tang S.M., Yi Y.Z., Zhou Y.J., Zhang Z.F., Li Y.R., He J.L. The homologous region 3 from Bombyx mori nucleopolyhedrovirus enhancing the transcriptional activity of Drosophila hsp70 promoter. Int. J. Ind. Entomol. 2004;9:235–239. [Google Scholar]
- 20.Vallabhapurapu S., Karin M. Regulation and function of NF-kappaB transcription factors in the immune system. Annu. Rev. Immunol. 2009;27:693–733. doi: 10.1146/annurev.immunol.021908.132641. [DOI] [PubMed] [Google Scholar]
- 21.Smale S.T. Transcriptional regulation in the innate immune system. Curr. Opin. Immunol. 2012;24:51–57. doi: 10.1016/j.coi.2011.12.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Zhao C., Zhang X., Li F., Huan P., Xiang J. Functional analysis of the promoter of the heat shock cognate 70 gene of the Pacific white shrimp, Litopenaeus vannamei. Fish Shellfish. Immunol. 2013;34:397–401. doi: 10.1016/j.fsi.2012.09.022. [DOI] [PubMed] [Google Scholar]
- 23.Baird N.A., Douglas P.M., Simic M.S., Grant A.R., Moresco J.J., Wolff S.C., Yates J.R., Manning G., Dillin A. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science. 2014;346:360–363. doi: 10.1126/science.1253168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Zimarino V., Wilson S., Wu C. Antibody-mediated activation of Drosophila heat shock factor in vitro. Science. 1990;249:546–549. doi: 10.1126/science.2200124. [DOI] [PubMed] [Google Scholar]
- 25.Li C., Chen Q., Gao X., Qi B., Chen N., Xu S., Chen J., Wang X. AtHsfA2 modulates expression of stress responsive genes and enhances tolerance to heat and oxidative stress in Arabidopsis. Sci. China C. Life Sci. 2005;48:540–550. doi: 10.1360/062005-119. [DOI] [PubMed] [Google Scholar]
- 26.Jensen L.T., Nielsen M.M., Loeschcke V. New candidate genes for heat resistance in Drosophila melanogaster are regulated by HSF. Cell Stress Chaperones. 2008;13:177–182. doi: 10.1007/s12192-008-0020-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Westerheide S.D., Anckar J., Stevens S.J., Sistonen L., Morimoto R.I. Stress-inducible regulation of heat shock factor 1 by the deacetylase SIRT1. Science. 2009;323:1063–1066. doi: 10.1126/science.1165946. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Margulis B.A., Guzhova I.V. Stress proteins in eukaryotic cells. Tsitologiia. 2000;42:323–342. [PubMed] [Google Scholar]
- 29.Nitika, Porter C.M., Truman A.W., Truttmann M.C. Post-translational modifications of Hsp70 family proteins: Expanding the chaperone code. J. Biol. Chem. 2020;295:10689–10708. doi: 10.1074/jbc.REV120.011666. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Zeiger C.F. Biological control of alligator weed with Agasicles n. sp. in Florida. Hyacinth Control J. 1967;6:31–34. [Google Scholar]
- 31.Spencer N.R., Coulson J.R. The biological control of alligator weed, Alternanthera philoxeroides, in the United States of America. Aquat. Bot. 1976;2:177–190. doi: 10.1016/0304-3770(76)90019-X. [DOI] [Google Scholar]
- 32.Coulson J.R. A Review and Evaluation. Technical Bulletins, United States Department of Agriculture; Washington, DC, USA: 1977. Biological control of alligator weed, 1959–1972; pp. 95–98. [Google Scholar]
- 33.Zhao X. Thermal Adaptation of Agasicles Hygrophila (Coleoptera: Chrysomelidae) in Responses to Temperature Stress. Southwest University; Chongqing, China: 2009. pp. 10–19. [Google Scholar]
- 34.Li Y.N., Fu J.W., Guo J.Y. Effects of release density on the population dynamics of the biocontrol agent, Agasicles hygrophila (Coleoptera:Chrysomelidae) J. Biosaf. 2011;20:275–280. [Google Scholar]
- 35.Zhao M.T., Wang Y., Zhou Z.S., Wang R., Guo J.Y., Wan F.H. Effects of Periodically Repeated Heat Events on Reproduction and Ovary Development of Agasicles hygrophila (Coleoptera: Chrysomelidae) J. Econ. Entomol. 2016;109:1586–1594. doi: 10.1093/jee/tow093. [DOI] [PubMed] [Google Scholar]
- 36.Zhao M.T. Ecological Performance and Transcriptome Analyses of the Two Geographic Population of Agasicles Hygrophila in Response to Heat Stresses. Chinese Academy of Agricultural Sciences; Beijing, China: 2017. pp. 11–25. [Google Scholar]
- 37.Jin J.S., Zhao M.T., Zhang H., Liu Y.R., Wan F.H., Zhou Z.S., Guo J.Y. Impact of summer temperatures on Agasicles hygrophila, a key biocontrol agent of the invasive weed Alternanthera philoxeroides in Hunan province, China. Entomol. Gen. 2021;41:59–70. doi: 10.1127/entomologia/2020/0968. [DOI] [Google Scholar]
- 38.Buckingham G.R. Biological control of alligator weed, Alternanthera philoxeroides, the world’s first aquatic weed success story. Castanea. 1996;61:232–243. [Google Scholar]
- 39.Wang B.R., Li W.G., Wang J.B. Genetic diversity of Alternanthera philoxeroides in China. Aquat. Bot. 2005;81:277–283. doi: 10.1016/j.aquabot.2005.01.004. [DOI] [Google Scholar]
- 40.Ye W.H., Li J., Cao H.L., Ge X.J. Genetic uniformity of Alternanthera philoxeroides in South China. Weed Res. 2003;43:297–302. doi: 10.1046/j.1365-3180.2003.00346.x. [DOI] [Google Scholar]
- 41.State Environmental Protection Administration of China, and Chinese Academy of Sciences . The Announcement about the First List if Invasive Species in China. Chinese Academy of Sciences; Beijing, China: 2003. [Google Scholar]
- 42.Jin J., Zhao M., Wang Y., Zhou Z., Wan F., Guo J. Induced thermotolerance and expression of three key Hsp genes (Hsp70, Hsp21, and sHsp21) and their roles in the high temperature tolerance of Agasicles hygrophila. Front. Physiol. 2019;10:1593. doi: 10.3389/fphys.2019.01593. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Jin J.S., Li Y.Z., Zhou Z.S., Zhang H., Guo J.Y., Wan F.H. Heat shock factor is involved in regulating the transcriptional expression of twopotential Hsps (AhHsp70 and AhsHsp21) and its role in heat shock response of Agasicles hygrophila. Front. Physiol. 2020;11:562204. doi: 10.3389/fphys.2020.562204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Westwood J.T., Clos J., Wu C. Stress-induced oligomerization and chromosomal relocalization of heat-shock factor. Nature. 1991;353:822–827. doi: 10.1038/353822a0. [DOI] [PubMed] [Google Scholar]
- 45.Peteranderl R., Nelson H.C. Trimerization of the heat shock transcription factor by a triple-stranded alpha-helical coiled-coil. Biochemistry. 1992;31:12272–12276. doi: 10.1021/bi00163a042. [DOI] [PubMed] [Google Scholar]
- 46.Rabindran S.K., Haroun R.I., Clos J., Wisniewski J., Wu C. Regulation of heat shock factor trimer formation: Role of a conserved leucine zipper. Science. 1993;259:230–234. doi: 10.1126/science.8421783. [DOI] [PubMed] [Google Scholar]
- 47.Sarge K.D., Murphy S.P., Morimoto R.I. Activation of heat shock gene transcription by heat shock factor 1 involves oligomerization, acquisition of DNA-binding activity, and nuclear localization and can occur in the absence of stress. Mol. Cell Biol. 1993;13:1392–1407. doi: 10.1128/mcb.13.3.1392. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Erkine A.M., Magrogan S.F., Sekinger E.A., Gross D.S. Cooperative binding of heat shock factor to the yeast HSP82 promoter in vivo and in vitro. Mol. Cell Biol. 1999;19:1627–1639. doi: 10.1128/MCB.19.3.1627. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Xu Y.Z., Kanagaratham C., Jancik S., Radzioch D. Promoter deletion analysis using a dual-luciferase reporter system. Methods Mol. Biol. 2013;977:79–93. doi: 10.1007/978-1-62703-284-1_7. [DOI] [PubMed] [Google Scholar]
- 50.Liu H.J. Clone of Bmall Gene Promoter in Mice and its Construction of Luciferase Reporter Gene Vector. Hebei Medical University; Shijiazhuang , China: 2014. pp. 7–21. [Google Scholar]
- 51.Thomson J.P., Skene P.J., Selfridge J., Clouaire T., Guy J., Webb S., Kerr A.R., Deaton A., Andrews R., James K.D., et al. CpG islands influence chromatin structure via the CpG-binding protein Cfp1. Nature. 2010;464:1082–1086. doi: 10.1038/nature08924. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Deaton A.M., Bird A. CpG islands and the regulation of transcription. Genes Dev. 2011;25:1010–1022. doi: 10.1101/gad.2037511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Blackledge N.P., Klose R. CpG island chromatin: A platform for gene regulation. Epigenetics. 2011;6:147–152. doi: 10.4161/epi.6.2.13640. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Chen J., Chen Y., Wei Y., Tao X., Xu H., Liu Y., Zhu L., Tang G., Wen A., Lv D., et al. Activities analysis and polymorphisms identification of GPIHBP1 promoter region in porcine. Russ. J. Genet. 2018;54:680–686. doi: 10.1134/S1022795418060042. [DOI] [Google Scholar]
- 55.Jia D., Liu Y.H., Zhang B., Ji Z.Y., Wang Y.X., Gao L.L., Ma R.Y. Induction of heat shock protein genes is the hallmark of egg heat tolerance in Agasicles hygrophila (Coleoptera: Chrysomelidae) J. Econ. Entomol. 2020;113:1972–1981. doi: 10.1093/jee/toaa105. [DOI] [PubMed] [Google Scholar]
- 56.Tungjitwitayakul J., Tatun N., Singtripop T., Sakurai S. Characteristic expression of three heat shock-responsive genes during larval diapause in the bamboo borer Omphisa fuscidentalis. Zool. Sci. 2008;25:321–333. doi: 10.2108/zsj.25.321. [DOI] [PubMed] [Google Scholar]
- 57.Yao G.Q., Zhu M.L., Walker J., Insogna K. Identification of a 22 bp DNA cis element that plays a critical role in colony stimulating factor 1-dependent transcriptional activation of the SPHK1 gene. Calcif. Tissue Int. 2020;107:52–59. doi: 10.1007/s00223-020-00685-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Chen J.L., Zhang Z.H., Li B.X., Cai Z., Zhou Q.H. Bioinformatic and functional analysis of promoter region of human SLC25A13 gene. Gene. 2019;693:69–75. doi: 10.1016/j.gene.2019.01.023. [DOI] [PubMed] [Google Scholar]
- 59.Apriana A., Sisharmini A., Aswidinnoor H., Trijatmiko K.R., Sudarsono S. Promoter deletion analysis reveals root-specific expression of the alkenal reductase gene (OsAER1) in Oryza sativa. Funct. Plant Biol. 2019;46:376–391. doi: 10.1071/FP18237. [DOI] [PubMed] [Google Scholar]
- 60.Chen G., Hu J., Lian J., Zhang Y., Zhu L., Zeng D., Guo L., Yu L., Xu G., Qian Q. Functional characterization of OsHAK1 promoter in response to osmotic/drought stress by deletion analysis in transgenic rice. Plant Growth Regul. 2019;88:241–251. doi: 10.1007/s10725-019-00504-3. [DOI] [Google Scholar]
- 61.Sorensen J.G., Kristensen T.N., Kristensen K.V., Loeschcke V. Sex specific effects of heat induced hormesis in Hsf-deficient Drosophila melanogaster. Exp. Gerontol. 2007;42:1123–1129. doi: 10.1016/j.exger.2007.09.001. [DOI] [PubMed] [Google Scholar]
- 62.Guo J.Y., Fu J., Xian X., Ma M., Wan F. Performance of Agasicles hygrophila (Coleoptera: Chrysomelidae), a biological control agent of invasive alligator weed, at low non-freezing temperatures. Biol. Invasions. 2012;14:1597–1608. doi: 10.1007/s10530-010-9932-3. [DOI] [Google Scholar]
- 63.Bender W., Spierer P., Hogness D.S. Chromosomal walking and jumping to isolate DNA from the Ace and rosy loci and the bithorax complex in Drosophila melanogaster. J. Mol. Biol. 1983;168:17–33. doi: 10.1016/S0022-2836(83)80320-9. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data presented in this study are available on request from the corresponding author.






