Skip to main content
STAR Protocols logoLink to STAR Protocols
. 2022 Mar 23;3(2):101260. doi: 10.1016/j.xpro.2022.101260

A protocol to enrich in undifferentiated cells from neuroblastoma tumor tissue samples and cell lines

Aida Amador-Álvarez 1,2,4, María A Gómez-Muñoz 2,3, Ismael Rodríguez-Prieto 2, Ricardo Pardal 2,3, Francisco M Vega 1,2,5,
PMCID: PMC8956940  PMID: 35345594

Summary

The existence of a subpopulation of undifferentiated cells with stem-like properties has been suggested in neuroblastoma tumors, but a definitive biomarker for their successful isolation is missing. Here we describe an in vitro culture system for the enrichment in undifferentiated stem-like tumor cells for subsequent functional assays. We make use of clonal non-adherent cell culture conditions together with cell sorting with specific expression markers. This protocol allows for the differential study of heterogeneous cell population in neuroblastoma tumors.

For complete details on the use and execution of this protocol, please refer to Vega et al. (2019).

Subject areas: Cell Biology, Cell culture, Cell isolation, Single Cell, Flow Cytometry/Mass Cytometry, Cancer, Stem Cells

Graphical abstract

graphic file with name fx1.jpg

Highlights

  • Protocol to enrich neuroblastoma cell cultures in neuroblastoma undifferentiated cells

  • Obtaining individual undifferentiated cells suitable for cellular functional assays

  • Expansion, cryopreservation, and recovery to enable biobanking


The existence of a subpopulation of undifferentiated cells with stem-like properties has been suggested in neuroblastoma tumors, but a definitive biomarker for their successful isolation is missing. Here we describe an in vitro culture system for the enrichment in undifferentiated stem-like tumor cells for subsequent functional assays. We make use of clonal non-adherent cell culture conditions together with cell sorting with specific expression markers. This protocol allows for the differential study of heterogeneous cell population in neuroblastoma tumors.

Before you begin

The experimental procedures included in this protocol describe the steps to enrich in undifferentiated neuroblastoma (NB) cells from the SK-N-SH cell line, a spontaneously immortalized heterogeneous human NB cell line. However, we have also used this protocol with other NB cell lines and patient-derived xenografts (PDX)-derived primary cells, with minimal modifications. The protocol has been successfully used with SK-N-AS, GI-MEN and GI-CAN cell lines, and can potentially be used to isolate undifferentiated cells from any heterogeneous cell line that present them in any proportion.

A tumorsphere is a solid, spherical formation developed from the proliferation of one cancer stem/progenitor cell, grown in non-adherent conditions with the suitable media. These tumorspheres are easily distinguishable from single or aggregated cells (Johnson et al., 2013). Tumorsphere cultivation, although with some limitations, is widely used to analyze the self-renewal capability of cancer stem cells (CSCs). In addition, the tumorsphere assay may be a promising in vitro strategy in the innovation towards future cancer therapeutics and may help in the screening of anti-cancer small-molecule chemicals (Lee et al., 2016).

The described protocol derives from the protocol used to isolate adult stem cells from peripheral nervous tissues like the carotid body (Pardal et al., 2007). Contrary to the protocols normally used with central nervous system and glioblastoma cells, in cells derived from peripheral nervous tissues or the neural crest, serum-rich (15–20%) media is used for the isolation of undifferentiated progenitor cells. Tumorspheres can also be formed using media without serum, but then the undifferentiated character and self-renewal of the cells obtained is compromised (Hong et al., 2012; Vega et al., 2019).

In this protocol, we perform fluorescence-activated cell sorting (FACS) prior to tumorsphere culture to select for CD44 high expressing cells in SK-N-SH cells in order to eliminate adrenergic NB cells from the culture. CD44 is a putative stem cell marker in several solid tumors and it is expressed in a cell population with neural crest stem-like features in neuroblastoma tumors (Vega et al., 2019).

Institutional permissions

Ethical approvals and institutional permissions are required for the use of experimental mouse xenograft models and Patient-derived-xenografts (PDX). Tumor tissues from mouse xenografts referred in this protocol were obtained from the Instituto de Biomedicina de Sevilla (IBiS) animal facility with the approval from the local research ethics committee and the Andalusian Tissue Biobank. All experiments conform to the relevant regulatory standards.

Preparation of solutions

Inline graphicTiming: 1–2 h

Required solutions used in this protocol can either be prepared in advance and stored as indicated, or can be made fresh on the day of the experiment. Please refer to the materials and equipment for a complete list of solution recipes.

Culture cells

Inline graphicTiming: 3 days

  • 1.
    Thawing and sub cultivation.
    • a.
      Place cryovial of liquid nitrogen, frozen cells into a water bath at 37°C.
    • b.
      Recover the cells from the vial by gently mixing with growing volume of fresh media to dilute DMSO concentration in the cell suspension.
    • c.
      Centrifuge for 5 min at 300 × g.
    • d.
      Resuspend cell pellet with 1 mL of fresh complete media and add to a 25 cm2 cell culture flask with 4 mL of pre-warmed media.
    • e.
      Incubate at 37°C in an incubator with 5% CO2.
    • f.
      Once at 80% confluence, sub cultivate and amplify cells by washing the cell monolayer with PBS without Ca2+ and Mg2+ twice, before trypsinising with the addition of 1 mL of 0.05% trypsin-EDTA solution to the culture.
    • g.
      Incubate 5 min in the incubator, and add 4 mL complete media to inactivate trypsin and avoid cell damage.
    • h.
      Make a uniform cell suspension by pipetting up and down, centrifuge for 5 min at 300 × g and resuspend pellet in 5 mL of fresh complete media.
    • i.
      Quantify cell suspension and reseed the desired number of cells in a new flask.

Note: we routinely sub cultivate cells by making a 1:20 surface dilution into a new flask. Alternatively, cell suspension can be seeded in bigger surface flasks for expansion. Ensure having a 70–80% confluent low passage (1–5) cell culture with enough cells to start procedure. We recommend starting with at least a 75 cm2 flask.

Alternative: Dissociation of tissue sample into cells

Inline graphicTiming: 1.5 h

  • 2.
    Primary tissue dissociation.
    • a.
      Place the tumor tissue in a 100 mm dish. Mince it into small 2–4 mm pieces using a scalpel.
    • b.
      Place all pieces in a 15 mL plastic tube and add 3 mL of tumor dissociation media. Incubate for 10 min at 37°C in agitation.
    • c.
      Stop the enzymatic reaction by adding 5 mL of IMDM complete medium. Pipette up and down a few times until a homogeneous suspension is achieved.
    • d.
      Pass the result suspension through a 70 μm cell strainer.
    • e.
      Centrifuge 5 min at 300 × g and discard the supernatant, leaving behind dissociated cells pellet.
    • f.
      Add 5 mL of ACK buffer and resuspend carefully to eliminate red blood cells.
    • g.
      Incubate 5 min at room temperature (RT; 18°C–25°C). Centrifuge 5 min at 300 × g and discard the supernatant.
    • h.
      Repeat steps f and g.
    • i.
      Resuspend the cell pellet in IMDM complete media.
    • j.
      Count the number of cells in the suspension and calculate the viability by mixing a small aliquot with an equal volume of trypan blue. Use manual or automatic cell counting.

Note: Cells obtained can be seeded on a culture flask for primary culture at an approximate density of 1 × 105 cells in a 100 mm dish.

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies

Purified Mouse Anti-Human CD44 (used at 1:500 dilution) BD Biosciences Cat#555476
Rabbit Anti-Nestin (used at 1:1,000 dilution) Millipore Cat#ABD69
Mouse Anti-Nestin (used at 1:1,000 dilution) R&D Systems Cat#MAB1259
Rabbit Anti-Dopa Decarboxylase (used at 1:500 dilution) Cell signalling Technology Cat#8786
Alexa488-donkey-α-mouse-IgG (used at 1:2,000 dilution) Life Technologies Cat#A32723
Alexa488-donkey-α-rabbit-IgG (used at 1:2,000 dilution) Life Technologies Cat#A32790
Alexa568-goat-α-rabbit-IgG (used at 1:2,000 dilution) Life Technologies Cat#A-11036

Chemicals, peptides, and recombinant proteins

DMEM/F-12 medium Gibco Cat#10565018
DMEM medium Gibco Cat#61965059
IMDM medium Gibco Cat#12440-061
Penicillin-Streptomycin (10,000 U/mL) Gibco Cat#15140122
N-2 Supplement Gibco Cat#17502048
B-27 Supplement minus vitamin A Gibco Cat#12587010
Recombinant Human FGF R&D Systems Cat#233-FB
Recombinant Human EGF R&D Systems Cat#236-EG
Recombinant Human IGF-I R&D Systems Cat#291-G1
PBS Gibco Cat#10010023
Trypsin-EDTA (0.05%) Gibco Cat#25300062
Ammonium chloride (NH4Cl) Sigma-Aldrich Cat#A0171
Sodium bicarbonate (NaHCO₃) Sigma-Aldrich Cat#S8875
Ethylenediaminetetraacetic acid disodium salt dihydrate (C10H14N2Na2O8 · 2H2O) Sigma-Aldrich Cat#E1644
HBSS buffer, no Ca2+, no Mg2+, no phenol red Gibco Cat#14175095
Collagenase from Clostridium histolyticum Sigma-Aldrich Cat#C6885
Elastase Sigma-Aldrich Cat#324682
Trypsin from bovine pancreas Sigma-Aldrich Cat#T8003
Deoxyribonuclease II from bovine spleen Sigma-Aldrich Cat#D8764
Fetal Bovine Serum (FBS) TICO Europe Cat#EU500
Leibovitz’s L-15 Medium Gibco Cat#21083027
HEPES Gibco Cat#15630080
Bovine Serum Albumin Sigma-Aldrich Cat#A2153
Versene solution Gibco Cat#15040066

Experimental models: Cell lines

SK-N-SH European Collection of Authenticated Cell Cultures (ECACC) Cat#86012802

Biological samples

Tumor tissue from human cell line derived- xenograft SK-N-SH cells on C.B-17 SCID mice (Harland laboratories). Animal facility. n/a
Tumor tissue from Patient-derived xenografts (PDX) Own repository. Instituto de Biomedicina de Sevilla. n/a

Oligonucleotides

See Table 1 Sigma-Aldrich n/a

Software and algorithms

Fiji/ImageJ software https://doi.org/10.1038/nmeth.2019 https://imagej.net/software/fiji/

Other

Corning Costar Ultra-Low Attachment Microplates 6 well Corning Cat#3471
40 μm Cell Strainer Corning Cat#352340
50 μm Cell Strainer BD Biosciences Cat#340632
70 μm cell strainer Falcon Cat#352350
Plastic tubes Corning Cat#352063
Dimethyl sulfoxide Sigma-Aldrich Cat#D2438
Cell Scrapers Biologix Cat#70-1250
Thermo Scientific™ Mr. Frosty™ Freezing Container Thermo Fisher Scientific Cat#1535050
Olympus CKX41 inverted microscope Olympus Life Sciences n/a
Nikon DS-Fi2 camera Nikon Instruments n/a
BD FACS Aria cytometer BD Biosciences n/a

Table 1.

Primers

Oligonucleotide Source Identifier
Bmi-1: forward: TTGTTCGTTACCTGGAGACC; reverse: GGCAGCATCAGCAGAAGG Sigma-Aldrich n/a
Nestin: forward: GTGGCTCCAAGACTTCC; reverse: GCACAGGTGTCTCAAGG Sigma-Aldrich n/a
Oct3/4: forward: CTTGCTGCAGAAGTGGGTGGAGGAA; reverse: CTGCAGTGTGGGTTTCGGGCA Sigma-Aldrich n/a
TH: forward: GCGCAGGAAGCTGATTGC; reverse: CAATCTCCTCGGCGGTGTAC Sigma-Aldrich n/a
GATA3: forward: TCA TTA AGC CCA AGC GAA GG; reverse: GTCCCCATTGGCATTCCTC Sigma-Aldrich n/a
HAND1: forward: GAGAGCATTAACAGCGCATTCG; reverse: CGCAGAGTCTTGATCTTGGAGAG Sigma-Aldrich n/a
HAND2: forward: CGCCGACACCAAACTCTCC; reverse: TCGCCATTCTGGTCGTCCT Sigma-Aldrich n/a
PHOX2B: forward: AACCCGATAAGGACCACTTTTG; reverse: AGAGTTTGTAAGGAACTGCGG Sigma-Aldrich n/a
ISL1: forward: TACGGGATCAAATGCGCCAA; reverse: CACACAGCGGAAACACTCGAT Sigma-Aldrich n/a
KLF7: forward: AGACATGCCTTGAATTGGAACG; reverse: GGGGTCTAAGCGACGGAAG Sigma-Aldrich n/a
FOSL1: forward: CAGGCGGAGACTGACAAACTG; reverse: TCCTTCCGGGATTTTGCAGAT Sigma-Aldrich n/a
RUNX1: forward: CTGCCCATCGCTTTCAAGGT; reverse: GCCGAGTAGTTTTCATCATTGCC Sigma-Aldrich n/a
GLIS3: forward: GTTCAGCGACTGGGACTCATT; reverse: CCCTCTGTAAGCTAGGACTGAT Sigma-Aldrich n/a
ID1: forward: CTGCTCTACGACATGAACGG; reverse: GAAGGTCCCTGATGTAGTCGAT Sigma-Aldrich n/a
SOX9: forward: AGCGAACGCACATCAAGAC; reverse: CTGTAGGCGATCTGTTGGGG Sigma-Aldrich n/a
NOTCH2: forward: CAACCGCAATGGAGGCTATG; reverse: GCGAAGGCACAATCATCAATGTT Sigma-Aldrich n/a
SMAD3: forward: TGGACGCAGGTTCTCCAAAC; reverse: CCGGCTCGCAGTAGGTAAC Sigma-Aldrich n/a

Materials and equipment

Complete DMEM medium

Reagent Final concentration Amount
DMEM medium n/a 445 mL
FBS 10% 50 mL
Penicillin-Streptomycin (10,000 U/mL) 100 U/mL 5 mL
Total n/a 500 mL

Store at 4°C (maximum 1 month) and prewarm at 37°C before use.

Note: DMEM medium is used for the growth of SK-N-SH cells. Use appropriate growing media for the used cell line or cell source.

Complete IMDM medium

Reagent Final concentration Amount
IMDM medium n/a 420 mL
FBS 15% 75 mL
Penicillin-Streptomycin (10,000 U/mL) 100 U/mL 5 mL
Total n/a 500 mL

Store at 4°C (maximum 1 month) and prewarm at 37°C before use.

Neural Crest Medium (NCM)

Reagent Final concentration Amount
DMEM/F12 medium n/a 445 mL
IGF-I (100 μg/mL) 20 ng/mL 100 μL
EGF (500 μg/mL) 20 ng/mL 20 μL
FGF (10 μg/mL) 10 ng/mL 500 μL
FBS 15% 75 mL
Penicillin-Streptomycin (10,000 U/mL) 100 U/mL 5 mL
B27 supplement (50×) 10 mL
N2 supplement (100×) 5 mL
Total n/a 500 mL

Sterilize by filtration and store at 4°C until needed (maximum 2 weeks).

Note: In order to preserve stability and activity of growth factors and supplements, let warm up at RT before use, and do not store neural crest medium for more than one month.

Inline graphicCRITICAL: Due to the short half-life of these growth factors, the neural crest medium is made fresh every two weeks in order to preserve stability and activity of compounds.

Tumor dissociation media

Reagent Final concentration Amount
HBSS buffer n/a 959.77 μL
Collagenase (60 mg/mL) 0.5 μg/mL 8.33 μL
Elastase (5 mg/mL) 0.05 μg/mL 10 μL
Trypsin (26.6 mg/mL) 0.25 μg/mL 9.4 μL
Deoxyribonuclease II 0.04% (32 mg/mL) 0.4 mg/mL 12.5 μL
Total n/a 1 mL

Prepare fresh and keep at 4°C until use.

Erythrocyte lysis buffer (ACK buffer)

Reagent Final concentration Amount
Milli-Q water n/a 100 mL
NH4Cl 155 mM 829 mg
NaHCO₃ 2,96 mM 24,867 mg
EDTA · 2H2O 3,72 mM 168,8 mg
Total n/a 100 mL

Store at 4°C for 2 months maximum.

Cryopreservation media

Reagent Final concentration Amount
Neural Crest medium n/a 45
DMSO 10% 5 mL
Total n/a 50 mL

Store at 4°C for maximum 2 weeks.

FACS media

Reagent Final concentration Amount
Leibovitz’s L-15 Medium n/a 440 mL
BSA (2% (w/v) 0.2% 50 mL
HEPES (1 M) 10 mM 5 mL
Penicillin-Streptomycin (10,000 U/mL) 100 U/mL 5 mL
Total n/a 500 mL

Store at 4°C for 1 month maximum.

Inline graphicCRITICAL: The use of an inverted light microscope equipped with a 4× objective is essential to observe tumorspheres and to be able to recover them. In this protocol we use an Olympus CKX41 inverted microscope with a Nikon DS-Fi2 camera.

Alternatives: This protocol uses 6-well Ultralow binding plates. 24-well plates can also be used adapting volumes and number of cells seeded. Alternative low binding plates can be found in the market from different makers. However, we have found, particularly with primary cells, that some adhesion of tumorspheres to the plate surface can be observed with some products.

Alternatives: This protocol uses Counting Chamber/Hemocytometer or LUNA™ Automated Cell Counter with LUNA™ Cell Counting Slides from Logos Biosystems. Any other suitable cell counting method can be used, ensuring accuracy in cell number quantification and possibility to ensure single cell suspension.

Step-by-step method details

CD44hi cell sorting – day 1

Inline graphicTiming: 5–6 h

CD44hi cells are sorted from neuroblastoma cell lines.

  • 1.
    Obtain a single cell suspension for labelling.
    • a.
      Aspirate media from a tissue culture flask with SK-N-SH cells and gently wash the cells twice with a volume of PBS without Ca2+ and Mg2+ enough to cover the cell layer (3 mL for a 25 cm2 cell culture flask).
    • b.
      Aspirate PBS and add a volume of Versene enough to cover the cell layer (500 μL for a 25 cm2 cell culture flask). Incubate at 37°C in the cell incubator for 5 min.
    • c.
      Stop the dissociation by adding 2 mL of FACS medium and resuspend cells by pipetting up-and-down until a homogeneous cell suspension is achieved.
    • d.
      Transfer cell suspension to a sterile 15 mL plastic tube and centrifuge at 300 × g for 5 min.
    • e.
      Discard the supernatant and resuspend the cell pellet with 1 mL of FACS medium gently pipetting up and down.
    • f.
      Pass through a sterile cell strainer with 40 μm pore size into a sterile 50 mL tube to remove non-dissociated cell aggregates.
    • g.
      Count the number of cells in the suspension and calculate the viability by mixing a small aliquot with an equal volume of trypan blue. Use manual or automatic cell counting.
    • h.
      Prepare a suspension of at least 1 × 106 cells per 100–200 mL of FACS medium for labelling. Prepare also a suspension of at least 2 × 104 cells for unlabeled cells and 2 × 104 cells for cells to be labelled only with secondary antibody as controls.

Note: Proper digestion and preparation of cells into a single cell suspension is crucial for the efficient collection of the fluorescently tagged population.

  • 2.
    Labelling of cells for fluorescence-activated cell sorting (FACS).
    • a.
      Incubate sample cell suspension with 1 μg of CD44 primary antibody for 40–60 min on ice.
    • b.
      Wash cells 3 times with 1 mL cold FACS medium with gentle centrifugation (5 min at 300 g and 4°C) between washes.
    • c.
      Incubate on ice for 30 min with Alexa488-donkey-α-mouse at 1:500 dilution in a volume of 200 μL. Keep protected from light from this step on.
      Note: pipet up and down gently in the middle of the incubation when possible.
      Alternatives: The use of a secondary antibody is not needed if a conjugated primary CD44 antibody is used.
    • d.
      Wash cells 3 times with 1 mL cold FACS medium with gentle centrifugation (5 min at 300 g and 4°C) between washes.
    • e.
      Place the cell suspension in the appropriate tube for sorting, passing the cell suspension through a 50 μm cell strainer before sorting.
  • 3.
    Sorting of CD44hi cells.
    • a.
      Use forward and side scatter density plots to exclude debris.
    • b.
      Use secondary antibody control to set gates for positive fluorescence.
    • c.
      Use CD44 expression distribution levels for gating strategy, defining the population with high CD44 expression (Figure 1).
  • 4.
    Recovery of CD44hi cells.
    • a.
      Seed 1 × 105 of recovered sorted cells per well in a 6-well ultralow binding plate with 2 mL of pre-warmed NCM. Transfer the 6-well plate to a 37°C, 5% CO2 incubator overnight (6–18 h).

Note: The flow cytometer to be used must have the proper lasers and filters to detect the emission spectrum of the fluorescent protein. We performed flow cytometry analyses and sorting in a BD FACS Aria cytometer, which allows for stringent gating to ensure the collection of a pure population. Users can adjust the gate depending on the stringency of their experiment. Also ensure that sorting is performed under sterile conditions as cells are going to be cultured long-term after the sorting.

Alternatives: The sorting can be carried out with dissociated cells from tissue samples, like PDXs, as the ones obtained from the alternative step 2 described above. In this case sorting is carried out right after dissociation with a similar strategy. CD24 is used as a negative selection marker in the case of xenographs to eliminate possible CD44+ host cells.

Alternatives: The following protocol can be performed using unsorted SK-N-SH cells as starting point. In this case, resulting tumorspheres will be enriched in any case in CD44hi cells which can be sorted later to eliminate possible differentiated cells present in the spheres. The main advantage of sorting early rather than sorting after obtaining the tumorspheres is that you can obtain more undifferentiated cells without the interference of the tumorspheres/aggregates formed by CD44- differentiated cells. We would only recommend sorting the resulting tumorspheres to save time at the beginning of the protocol or to remove possible differentiated cells in the tumorspheres.

Figure 1.

Figure 1

CD44 expression in SK-N-SH cells

Representative dot-plots showing CD44 expression and sorting strategy. Immunofluorescence show CD44 and DDC (adrenergic marker) expression in sorted populations. Scale bar: 25 μm. Published with author’s permission.

Tumorsphere culture – day 2

Inline graphicTiming: 1 h

Cells are prepared and seeded for growing as tumorspheres.

Note: Use appropriate number of wells at start, as required, taking into account that the culture will be amplified in subsequent steps.

Note: Pre-warm complete DMEM medium and trypsin in a water bath at 37°C. Pre-warm NCM medium at room temperature.

Note: For unsorted SK-N-SH cells, start with a culture at around 70% confluency and follow steps 1.a–g. Use low passage cells as a starting point (below 5). For sorted SK-N-SH cells, continue from 5.a.

  • 5.
    Obtain a homogeneous single cell suspension.
    • a.
      Observe under the microscope and recover all previously sorted cells from the ultralow binding plate.
    • b.
      Pass through a sterile cell strainer with 40 μm pore size to remove possible aggregates.
      Alternatives: alternatively dissociate aggregates resuspending in Versene after gentle centrifugation. Centrifuge again and recover cells in NCM media.
    • c.
      Count the number of cells in the suspension and calculate the viability by mixing a small aliquot with an equal volume of trypan blue. Use manual or automatic cell counting.
      Note: We use an automatic cell counter with parameters adjusted to the cell line in use. Direct counting under a microscope with a hemocytometer is also possible. Either way, ensure you have an accurate quantification and, by imaging, that you have a single cell suspension.
      Inline graphicCRITICAL: A single cell suspension is critical to ensure the clonality of the tumorspheres (see troubleshooting, problem 1).
  • 6.
    Plating cells for primary tumorsphere.
    • a.
      Add 2 mL of pre-warmed NCM per well in a 6-well ultralow binding plate.
    • b.
      Mix the cell suspension a few times by pipetting before plating.
    • c.
      For each well, pipette a volume of cell suspension so that the final concentration in the plate is 1–2.5 cells/μL (2,500–5,000 cells in 2 mL of media). Plate as many wells as necessary.
    • d.
      Ensure even distribution of the cells in the well by slowly moving the plate drawing a cross and by gentle tapping.
    • e.
      Carefully transfer the 6-well plate to a 37°C cell incubator for 7 days.

Inline graphicCRITICAL: Even distribution of the cells in the well is critical to ensure the clonality and growth of the tumorspheres. Ensure that the plate is maintained completely flat at all times in the incubator. Do not move or remove the plate form the incubator until the final day. Big groups or clumps can be formed otherwise (see troubleshooting, problem 1).

Note: Plates can be incubated for 5–10 days, depending on the cells used and the desired outcome. We normally incubate for 7 days.

Note: Tumorspheres can be also plated in 24-well plates, seeding 600 cells per well in 1 mL of NCM.

Alternatives: The protocol can be easily adapted to a single cell tumorsphere assay to better asses clonality. In this case a single cell per well is seeded on a 96 well plate with 150 μL NCM. As only around 1% of cells will form tumorspheres, a high number of plates are needed.

Recovery and passage of primary tumorsphere – day 8

Inline graphicTiming: 1.5 h

Primary tumorspheres are imaged and collected. Once dissociated, cells can be plated to form secondary tumorspheres.

  • 7.
    Imaging and collection of primary tumorspheres.
    • a.
      Observe the plate under the microscope. Visible dispersed cell spheres should be observable.
    • b.
      Gently rotate the plate in circles so that the tumorspheres concentrate in the middle of the well.
      Note: This motion will concentrate them by size, with the bigger spheres reaching the center quicker than the small ones or small aggregates. If the formed tumorspheres are too big or too small, see troubleshooting, problem 4. If tumorspheres are not obtained, see troubleshooting, problem 5.
    • c.
      Take images of the resulting tumorspheres, ensuring that all spheres fall within the imaged field.
      Note: These images will serve to quantify the number and diameter of the resulting tumorspheres. Alternatively, spheres can be counted in situ under the microscope.
    • d.
      While looking into the microscope, transfer all tumorspheres from the well with a 10 μL pipette, taking the minimum possible volume of medium, into a sterile plastic tube containing 500 μL 0.05% trypsin.
      Note: If different wells with the same condition are used, tumorspheres from these can be transferred into a single well, so that they can be recovered in the minimum volume possible.
      Note: Alternative to the use of 0.05% trypsin, tumorspheres can be transferred to a solution with a cocktail of enzymes for better dissociation. This can work better with sensitive spheres coming from primary tissue.
      Note: To avoid contamination, keep the plate open for the shortest time possible.
  • 8.
    Dissociation and plating for secondary tumorspheres.
    • a.
      Gently pipette the tumorspheres in the trypsin solution from time to time to help dissociation. Keep for approximately 5 min. Keep at room temperature and avoid long incubation times.
      Note: You can also collect the tumorspheres by transferring media with the cells directly into a 15 mL falcon tube. Then, allow the spheres to settle by gravity sedimentation for 5 min at room temperature. Aspirate the supernatant but leave approximately 200 μL in the falcon tube. Be careful not to aspirate the tumorsphere. Add 1 mlm of 0.05% trypsin to the tumorspheres and incubate for 5 min at room temperature. If your tumorspheres do not dissociate with trypsin or a gentler dispersion is needed, see troubleshooting, problem 2.
    • b.
      Stop the trypsinization by adding 2 mL of NCM.
    • c.
      Transfer cell suspension to a sterile 15 mL plastic tube and centrifuge at 300 × g for 5 min.
    • d.
      Discard the supernatant and resuspend the cell pellet with 1 mL of NCM gently pipetting up and down.
    • e.
      Pass through a sterile cell strainer with 40 μm pore size to remove non-dissociated cell aggregates.
    • f.
      Count the number of cells in the suspension and calculate the viability by mixing a small aliquot with an equal volume of Trypan blue. Use manual or automatic cell counting.
    • g.
      Reseed tumorspheres following step 6 to have secondary tumorspheres.
      Note: Cell aggregates are more common on the primary tumorspheres. Subsequent tumorsphere passages permit to obtain higher number of undifferentiated cells. Serial tumorsphere passage also permits to calculate the self-renewal potential.

Recovery and passage of secondary tumorspheres – day 15

Inline graphicTiming: 1.5 h

Secondary tumorspheres are imaged and collected following step 7. Once dissociated, cells can be plated to form tertiary tumorspheres following the procedure described in step 8.

Recovery of tertiary tumorspheres and isolation of undifferentiated cells – day 22

Inline graphicTiming: 1.5 h

  • 9.

    Tertiary tumorspheres are imaged and collected following step 7 and dissociated following step 8.a to f. Once dissociated, cells can be used for characterization, functional assays, or single cell experiments.

Optional: Complete tertiary tumorspheres without dissociation in single cells, can also be seeded on a tissue culture treated surface for them to adhere and open after a short incubation time. This allows the characterization of the cells in the spheres by immunofluorescence, video-microscopy or differentiation. Spheres can also be included fresh on optimal cutting temperature compound (OCT) and cryopreserved as frozen blocks that can be serially sliced using a cryotome to assess composition by immunofluorescence.

Note: If the cells obtained from tertiary tumorspheres are not undifferentiated enough, see troubleshooting, problem 3.

Cryopreservation of undifferentiated cells

Inline graphicTiming: 15 min

Undifferentiated cells from tumorspheres can be preserved.

  • 10.
    Freezing tumorspheres cells.
    • a.
      Set a cryopreservation container filled with propan-2-ol aside, at 20°C–25°C.
    • b.
      Dissociate tumorspheres into cell suspension as in step 8.a to f.
    • c.
      Prepare enough cryopreservation media.
    • d.
      After centrifugation, resuspend cell pellet in 1 mL of cryopreservation media, mixing gently.
    • e.
      Transfer the cell suspension to a labelled 1.5–2 mL cryovial and place in the container.
    • f.
      Transfer the cryopreservation container with the cryovial to a −80°C freezer.
    • g.
      The day after, transfer cryovials into a liquid nitrogen tank for long-term storage.

Recovery of undifferentiated cells

Inline graphicTiming: 20 min

Note: The following steps describe the procedure to thaw a single cryovial.

  • 11.
    Thawing of cryopreserved tumorspheres-derived cells.
    • a.
      Pre-warm NCM at room temperature (RT), then place it under the tissue-culture hood.
    • b.
      Place the cryovial containing frozen undifferentiated cells in a 37°C water bath for 1–2 min, or until fully thawed.
    • c.
      Transfer all medium with cells from the cryovial into a 15 mL sterile tube containing 1 mL of NCM.
    • d.
      Sequentially add NCM to double the current volume, gently agitating and incubating briefly after each addition to gradually dilute the DMSO. Repeat until you reach 10 mL of media.
    • e.
      Centrifuge at 300 × g for 5 min.
    • f.
      Aspirate supernatant.
    • g.
      Resuspend the cell pellet in 1 mL of NCM.
    • h.
      Proceed with the cells to form tumorspheres as described in steps 5 and 6.

Note: We normally plate cells for tumorsphere formation after thawing, to conserve undifferentiated character and let them recover.

Expected outcomes

Upon the completion of this protocol, we obtain multipotent, undifferentiated tumorspheres that are mainly composed by CD44hi/CD114+/Nestin+/DDC- cells. The tumorspheres should be solid, spheric structures, however their size varies, with an median diameter of around 80 μm. Gene expression analysis demonstrates that the cells obtained with this protocol present a mesenchymal (MES) gene expression signature, that can turn into an adrenergic (ADRN) type signature upon differentiation with retinoic acid (Vega et al., 2019) (Figure 2).

Figure 2.

Figure 2

CD44hi cells present a MES gene expression signature

Data are represented as mean ± SEM. Published with author’s permission.

The undifferentiated cells obtained maintain their phenotypic characteristics for at least 10 days in culture when properly maintained. They can also be differentiated into neuronal, glial, or mesenchymal lineages using the appropriate differentiation protocols (Vega et al., 2019).

With an extended incubation time, tumorspheres will normally generate a visible crown of differentiated adrenergic DDC+ cells.

When sorting cells from fresh tissue samples, some cells from other tissues can express CD44. In our hands, high levels of CD44 in PDXs tumors are mainly seen on tumor cells. Nevertheless, is the tumorsphere serial passage culture condition the one finally selecting for undifferentiated neural crest like cell, not the initial CD44 sorting. Non desirable CD44+ cells initially sorted will not form tumorspheres and will disappear.

Limitations

Cells obtained with the use of this protocol in SK-N-SH cells present neural crest stem-like features but can not be considered bona-fide neural progenitor cells. Neural progenitor cells can be obtained with a similar protocol from different fresh tissues (Pardal et al., 2007; Platero-Luengo et al., 2014).

The number of cells obtained ranges between 0.5 and 2% of the starting cell number. Obtaining undifferentiated cells from cell lines or PDXs might not be a problem but starting sample material is a limitation when performed from patient samples. Furthermore, there is a great variability in the number of initial CD44hi sorted cells obtained from different samples and cell lines. A heterogeneous NB cell line like SK-N-SH is the optimal situation. Some mesenchymal cell lines might present uniform moderate levels of CD44. In this case it can be more difficult to sort the CD44 high expressing cells and it might be better to perform the tumorsphere assay directly without sorting.

The protocol does not work on cell lines that are very adrenergic and composed of only differentiated cells, such as IMR-32, from which we only obtained spheres with differentiated committed cells.

CD44 is not an exclusive marker of undifferentiated neuroblastoma cells, as it will also mark for example benign Schwann-like stromal cells. Also, only a small proportion of the CD44hi cells form undifferentiated tumorspheres in culture. This must be considered when sorting cell populations and interpreting the data obtained. As there are no definitive and specific cancer stem cell markers described for neuroblastoma tumors, functional experiments with the resulting cells are needed to address multipotency and other properties.

We have only used the protocol successfully with human cells. We have not been able to select for undifferentiated neural crest stem-like cells from spontaneous tumors in the TH-MYCN mouse model. This is probably due to the strong homogeneous adrenergic nature of these tumors (De Wyn et al., 2021). A different protocol to isolate sphere forming cells from TH-MYCN transgenic tumors has been described (Liu et al., 2016), but we have not been able to replicate it.

Troubleshooting

Problem 1

Big cell aggregates or clumps of tumorspheres are observed, especially on the primary tumorsphere culture (Figure 3; step 7).

Figure 3.

Figure 3

Examples of obtained tertiary tumorspheres and potential culture with aggregates

Scale bar: 200 μm.

Potential solution

Lower cell density on the original plate. Ensure starting with a single cell suspension. Ensure the minimum movement of the plate and an even flat surface during incubation. Alternatively, to ensure clonality, perform the single cell tumorsphere assay (described above).

Problem 2

Tumorspheres do not dissociate well into single cells in the passages (step 8).

Potential solution

Use a mechanical or enzymatic dispersion system that suits your cells.

Problem 3

Enough undifferentiated cells cannot be observed from the tumorspheres obtained (step 9).

Potential solution

Some differentiated cells will form also tumorspheres with this method, but with a limited self-renewal potential and no multipotency. Perform functional and expression analysis to ensure the undifferentiated character of the cells obtained with your starting sample/cell line.

Also, some differentiation will be observed in the tumorspheres. Reduce the incubation time on the tumorsphere assay to avoid differentiation and sort the resulting cells to eliminate undesired populations.

Problem 4

Too big or too small tumorspheres are obtained (step 7).

Potential solution

Adjust the incubation time for your sample/cell line so that you obtain tumorsphere big enough to be a source of undifferentiated cells, but not so big so that differentiation is occurring during tumorsphere formation.

Problem 5

Tumorspheres are not obtained (step 7).

Potential solution

Make sure to use fresh NCM medium and supplements. If you still do not obtain tumorspheres after 10–12 days ensure you start with a heterogeneous population as proper tumorspheres will not grow from already differentiated cells.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Francisco M. Vega (fmvega@us.es).

Materials availability

This study did not generate new unique reagents.

Acknowledgments

This research is supported by grants PID2019-110817RB-I00 funded by MCIN/AEI/ 10.13039/501100011033, grants P18-RT-3151 and US-1262985 funded by Junta de Andalucía-Universidad de Sevilla, and by “ERDF A way of making Europe”. M.A.G. was partially supported by a fellowship from the “Asociación Niños Enfermos de Neuroblastoma (NEN)”. A.A.A. is supported by a FPU grant from the Ministry of Universities.

Author contributions

Conceptualization, A.A. and F.M.V.; Investigation, A.A., F.M.V., I.R., and M.A.G.; Writing – Original Draft, A.A. and F.M.V.; Writing – Review & Editing, A.A.A., F.M.V., R.P., and M.A.G.; Funding Acquisition, F.M.V. and R.P.; Supervision, F.M.V.

Declaration of interests

The authors declare no competing interests

Data and code availability

This study did not generate/analyze new datasets or code.

References

  1. De Wyn J., Zimmerman M.W., Weichert-Leahey N., Nunes C., Cheung B.B., Abraham B.J., Beckers A., Volders P.-J., Decaesteker B., Carter D.R., et al. MEIS2 is an adrenergic core regulatory transcription factor involved in early initiation of TH-MYCN-driven neuroblastoma formation. Cancers. 2021;13:4783. doi: 10.3390/cancers13194783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Hong X., Chedid K., Kalkanis S.N. Glioblastoma cell line-derived spheres in serum-containing medium versus serum-free medium: a comparison of cancer stem cell properties. Int. J. Oncol. 2012;41:1693–1700. doi: 10.3892/ijo.2012.1592. [DOI] [PubMed] [Google Scholar]
  3. Johnson Sara, Chen Hexin, Lo Pang-Kuo. In vitro Tumorsphere Formation Assays. BIO-Protocol. 2013;3(3) doi: 10.21769/BioProtoc.325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Lee Che-Hsin, Yu Cheng-Chia, Wang Bing-Yen, Chang Wen-Wei. Tumorsphere as an effective in vitro platform for screening anti-cancer stem cell drugs. Oncotarget. 2016;7(2):1215. doi: 10.18632/oncotarget.6261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Liu M., Xia Y., Ding J., Ye B., Zhao E., Choi J., Alptekin A., Yan C., Dong Z., Huang S., et al. Transcriptional profiling reveals a common metabolic program in high-risk human neuroblastoma and mouse neuroblastoma sphere-forming cells. Cell Rep. 2016;17:609–623. doi: 10.1016/j.celrep.2016.09.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Pardal R., Ortega-Sáenz P., Durán R., López-Barneo J. Glia-like stem cells sustain physiologic neurogenesis in the adult mammalian carotid body. Cell. 2007;131:364–377. doi: 10.1016/j.cell.2007.07.043. [DOI] [PubMed] [Google Scholar]
  7. Platero-Luengo A., González-Granero S., Durán R., Díaz-Castro B., Piruat J.I., García-Verdugo J.M., Pardal R., López-Barneo J. An O2-sensitive glomus cell-stem cell synapse induces carotid body growth in chronic hypoxia. Cell. 2014;156:291–303. doi: 10.1016/j.cell.2013.12.013. [DOI] [PubMed] [Google Scholar]
  8. Vega F.M., Colmenero-Repiso A., Gómez-Muñoz M.A., Rodríguez-Prieto I., Aguilar-Morante D., Ramírez G., Márquez C., Cabello R., Pardal R. CD44-high neural crest stem-like cells are associated with tumour aggressiveness and poor survival in neuroblastoma tumours. EBioMedicine. 2019;49:82–95. doi: 10.1016/j.ebiom.2019.10.041. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

This study did not generate/analyze new datasets or code.


Articles from STAR Protocols are provided here courtesy of Elsevier

RESOURCES