Skip to main content
PLOS Genetics logoLink to PLOS Genetics
. 2022 Mar 16;18(3):e1010083. doi: 10.1371/journal.pgen.1010083

A shared ancient enhancer element differentially regulates the bric-a-brac tandem gene duplicates in the developing Drosophila leg

Henri-Marc G Bourbon 1,#, Mikhail H Benetah 1,#, Emmanuelle Guillou 1, Luis Humberto Mojica-Vazquez 1,¤a, Aissette Baanannou 1,¤b, Sandra Bernat-Fabre 1, Vincent Loubiere 2,¤c, Frédéric Bantignies 2, Giacomo Cavalli 2, Muriel Boube 1,¤d,*
Editor: Artyom Kopp3
PMCID: PMC8959175  PMID: 35294439

Abstract

Gene duplications and transcriptional enhancer emergence/modifications are thought having greatly contributed to phenotypic innovations during animal evolution. Nevertheless, little is known about how enhancers evolve after gene duplication and how regulatory information is rewired between duplicated genes. The Drosophila melanogaster bric-a-brac (bab) complex, comprising the tandem paralogous genes bab1 and bab2, provides a paradigm to address these issues. We previously characterized an intergenic enhancer (named LAE) regulating bab2 expression in the developing legs. We show here that bab2 regulators binding directly the LAE also govern bab1 expression in tarsal cells. LAE excision by CRISPR/Cas9-mediated genome editing reveals that this enhancer appears involved but not strictly required for bab1 and bab2 co-expression in leg tissues. Instead, the LAE enhancer is critical for paralog-specific bab2 expression along the proximo-distal leg axis. Chromatin features and phenotypic rescue experiments indicate that LAE functions partly redundantly with leg-specific regulatory information overlapping the bab1 transcription unit. Phylogenomics analyses indicate that (i) the bab complex originates from duplication of an ancestral singleton gene early on within the Cyclorrhapha dipteran sublineage, and (ii) LAE sequences have been evolutionarily-fixed early on within the Brachycera suborder thus predating the gene duplication event. This work provides new insights on enhancers, particularly about their emergence, maintenance and functional diversification during evolution.

Author summary

During animal evolution, de novo emergence and rewiring of transcriptional enhancers have contributed to morphological innovations. However, how enhancers regulate distinctly gene duplicates and are evolutionary-fixed remain largely unknown. The Drosophila bric-a-brac (bab) locus, comprising the tandemly-duplicated genes bab1 and bab2, provides a good paradigm to address these issues. In this study, genetic analyses show a partial co-regulation of both genes in the developing leg depending on tissue-specific transcription factors known to bind an intergenic enhancer. Genome editing reveals that this enhancer is shared by both genes and is also critically required for bab2-specific expression. Chromatin features and phenotypic rescue experiments indicate the existence of partly-redundant limb-specific regulatory information within the bab1 transcription unit. Phylogenomics analyses among Diptera indicate that the Drosophila bab locus originates from duplication of a singleton gene within the Brachycera lineage. Lastly, we show that whereas bab1 promoter and leg enhancer sequences have been well conserved after the duplication event, bab2 promoter and other bab enhancers have evolved more recently in the Cyclorrhapha sublineage. This work brings some new insights about (i) how a single enhancer can drive specificity among tandem gene duplicates, and (ii) how enhancers evolutionary adapt with distinct cognate gene promoters.

Introduction

Gene duplications have largely contributed to create genetic novelties during evolution [1,2]. Intra-species gene duplicates are referred to as “paralogs”, which eventually diverged functionally during evolution in a phylogenetic manner. Gene family expansion has facilitated phenotypic innovation through (i) acquisition of new molecular functions or (ii) the subdivision of the parental gene function between the duplicate copies [3–5]. Phenotypic novelties are thought having originated from both modifications of protein sequences and evolutionary emergence or modifications of genomic Cis-Regulatory Elements (CREs) or modules, most often dubbed as “enhancer” regions, which regulate gene transcription in a stage-, tissue- and/or cell-type-specific manner [6–10]. While many shared CRE/enhancers have been described in Drosophila for several gene complexes [11–14], how they emerge and are differentially evolving remain largely elusive.

The ~150-kilobase (kb) long Drosophila melanogaster bric-a-brac (bab) locus, located on the third chromosome (3L arm), comprises two tandemly-duplicated genes (Fig 1A), bab1 and bab2, which encode paralogous transcription factors sharing two conserved domains: (i) a Bric-a-brac/Tramtrack/Broad-complex (BTB) domain involved in protein-protein interactions, and (ii) a specific DNA-binding domain (referred to as BabCD, for Bab Conserved Domain), in their amino(N)- and carboxyl(C)-terminal moieties, respectively [15]. Bab1-2 proteins are co-expressed in many tissues [15,16]. In the larval epidermis, they co-regulate directly yellow expression in a sexually-dimorphic manner, thus controlling adult male versus female body pigmentation traits [17–20]. bab1-2 co-expression in the developing epidermis is partially governed by two CREs which drive reporter gene expression (i) in a monomorphic pattern in the abdominal segments A2-A5 of both sexes (termed AE, for “Anterior Element”), and (ii) in a female-specific pattern in the A5-A7 segments (DE, for “Dimorphic Element”) (Fig 1A) [18,21]. In addition to controlling male-specific abdominal pigmentation traits, bab1-2 are required, singly, jointly or in a partially-redundant manner, for embryonic cardiac development, sexually-dimorphic larval somatic gonad formation, salivary glue gene repression, female oogenesis, wing development as well as distal leg (tarsal) and antennal segmentation [15,17,21–28]. In addition to abdominal AE and DE, two other bab enhancers, termed CE and LAE (see Fig 1A), have been characterized, which recapitulate bab2 expression in embryonic cardiac cells and developing distal leg (tarsus) as well as antennal cells, respectively [21,25,29]. However, while bab1 and bab2 are co-expressed in tarsal cells [15], contribution of the LAE enhancer to bab1 regulation in the developing leg has not been yet investigated.

Fig 1. C15, rotund and bowl regulate both bab1 and bab2 expression.

Fig 1

(A) Schematic view of the Dmel bab locus on the 3L chromosomal arm (Chr3L). The tandem bab1 (blue) and bab2 (red) transcription units (filled boxes and broken lines represent exons and introns, respectively), the previously known CRE/enhancers are depicted by filled dots (abdominal DE and AE in dark and light orange, respectively; leg/antennal LAE in dark green and cardiac CE in purple), and the telomere and centromere directions are indicated by arrows. (B) Scheme depicting C15, Bowl and Rn TF activities in regulating bab2 expression as a four-ring pattern within the developing distal leg. (C) Medial confocal view of a wild-type L3 leg disc. Merged Bab1 (cyan) and Bab2 (red) immunostainings, as well as each marker in isolation in (C’) and (C”), respectively, are shown. Positions of bab2-expressing ts1-5 cells and the pretarsal (pt) field are indicated in (C”). Brackets indicate paralog-specific bab2 expression in ts1 and ts5 cells, and blue arrows corresponding cell rows that do not express bab1. (D) Distal confocal view of a homozygous C152 mutant L3 leg disc expressing LAE-RFPZH2A. Merged Bab1 immunostaining (in cyan) and RFP fluorescence (red), and each marker in isolation in (D’) and (D”), are shown. Bab2-expressing mutant pt cells are circled with a dashed line in (D’) and (D”). (E) Medial confocal view of a mosaic L3 leg disc expressing LAE-GFPZH2A and harboring rotund mutant clones. Merged Bab1 (cyan) immunostaining, GFP (green) and RFP (red) fluorescence, as well as each marker in isolation in (E’), (E”) and (E”‘), respectively, are shown. Mutant clones are detected as black areas, owing to the loss of RFP. The respective ts1-5 fields are indicated in (E). White arrows indicate rotund-/- clones still expressing bab1 and yellow ones those that do not express bab1. (F) Distal confocal view of a mosaic L3 leg disc expressing LAE-RFPZH2A and harboring bowl mutant clones (GFP-). Merged Bab1 (cyan) immunostaining, RFP (red) and GFP (green) fluorescence, as well as a higher magnification of the boxed area for each marker in isolation in (F’), (F”) and (F”‘), respectively, are shown. Mutant clones are detected as black areas, owing to the loss of GFP. White arrows indicate pretarsal bowl-/- clones ectopically expressing both bab1 and LAE-RFPZH2A (bab2).

Adult T1-3 legs, on the pro-, meso- and meta-thoraces, respectively, are derived from distinct mono-layered epithelial cell sheets, organized as sac-like structures, called leg imaginal discs (hereafter simply referred to as leg discs) [30–32]. Upon completion of the third-instar larval stage (L3), each leg disc is already patterned along the proximo-distal (P-D) axis through regionalized expression of the Distal-less (Dll), Dachshund (Dac) and Homothorax (Hth) transcriptional regulators in the distal (center of the disc), medial and proximal (peripheral) regions, respectively [30]. The five tarsal (ts1-5) and the single pretarsal (distalmost) segments are patterned through genetic cascades mobilizing transcription factors, notably the distal selector protein Dll and the tarsal Rotund protein as well as nuclear effectors of Notch and Epidermal Growth Factor Receptor (EGFR) signaling, i.e., Bowl and C15, respectively [30,31].

Whereas both bab genes are required for dimorphic abdominal pigmentation traits and somatic gonad specification [17,26], only bab2 is critical for tarsal segmentation [15]. While bab1 loss-of-function legs are apparently wild-type, a protein null allele (babAR07) removing bab2 (in addition to bab1) gene activity causes shortened legs owing to ts2-5 tarsal fusions as well as P-D homeotic transformations as seen by the appearance of a few up to several ectopic sex comb teeth in ts4, ts3 and ts2 segments, respectively, in males [15]. While the two bab genes are co-expressed within ts1-4 cells, bab2 is expressed more proximally than bab1 in ts1, and in a graded manner along the P-D leg axis in ts5 [15]. We previously showed that bab2 expression in distal leg (and antennal) tissues is governed by a 567-basepair (bp) long CRE/enhancer (termed LAE for “Leg and Antennal Enhancer”) which is located in between the bab1-2 transcription units (Fig 1A) [21,29]. However, LAE enhancer contribution to bab1 versus bab2 regulation in the developing distal legs remains to be investigated.

Here, we show that bab1 expression in the developing distal leg depends on the Rotund, Bowl and C15 proteins, three transcription factors known to regulate directly bab2 expression, by binding to dedicated LAE sequences [21,29]. LAE excision by CRISPR/Cas9-mediated genome editing indicates that this enhancer is required but not sufficient for both bab1 and bab2 regulation and, more unexpectedly, is required also for their differential expression along the P-D leg axis. Phylogenomics analyses indicate that LAE sequences have been fixed early on during dipteran evolution, well before emergence of the bab complex in the Cyclorrhapha sublineage. This work illuminates how a transcriptional enhancer from tandem gene duplicates underwent evolutionary changes to diversify their respective tissue-specific gene expression pattern.

Results

The tandem bab1-2 gene paralogs are co-regulated in the developing distal leg

In addition to the distal selector homeodomain (HD) protein Distal-less, we and others have previously shown that the C15 HD protein (homeoprotein) as well as Rotund and Bowl Zinc-Finger (ZF) transcription factors (TFs) bind dedicated sequences within LAE to ensure precise bab2 expression in four concentric tarsal rings within the leg discs (Fig 1B) [21,29]. bab1-2 are co-expressed in ts2-4 tarsal segments, while bab2 is specifically expressed in ts5 and more proximally than bab1 in ts1, both in a graded manner along the P-D leg axis (Figs 1C and S1A) [15]. Given bab1-2 co-expression in ts1-4, we first asked whether C15, rotund and bowl activities are also controlling bab1 expression in the developing distal leg. To this end, we compared Bab1 expression with that of X-linked reporter genes faithfully reproducing the bab2 expression pattern there [21,29], in homozygous mutant leg discs for a null C15 allele or in genetically-mosaic leg discs harboring rotund or bowl loss-of-function mutant cells (Fig 1D–1F).

C15 is specifically activated in the distalmost (center) part of the leg disc giving rise to the pretarsal (pt) segment (see Fig 1B) [33,34]. We have previously shown that the C15 homeoprotein down-regulates directly bab2 to restrict its initially broad distal expression to the tarsal segments [29]. Bab1 expression analysis in a homozygous C15 mutant leg disc revealed that both bab1 and LAE-RFPZH2A (bab2) are similarly de-repressed in the pretarsus (Fig 1C and 1D).

In contrast to C15, rotund expression is restricted to the developing tarsal segments [35] and the transiently-expressed Rotund ZF protein contributes directly to bab2 up-regulation in proximal (ts1-2) but has no functional implication in distal (ts3-5) tarsal cells [21]. Immunostaining of genetically-mosaic leg discs at the L3 stage revealed that bab1 is cell-autonomously down-regulated in large rotund mutant clones in ts1-2, but not in ts3-4 segments (Fig 1E), as it is the case for LAE-GFPZH2A reflecting bab2 expression. Lastly, we examined whether the Bowl ZF protein, a repressive TF active in pretarsal but not in most tarsal cells, is down-regulating bab1 expression there [36], like bab2 [29]. Both bab1 and LAE-RFPZH2A (bab2) appeared cell-autonomously de-repressed in bowl loss-of-function pretarsal clones (Fig 1F).

In addition to loss-of-function, we also conducted gain-of-function experiments for bowl and rotund. Given Bowl TF instability when overexpressed, bowl gain-of-function has been achieved by down-regulating lines which (i) encodes a related but antagonistic ZF protein destabilizing nuclear Bowl and (ii) is specifically expressed in the tarsal territory [36]. As previously shown for LAE-GFPZH2A (and bab2) expression, nuclear Bowl stabilization in the developing tarsal region appears sufficient to down-regulate cell-autonomously bab1 (S1C Fig). Prolonged expression of the Rotund protein in the entire distal part of the developing leg disc, i.e., tarsal in addition to pretarsal primordia, induces ectopic bab1 expression in the presumptive pretarsal territory, as previously shown for bab2 albeit with some differences in proximalmost GFP+ cells (S1B Fig, differentially-expressing cells are indicated with arrows), thus suggesting differential sensitivity of the two gene duplicates to Rotund TF levels (see discussion).

Taken together, these data indicate that the C15, Bowl and Rotund transcription factors, previously shown to interact physically with specific LAE sequences and thus to regulate directly bab2 expression in the developing distal leg, are also controlling bab1 expression there. These results suggest that the limb-specific intergenic LAE enhancer activity regulates directly both bab genes.

LAE activity regulates both bab1 and bab2 paralogs along the proximo-distal leg axis

To test the role of LAE in regulating both bab1 and bab2, we deleted precisely the LAE sequence through CRISPR/Cas9-mediated genome editing (see Materials and Methods) (Fig 2A). Two independent 3L chromosomal deletion events (termed ΔLAE-M1 and -M2; see S2A Fig for deleted DNA sequences) were selected for phenotypic analysis. Both deletion mutants are homozygous viable and give rise to fertile adults with identical fully-penetrant distal leg phenotypes, namely ectopic sex-comb teeth on ts2 (normally only found on ts1) tarsal segment in the male prothoracic (T1) legs (Fig 2B), which are typical of bab2 hypomorphic alleles [15]. The ΔLAE-M1 allele was selected for detailed phenotypic analyses and is below referred to as babΔLAE.

Fig 2. LAE is differentially required for bab1 and bab2 expression in the developing leg.

Fig 2

(A) Schematic view of the Dmel bab locus on the 3L chromosomal arm (Chr3L). The tandem bab1 and bab2 transcription units (filled boxes and broken lines represent exons and introns, respectively) and the intergenic LAE enhancer (in green) are depicted as in Fig 1A. The small CRISPR/Cas9-mediated chromosomal deficiency (babΔLAE) is depicted in beneath (deleted LAE is depicted as a green broken line). (B) Photographs of wild-type (left) and homozygous babΔLAE (right) T1 distal legs from adult males. The regular sex-comb (an array of about 10 specialized bristles on the male forelegs) on distal ts1 is indicated with asterisks, while ectopic sex-comb bristles on distal ts2 from the mutant leg is indicated by an arrow. Note that the five tarsal segments remain individualized in homozygous babΔLAE mutant legs. (C-D) Confocal views of wild-type (C) and homozygous babΔLAE mutant (D) L3 leg discs expressing LAE-GFPZH2A. Merged GFP fluorescence (green), Bab1 (cyan) and Bab2 (red) immunostainings, as well as the two latter in isolation in (C’-D’) and (C”-D”), respectively, are shown. The respective ts1-5 fields are indicated in C”. Brackets in C-C” show positions of GFP+ ts1 and ts5 cells expressing bab2 in a paralog-specific manner (yellow arrows in C’ indicate bab2-expressing GFP+ cell rows neither expressing bab1). Brackets in D-D” show that neither bab2 nor bab1 are expressed in GFP+ ts1 and ts5 mutant cells (as indicated in D” by green arrows). (E) Confocal view of a homozygous babΔLAE mutant L3 leg disc non-expressing the X-linked LAE-GFPZH2A reporter. Note that Bab1-2 are strictly co-expressed in three instead of four cell rings, consistently with the pattern observed in presence of the LAE-GFPZH2A construct.

First, we quantified bab1 and bab2 mRNAs prepared from dissected wild-type and homozygous babΔLAE mutant leg discs. As shown in S2B Fig, both mRNAs were detected in mutant discs, although bab1 levels were two times lower than wild-type. Second, Bab1-2 expression patterns were analyzed in homozygous babΔLAE leg discs. To identify leg cells that should normally express bab2, we used the LAE-GFPZH2A reporter. In homozygous babΔLAE mutant leg discs, bab2-specific expression in proximalmost ts1 and ts5 cells (see Fig 1C) is no longer observed (Fig 2C and 2D). Furthermore, shared expression of both gene duplicates in distalmost ts1 cells is no longer detectable in babΔLAE mutant discs. Nevertheless, maintenance of bab1-2 co-expression in ts2-4 mutant cells indicates that additional cis-regulatory region(s) acting redundantly with the LAE enhancer must be present within the bab locus on the third chromosome. To exclude possible “transvection” effects of the X-linked LAE-GFPZH2A construct across different chromosomes [37], we also examined Bab1-2 expression patterns in homozygous babΔLAE leg discs in the absence of the LAE-GFPZH2A reporter. As shown in Fig 2E, in the homozygous babΔLAE mutant both bab genes are only (co-)expressed in ts2-4 cells and bab2 remains no longer specifically expressed in ts1 an ts5 cells, ruling out a trans-chromosomal effect of the LAE-GFPZH2A transgene.

Taken together, our data indicate that intergenic LAE enhancer activity regulates both bab gene duplicates, being (i) required for bab1-2 co-expression in distal ts1, (ii) dispensable for their co-expression in ts2-4, suggesting the presence of redundant cis-regulatory information and (iii) critically required for bab2-specific tarsal expression both proximally and distally (in ts1 and ts5, respectively). Thus, the LAE enhancer governs both shared and paralog-specific expression of the bab1-2 gene duplicates.

Chromatin features predict limb-specific cis-regulatory elements within bab1

Since LAE appeared dispensable for bab1 and bab2 co-expression in ts2-4 cells, our data suggested the existence of other redundant cis-regulatory elements. We sought to identify cis-regulatory information acting redundantly with LAE by taking advantage of available genome-wide chromatin features and High-throughput chromosome conformation Capture (Hi-C) experiments performed from L3 leg or eye-antennal discs (Fig 3). bab1 and bab2 are indeed co-expressed in distal antennal cells within the composite eye-antennal imaginal disc [15]. A topologically-associating domain covering the entire bab locus was detected in Hi-C data from eye-antennal discs (Fig 3A) [38], revealing particularly strong interactions between bab1-2 promoter regions.

Fig 3. Chromatin feature analyses suggest partly-redundant limb-specific regulatory information within the bab1 transcription unit.

Fig 3

(A) Hi-C screenshot of a ~160 kb region covering the Dmel bab gene complex. Score scale is indicated on the right (yellow to dark blue from positive to negative). The tandem bab1 and bab2 transcription units as well as the intergenic LAE enhancer are depicted as in Fig 2A. (B) FAIRE-, ATAC- and/or ChIP-Seq profiles from L3 eye-antennal and leg discs. Normalized open chromatin, histone H3 post-translational modifications and Dll binding profiles are shown. The respective locations of the enhancer signature region (ESR), LAE and bab2 promoter sequences are boxed in light blue, green and red, respectively.

We then used published genome-wide data from Chromatin Immuno-Precipitation (ChIP-Seq) and Formaldehyde-Assisted Isolation of Regulatory Elements (FAIRE-Seq), as well as Assay for Transposase-Accessible Chromatin (ATAC-Seq) experiments [38–41], looking for active enhancer marks (H3K4me1 and H3K27Ac) and nucleosome-depleted chromatin regions (thus accessible to transcription factors), respectively. In the eye-antennal disc active enhancer signatures are mainly associated with a ~15-kb-long genomic region encompassing the bab1 promoter, first exon and part of its first intron (Fig 3B). Note that LAE is also accessible to transcription factors and carries H3K4me1 marks, consistently with its enhancer activity characterized in distal antennal cells [21].

To investigate further the role of this putative enhancer region (hereafter referred to as ESR) within bab1, we analyzed previously-published ChIP-Seq data from L3 leg discs [42] for binding sites for Dll which is critically required to cell-autonomously activate bab1 and bab2 [21,43,44]. In addition to expected binding over LAE [21] and the bab2 promoter, strong Dll binding is also detected throughout ESR, including over the bab1 promoter (Fig 3B).

Taken together, we concluded that the bab1 transcription unit is predicted to include uncharacterized limb-specific regulatory information (i.e.., ESR) acting redundantly with the LAE enhancer.

LAE functions together with cis-regulatory elements located within bab1

To validate the existence of regulatory information within the bab1 locus, we performed phenotypic rescue experiments with Bacterial Artificial Chromosome (BAC) constructs covering each about 100 kb of genomic DNA. We have previously shown that a X-linked BAC construct, BAC26B15ZH2A, encompassing bab2 and the downstream intergenic sequence including LAE (see Fig 4A), is able to rescue (i) Bab2 expression in the tarsal primordium and (ii), distal leg phenotypes detected in homozygous animals for the protein null allele babAR07, affecting both Bab1 and Bab2 [15]. Conversely, a mutant BAC26B15 construct (BAC26B15ΔLAEZH2A) inserted at the same genomic landing site (i.e., ZH2A on the X chromosome) and specifically lacking LAE sequence is unable to rescue Bab2 tarsal expression and leg phenotypes of babAR07 mutants (Fig 4B–4D) [21]. These data indicated that (i) in absence of redundant cis-regulatory information, LAE is essential for bab2 expression in the developing tarsus and (ii) the enhancer information redundant with LAE is located outside the genomic region covered by BAC26B15, which only includes the bab1 first exon and thus lacks adjacent intronic ESR sequences.

Fig 4. The bab1-overlaping BAC69B22 construct includes partially-redundant limb-specific cis-regulatory information.

Fig 4

(A) Chromosomal deficiency and BAC constructs covering the bab locus. The tandem gene paralogs and intergenic LAE are depicted as shown in Fig 1A, except that bab2 is depicted in pink instead of red. The babAR07 3L chromosomal deficiency, a protein null allele removing bab1 and bab2 activities, is shown in beneath, with known deleted portion indicated by a dashed line. The two overlapping BAC constructs 69B22 and 26B15, as well as a mutant derivative of the latter specifically-deleted for LAE, are shown in beneath. (B-G) Medial confocal views of wild-type (B, E) and homozygous babAR07 mutant (C-D and F-G) L3 leg discs, harboring singly or combined X-linked BAC construct(s) shown in (A), as indicated above each panel. Bab2 (pink) and Bab1 (cyan) immunostainings are shown. Positions of bab1- and bab2-expressing ts1-4 cells are indicated. Note stochastic bab2 expression in (G).

To validate the putative regulatory information within the bab1 transcription unit, we have tested the capacity of another BAC, BAC69B22, which overlaps entirely bab1 but lacks LAE (see Fig 4A), to restore Bab1 expression in homozygous babAR07 leg discs. As shown in Fig 4E and 4F, the X-linked BAC69B22ZH2A construct could partially restore bab1 expression in ts2-4 cells, indicating that it contains cis-regulatory information redundant with LAE activity in these tarsal segments. To test the capacity of BAC69B22 sequences to also regulate bab2 expression in ts2-4 cells, we placed BAC69B22ZH2A across BAC26B15ΔLAEZH2A, to allow pairing-dependent trans-interactions (i.e., transvection; both constructs being inserted at the same ZH2A landing site) between the two X chromosomes in females. This configuration partially restored Bab2 expression in ts2-4 cells from babAR07 mutant L3 leg discs, albeit in salt and pepper patterns (Fig 4G), diagnostic of transvection effects [37].

Taken together with our previous chromatin data, these genetic results are consistent with the existence within the 15 kb bab1 ESR of uncharacterized cis-regulatory information capable to drive some bab1 and bab2 expression in distal leg tissues and acting redundantly with the LAE enhancer. The large size and complexity of this region, together with data mining from the literature, suggested that this region includes interspersed regulatory elements whose functional implication in the developing leg and antenna deserves to be studied separately.

The bab complex arose from a gene duplication event in the Cyclorrhapha lineage

Both specific and common LAE enhancer activities toward bab1 and bab2, as well as LAE apparent redundancy with regulatory information from the bab1 locus provided us with a unique model to address the issue of evolutionary conservation of cis-regulatory landscapes governing expression of tandem paralogous genes.

To trace back the evolutionary origin of the bab duplication found in D. melanogaster (Dmel), we first identified proteins orthologous to Dmel Bab1 or Bab2, i.e., displaying an N-terminal BTB associated to a C-terminal BabCD domain (collectively referred to as BTB-BabCD proteins) [15] within highly diverse dipteran families (see Fig 5A) for which genome sequencing projects were available to us [45–47]. Two distinct BTB-BabCD proteins strongly related to Dmel Bab1 and Bab2, respectively, were identified in the Cyclorrhapha (higher flies) superfamily, both within the Schizophora (in Calyptratae, such as Musca domestica and Glossina morsitans, and in Acalyptratae, particularly among Drosophilidae) and Aschiza subsections (see Fig 5B). In contrast, a single BTB-BabCD protein could be identified in evolutionarily-distant dipteran species within (i) the brachyceran Empidoidea, Asiloidea and Stratiomyomorpha superfamilies (such as Proctacanthus coquilletti, Condylostylus patibulatus and Hermetia illucens, respectively); (ii) the Nematocera suborder families (with rare exceptions, in Psychodomorpha and Bibionomorpha, see below); (iii) other Insecta orders (e.g., Coleoptera, Hymenoptera and Lepidoptera), and in crustaceans (e.g., Daphnia pulex) (see S1 Data).

Fig 5. Phylogenetic relationships among dipteran bab paralogs and orthologs.

Fig 5

(A) Dipteran families studied in this work and grouped according to [45]. Species abbreviations are described in S1 Data. (B) Phylogenetic relationships of the bab paralogs and orthologs inferred from a maximum likelihood consensus tree constructed from 1000 bootstrap replicates. IQ-TREE maximum-likelihood analysis was conducted under the JTT+F+R6 model. Support values (percentage of replicate trees) are shown in red. Scale bar represents substitution per site. Clustered positions of bab1 and bab2 paralog are shown in pink and blue, respectively, while singleton bab genes are depicted in grey.

To analyze the phylogenetic relationships between these different Bab1/2-related proteins, their primary sequences were aligned and their degree of structural relatedness examined through a maximum likelihood analysis. As expected from an ancient duplication, cyclorrhaphan Bab1 and Bab2 paralogs cluster separately, while singleton BTB-BabCD proteins are more related to cyclorrhaphan Bab1 than Bab2 (Fig 5B). Branch length comparison indicates that cyclorrhaphan bab2 paralogs have diverged more rapidly than their bab1 twins and thus that the Bab2 clade artificially cluster separately through long-branch attraction.

Interestingly, contrary to most nematocerans, two or even three bab gene paralogs are present in the fungus gnat Coboldia fuscipes (Psychodomorpha) and the gall midge Mayetiola destructor (Bibionomorpha), respectively. Significantly, M. destructor and C. fuscipes bab paralogs (i) cluster separately in our phylogenetic analysis (Fig 5B) and (ii) two are arrayed in the same genomic context in both species (S3 Fig), indicating that they have likely been generated through independent gene duplication processes in the Bibionomorpha and Psychodomorpha lineages, respectively.

Taken together, and updating a previous work [17], our phylogenomics analysis (summarized in Fig 6B and 6C) indicates that the bab tandem genes originated from a duplication event within the Cyclorrhapha dipteran lineage.

Fig 6. Evolutionary history and enhancer sequence conservation of the bab locus among the Brachycera.

Fig 6

(A) Organization of the Dmel bab gene paralogs and enhancers. The locus is depicted as in Fig 1A, except that bab2 is represented in pink instead of red. (B) Evolutionary conservation of the bab gene paralogs and enhancers among diverse dipterans. Infraorders, sections, subsections and superfamilies are indicated on the left, arranged in a phylogenetic series from the “lower” Nematocera to the “higher” Brachycera suborders. Presence of bab singleton or paralogs and conservation of previously-characterized enhancer sequences are indicated by filled boxes colored as depicted in (A). Presence of several bab paralogs in the Psychodomorpha and Bibionomorpha are indicated. (C) Evolutionary scenario for the bab locus within the Brachycera suborders. A scheme depicting chromosomal fate of an ancestral bab singleton gene which gives rise to derived extant orthorrhaphan bab singleton (Asilomorpha) and Muscomorpha-specific bab1 and bab2 paralogous (Calyptratae and Acalyptratae) genes. Locations of conserved enhancer sequences are shown, as depicted in (A).

LAE sequences emerged early on in the Brachycera, thus predating bab gene duplication

Having traced back the bab gene duplication raised the question of the evolutionary origin of the LAE enhancer, which regulates both bab1 and bab2 expression [21] (this work). We have previously shown that LAE includes three subsequences highly-conserved among twelve reference Drosophilidae genomes [48], termed CR1-3 (for Conserved Regions 1 to 3; see S4A Fig and S1 Data), of which only two, CR1 and 2, are critical for tissue-specificity [21,29]. The 68 bp CR1 includes contiguous binding sites for Dll and C15 homeoproteins, while the 41 bp CR2 comprises contiguous binding sites for Dll as well as the ZF protein Bowl (S4B and S4C Fig, respectively) [21,29].

To trace back the LAE evolutionary origin, we then systematically searched for homologous CR1-3 sequences (>50% identity) in dipteran genomes for which we identified one or two bab genes. Importantly, conserved LAE sequences have not been yet reported outside drosophilids. Small genomic regions with partial or extensive homologies to the CR1 (encompassing the C15 and Dll binding sites) and CR2 (particularly the Dll and Bowl binding sites) could be detected in all examined Brachycera families but not in any nematoceran (Figs 6B, S4B, and S4C). Contrary to closely-associated CR1-2 homologous sequences, no CR3-related sequence could be identified nearby, in any non-Drosophilidae species. Significantly, homologous LAE sequences are situated (i) in between the tandemly-duplicated paralogs in cyclorrhaphan species for which the entire bab locus sequence was available to us, suggesting an evolutionarily-conserved enhancer role, or (ii) 20 kb upstream of the bab singleton gene in the Asiloidea P. coquilletti (see Fig 6C).

Taken together, as summarized in Fig 6B and 6C, these data suggest that a LAE-like enhancer with CR1- and CR2-related elements emerged early on in the Brachycera suborder, 180–200 million years ago, and has been since fixed within or upstream the bab locus in the Cyclorrhapha and Asiloidea superfamilies, respectively.

Unlike LAE, other bab CREs have not been conserved beyond the Cyclorrhapha

The broad LAE sequence conservation led us to also trace back the evolutionary origins of the cardiac CE, abdominal anterior AE and sexually-dimorphic DE cis-regulatory elements (see Fig 6A). While CE only regulates bab2, the AE and DE elements are predicted to govern both bab1 and bab2 expression in abdominal cells. Significantly, CE- and DE-related sequences could be only detected within schizophorans (excepted in Calyptratae) (Figs 6B, S5B, and S5C, respectively), whereas AE-related sequences could be readily identified within bab loci from drosophilids (S1 Data) but not from Aschiza, Empidoidea and Nematocera.

In conclusion, as summarized in Fig 6B and 6C, contrary to the LAE enhancer which among the Diptera emerged early on in the Brachycera suborder, other so-far identified bab cis-regulatory sequences have not been conserved beyond the Cyclorrhapha. Thus, and unlike the brachyceran LAE (CR1-2) sequences, these data indicate that other shared enhancer sequences (i.e., DE and AE) have been evolutionarily-fixed after the bab1-2 paralog emergence.

bab1-2 promoter sequences have been differentially-fixed during evolution

Given the differential response of bab1 and bab2 to the LAE enhancer, we next analyzed the evolutionary conservation of Dmel bab1-2 promoter core sequences (Figs 6B and S6). Both bab promoters are TATA-less. Whereas bab1 has a single transcriptional initiator (Inr) element (TTCAGTC), its bab2 paralog displays tandemly-duplicated Inr sequences (ATTCAGTTCGT) [49,50] (S6B Fig). Both promoters display 64% sequence identity over 28 base pairs, including Inr (TTCAGT) and downstream putative Pause Button (PB; consensus CGNNCG) sequences [51] (see S6A Fig). These data suggested that (i) the duplication process having yielded bab1-2 included the ancestral bab promoter and (ii) PolII pausing ability previously shown for bab2 promoter [52–54] probably also occurs for bab1 promoter.

Homology searches revealed that bab1 promoter sequences have been strongly conserved in the three extant Cyclorrhapha families and even partially in some Asiloidea (e.g., P. coquellitti), for which a singleton bab gene is present (Figs 6B and S6B). In striking contrast to bab1, sequence conservation of the bab2 promoter could only be detected among some Acalyptratae drosophilids (Figs 6B and S6C). In agreement with a fast-evolutionary drift for bab2 promoter sequences, the duplicated Inr is even only detected in Drosophila group species.

Taken together, these evolutionary data (summarized in Fig 6B) indicate that, likewise for the LAE enhancer, bab1 promoter sequences have been under strong selective pressure among the Brachycera, both in the Cyclorrhapha and Asiloidea, while paralogous bab2 promoter sequences diverged rapidly among cyclorrhaphans. As discussed below, this evolutionary divergence may explain apparent differential activity of the LAE on each bab promoter.

Discussion

In this work, we have addressed the issue of the emergence and functional diversification of enhancers from two tandem gene duplicates. Using the Drosophila bab locus as a model, we showed that the paralogous genes bab1 and bab2 originate from an ancient tandem duplication in the Cyclorrhapha lineage. The early-fixed brachyceran LAE sequence has been co-opted lately to regulate both bab1 and bab2 expression in a cyclorrhaphan. Furthermore, this unique enhancer is also responsible for paralog-specific bab2 expression along the P-D leg axis. Finally, LAE governs only some aspects of bab1-2 expression in the developing limbs because redundant cis-regulatory information, which remains to be characterized, is present within the D. melanogaster bab1 gene. This work raises some hypotheses about (i) how a single enhancer can drive specificity among tandem gene duplicates, and (ii) how enhancers evolutionary adapt with distinct cognate gene promoters.

A long-lasting enhancer sequence predating resident gene duplication

Our comprehensive phylogenomics analyses from highly diverse Diptera families indicate that the bab complex has been generated through tandem duplication from an ancestral singleton gene within the Cyclorrhapha (i.e., higher flies), about 100–140 years ago. This result contrasts with published data reporting that the duplication process having yielded the tandem bab genes occurred much earlier in the Diptera lineage leading to both the Brachycera (true flies; i.e., with short antenna) and Nematocera (long horned “flies”, including mosquitos) suborders [17]. In fact, tandem duplication events implicating the bab locus did occur in the Bibionomorpha, as reported [17], and even in the Psychodomorpha with three bab gene copies (Figs 4, 5, and S3), but our phylogenetic analysis supports independent events. Thus, within the emerging dipteran lineages, the ancestral bab singleton gene had a high propensity to duplicate locally.

Gene duplication is a major source to generate phenotypic innovations during evolution, through diverging expression and molecular functions, and eventually from single gene copy translocation to another chromosomal site. Emergence of tissue-specific enhancers not shared between the two gene duplicates, as well as of “shadow” enhancers, have been proposed to be evolutionary sources of morphological novelties [6,55]. In this study, we have shown a strong evolutionary conservation of LAE subsequences among brachycerans, notably its CR2 element containing Dll and Bowl binding sites (S4C Fig). This conservation suggests a long-lasting enhancer function in distal limb-specific regulation of ancestral singleton bab genes, which has recently been co-opted in drosophilids to allow differential bab gene expression.

A shared enhancer differentially regulating two tandem gene paralogs

Here, we have shown that a single enhancer, LAE, regulates two tandem gene paralogs at the same stage and in the same expression pattern. How can this work? It has been proposed that enhancers and their cognate promoters are physically associated within phase-separated nuclear foci composed of high concentrations of TFs and proteins from the basal RNA polymerase II initiation machinery inducing strong transcriptional responses [56,57]. Our Hi-C data from eye-antennal discs show a strong interaction between bab1 and bab2 promoter regions (Fig 3), suggesting that both bab promoters could be in close proximity within such phase separated droplets, thus taking advantage of shared transcriptional regulators and allowing concerted gene regulation. In contrast, no strong chromosome contacts could be detected between LAE and any of the two bab promoter regions, indicating that this enhancer is not stably associated to the bab2 or bab1 promoter in the eye-antennal disc (where only the antennal distal part expresses both genes). It would be interesting to gain Hi-C data from leg discs, in which the bab1-2 genes are much more broadly expressed.

In addition to being required for bab1-2 co-expression in proximal tarsal segments, we showed here that the LAE enhancer is also responsible for paralog-specific bab2 expression along the proximo-distal leg axis. While it has been proposed that expression pattern modifications occur through enhancer emergence, our present work indicates that differential expression of two tandem gene paralogs can depend on a shared pre-existing enhancer (i.e., LAE). How this may work? Relative to its bab1 paralog, bab2 tarsal expression extends more proximally within the Dac-expressing ts1 cells [43] and more distally in the ts5 segment expressing nuclear Bowl protein. Furthermore, both Dac and Bowl proteins have been proposed to act as bab2 (and presumably bab1) repressors [29,36,58]. CRISPR/Cas9-mediated LAE excision allowed us to establish that this enhancer is critically required for paralog-specific bab2 expression proximally and distally, in ts1 and ts5 cells, respectively. In this context, we and others have previously proposed that transiently-expressed Rotund activating TF may antagonize Bowl (and eventually Dac) repressive activity to precisely delimit bab2 expression among ts1 cells [21,58]. Given that bab1-2 are distinctly expressed despite being both regulated by Bowl and Rotund, we propose that paralog-specific LAE activity depends on privileged interactions with bab2 promoter sequences. Thus, we speculate that the bab2 promoter responds to Rotund transcriptional activity differently from its bab1 counterpart. Consistent with this view, ectopic Rotund expression reveals differential regulatory impacts on the two bab gene promoters (S1B Fig). We envision that this could occur through specific interactions between LAE-bound TFs (e.g., Rotund) and dedicated proteins within the PolII pre-initiation complex stably-associated to the bab2 core promoter.

Differential enhancer-promoter interplay through evolutionary changes?

Despite that sequence homologies between both promoters (consistent with an ancient duplication event mobilizing the ancestral singleton bab promoter) are still detectable, it is significant that the bab2 promoter evolves much faster than its bab1 counterpart. While the bab1 promoter sequence has been strongly conserved among cyclorrhaphans, with sequence homologies with brachyceran singleton bab promoters, the bab2 promoter sequence has only been fixed recently among Drosophilidae, notably through the Initiator (Inr) sequence duplication, indicating very fast evolutionary drift after the gene duplication process which yielded the bab1/2 paralogs. We envision that this evolutionary ability has largely contributed to allow novel expression patterns for bab2, presumably through differential enhancer-promoter pairwise interplay.

Materials and methods

Fly stocks, culture and genetic manipulations

D. melanogaster stocks were grown on standard yeast extract-sucrose medium. The vasa-PhiC31 ZH2A attP stock (kindly provided by F. Karch) was used to generate the LAEpHsp70-GFP reporter lines and the BAC69B22 construct as previously described [21]. LAE-GFP and LAE-RFP constructs inserted on the ZH2A (X chromosome) or ZH86Fb (third chromosome) attP landing platforms, and displaying identical expression patterns, have been previously described [21,29]. C152/TM6B, Tb1 stock was kindly obtained from G. Campbell. Mutant mitotic clones for null alleles of bowl and rotund were generated with the following genotypes: y w LAE-GFP; DllGal4EM2012, UAS-Flp/+; FRT82B, Ub-RFP/FRT82B rn12 (i.e., rn mutant clones are RFP negative; Fig 1E) and y w LAE-RFP; DllGal4EM2012, UAS-Flp/+; Ub-GFP, FRT40A/bowl1 FRT40A (i.e., bowl mutant clones are GFP negative; Fig 1F), respectively. Rotund protein gain-of-function within the Dll-expressing domain was obtained with the following genotype: y w LAE-GFP; DllGal4EM2012; UAS-Rn1/+. The DllEM212-Gal4 line was provided by M. Suzanne, while the UAS-Rn1 line was obtained from the Bloomington stock center. “Flip-out” (FO) mitotic clones over-expressing dsRNA against lines were generated by 40 mn heat shocks at 38°C, in mid-late L2 to early-mid L3 larvae of genotypes: y w LAE-RFP hsFlp; UAS-dsRNAlines/pAct>y+>Gal4, UAS-GFP (i.e., FO clones express GFP in S1C Fig). The UAS-dsRNA stock used to obtain interfering RNA against lines (#40939) was obtained from the Bloomington stock Center.

Immuno-histochemistry and microscopy

Leg discs were dissected from wandering (late third instar stage) larvae (L3). Indirect immuno-fluorescence was carried out as previously described [21] using a LEICA TCS SP5 or SPE confocal microscope. Rat anti-Bab2 [15], rabbit anti-Bab1 [18], rabbit ant-Dll [59], rabbit anti-Bowl [58], and rabbit anti-C15 [34] antibodies were used at 1/2000, 1/500, 1/200, 1/1000 and 1/200, respectively.

CRISPR/Cas9-mediated chromosomal deletion

Guide RNAs (gRNAs) were designed with CHOPCHOP at the Harvard University website (https://chopchop.cbu.uib.no/). Four gRNA couples were selected that cover two distinct upstream and downstream LAE positions: TGCGTGGAGCCTTCTTCGCCAGG or TGGAGCCTTCTTCGCCAGGCCGG; and TATACTGTTGAGATCCCATGCGG or TTAGGCGCACATAAGGAGGCAGG (the PAM protospacer adjacent motif sequences are underlined), respectively. Targeting tandem chimeric RNAs were produced from annealed oligonucleotides inserted into the pCFD4 plasmid, as described in (http://www.crisprflydesign.org/). Each pCFD4-LAE-KO construct was injected into 50 Vasa-Cas9 embryos (of note the vasa promoter sequence is weakly expressed in somatic cells). F0 fertile adults and their F1 progeny, with possible somatic LAE-deletion events and candidate mutant chromosomes (balanced with TM6B, Tb), respectively, were tested by polymerase chain reactions (PCR) with the following oligonucleotides: AGTTTTTCATCCCCCTTCCA and GTATTTCTTTGCCTTGCCATCG (predicted wild-type amplified DNA: 2167 base pairs).

Quantitative RT-PCR analysis

T1-3 leg imaginal discs were dissected from homozygous white1118 and babΔLAE-M1 late L3 larvae in PBS 0.1% Tween. 50 discs of each genotype were collected and frozen in nitrogen. Total messenger RNAs were purified using RNeasy kit (Qiagen) and reverse transcribed (RT) by SuperScript II (ThermoFisher) and quantified by quantitative PCR (qPCR) using the ΔΔCt method from Bio-Rad CFX Manager 3.1 software [60]. bab1, bab2, Rpl32, Gpdh1 or Mlc-c cDNA levels were monitored by qPCR using the following oligonucleotides: Bab1Fw: CGCCCAAGAGTAACAGAAGC; Bab1Rev: TCTCCTTGTCCTCGTCCTTG; Bab2Fw: CTGCAGGATCCAAGTGAGGT; Bab2Rev: GACTTCACCAGCTCCGTTTC; Rpl32Fw: GACGCTTCAAGGGACAGTATCTG; Rpl32Rev: AAACGCGGTTCTGCATGAG; Gpdh1 Fw: TCTTCCAGGCGAACCACTTC; Gpdh1Rev: AGGCCACGATGTTCTTGAGG; Mlc-cFw: GCGGTTATATCTCCTCCGCC; Mlc-cRev: CGTAGTTGATGTTGCCCTGCA: Wilcoxon test was performed to evaluate the difference between samples.

Homology searches, sequence alignments and phylogenetic analyses

Homology searches were done at the NCBI Blast site (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Protein or nucleotide sequence alignments were done using MAFFT (Multiple Alignment using Fast Fourier Transform) (https://mafft.cbrc.jp/alignment/server/). Phylogenetic relationships were inferred through a maximum likelihood analysis with W-IQ-Tree (http://iqtree.cibiv.univie.ac.at/), using JTT+F+R6 as a substitution model, and visualized with the ETE toolkit (http://etetoolkit.org/treeview/).

Transcription factor binding prediction

DNA binding predictions were done using the motif-based sequence analysis tool TomTom from the MEME suite (https://meme-suite.org/meme/tools/tomtom) and the Fly Factor Survey database (http://mccb.umassmed.edu/ffs/).

Supporting information

S1 Fig. Contrary to Bowl, Rotund gain-of-function differentially affects bab1 and LAE-GFP (bab2) expression.

(A) The bab1 paralog is expressed in a subset of LAE-GFPZH2A (bab2)-expressing cells, both proximally and distally within the developing tarsus. Merged Bab1 (red) immunostaining and GFP fluorescence (green) as well as each marker in isolation in (A’) and (A”), respectively, are shown for a wild-type L3 leg disc expressing LAE-GFPZH2A (medial confocal view). Positions of LAE-GFPZH2A (bab2)-expressing ts1-5 cells and of the non-expressing pre-tarsal (pt) cells are indicated in (A) and (A’). Brackets indicate paralog-specific expression in bab2-expressing (GFP+) ts1 and ts5 cells, as detected as green- instead of yellow-colored cells in (A) (see also white arrows in (A’)). Of note, bab1 is only expressed in distal ts1 cells, while LAE-GFPZH2A (bab2) expression extends proximally. (B) Rotund TF gain-of-function within the developing Dll-expressing cells differentially activates the bab gene paralogs along the P-D leg axis. Merged Bab1 (red) immunostaining and GFP (green) fluorescence, as well as each marker in isolation in (B’) and (B”), respectively, are shown for a leg disc dissected from a L3 larvae harboring both UAS-Rn and DllEM212-Gal4 transgenes. Contrary to a distal domain (circled with a dashed line) in which both bab1 and LAE-GFPZH2A (bab2) are strictly co-expressed, many proximalmost Dll-expressing GFP+ cells neither activate bab1 (some are indicated by white arrows). (C) Ectopic Bowl TF stabilization, through clonal Lines protein depletion, is sufficient to down-regulate both bab1 and LAE-GFPZH2A (bab2) expression. Merged Bab1 (cyan) immunostaining, RFP (red) and GFP (green) fluorescence, as well as the two former markers in isolation in (C’) and (C”), respectively, are shown for a L3 leg disc expressing LAE-RFPZH2A. Flip-out (FO) mitotic clones are detected through GFP expression in (C), and are circled with dashed lines in (C’) and (C”). Within the developing tarsus Bowl stabilization leads to cell-autonomous repression of both bab1 and LAE-RFPZH2A (bab2).

(TIF)

S2 Fig. LAE deletion mutant behaves as a hypomorphic allele.

(A) Targeted deletion of the LAE with CRIPSR/Cas9 genome editing. The sequences flanking LAE from the wild-type (Wt) and six deleted chromosomes (M1-6) are shown. LAE sequences are depicted in orange while exogenous sequences in mutant chromosomes are indicated by distinctly-colored lower case letters (unmodified nucleotides are upper case ones). (B) Overall bab1-2 expression from wild-type and homozygous babΔLAE L3 leg discs, as determined from reverse transcription quantitative PCR analyses. mRNA levels are normalized from expression of three housekeeping genes: Rpl32, Mlc-c and Gpdh1. Results show the mean and the standard error of the mean of 4 independent experiments (Wilcoxon test p value < 0.05 is indicated by *).

(TIF)

S3 Fig. Predicted structural organizations of bab-related gene complexes among nematocerans.

bric-a-brac paralogs from the fungus gnat Coboldia fuscipes (Psychodomorpha) and the gall midge Mayetiola destructor (Bibionomorpha), are shown. GenBank identifiers of the corresponding genomic sequences are indicated.

(TIF)

S4 Fig. LAE sequence conservation among the Brachycera.

(A) Structural conservation of the Dmel LAE enhancer among Drosophilidae. The locations of CR1-3 sequences, conserved among 12 reference drosophilid genomes, are boxed in green. (B-C) Alignments of brachyceran CR1 (B) and CR2 (C) sequences are shown. The four-letter species abbreviations are listed in S1 Data. Strictly conserved positions are indicated by white characters on a red background while partially ones conserved (>50%) are in black characters on a yellow background. The sequence LOGOs for the evolutionarily-conserved C15, Dll and Bowl binding sites are indicated above the aligned sequences.

(TIF)

S5 Fig. Cardiac and abdominal enhancer sequence conservation among schizophorans.

(A) Schematic view of the DE and CE enhancers within the Dmel bab locus. The tandem bab1 (blue) and bab2 (magenta) transcription units are depicted as in Fig 4A. Positions of the evolutionarily-conserved cores within the cardiac CE and abdominal DE sequences are shown in beneath. (B-C) Evolutionary conservation of CE (B) and DE (C) core sequences among schizophorans. The four-letter species abbreviations are listed in S1 Data. Strictly conserved positions are indicated by white characters on a red background while partially conserved ones (>50%) are in black characters on a yellow background. The sequence LOGOs for bona fide (Dsx and Abd-B) or predicted (Twist-Da, Lbe and Pan) transcription factor binding sites are shown above or below the alignments.

(TIF)

S6 Fig. bab1-2 promoter sequence conservation among brachycerans.

(A) Sequence homology between the Dmel twin bab gene promoters. Positions of initiator (Inr) and pause button (PB) sequences are indicated above the aligned sequences. Transcription start site (TSS) is indicated by a vertical arrow. (B-C) Evolutionary conservation of bab1 (B) and bab2 (C) promoter sequences, among selected dipteran lineages (as indicated on the left side). The four-letter species abbreviations are listed in S1 Data. Strictly conserved positions are indicated by white characters on a red background while partially conserved ones are in black characters on a yellow background. Inr, PB and TSS locations are depicted as in (A).

(TIF)

S1 Data. p.2. Abbreviations of investigated species.

p.3-20. Predicted sequences for BTB-BabCD proteins. p.21-22. Bab1 sequence conservation among cyclorrhaphans. p.23-24. Bab2 sequence conservation among cyclorrhaphans. p.25-29 Sequence conservation between Bab1/2 paralogs Sequence conservation between paralogous Bab1/2 proteins among cyclorrhaphans. The four-letter species abbreviations are as listed above (p.2). Strictly conserved amino-acid residues are indicated by white characters on a red background while partially conserved ones are in black characters on a yellow background. Locations of the strongly-conserved BTB and BabCD domains are indicated along the right side (see black lines). p.30-39 Enhancer sequence conservation among Drosophilidae. Conservation among twelve reference drosophilids of D. melanogaster LAE, CE, AE and DE sequences. The four-letter Drosophilidae species abbreviations are as listed below (page 2). Sequence LOGOs of (predicted) binding sites for the Dll, Bowl, C15, Rn, Pan, Lbe, Twist, Abd-B and Dsx transcription factors are depicted above or below the alignments.

(PDF)

Acknowledgments

We thank F. Karch, M. Suzanne, T.M. Williams, G. Boekhoff-Falk, S. Bray, G. Campbell, T. Kojima, F. Laski, J.L. Couderc and the Bloomington Stock Center for fly stocks and reagents. We are grateful to Alain Vincent for his proofreading of the manuscript. We thank Julien Favier for technical assistance, particularly in managing the transgenic facility. Lastly, we acknowledge Brice Ronsin and the Toulouse RIO Imaging platform.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

Research in the HMB-MB laboratory was supported by grants from the Association pour la Recherche sur le Cancer (ARC PJA 20141201932) to MB, the Agence Nationale de la Recherche (ANR-16 CE12-0021-01) to MB, and institutional basic support from of the Centre National de Recherche Scientifique (CNRS) to HMB and Toulouse III University to HMB. Research in the G.C. laboratory was supported by a grant from the European Research Council (Advanced Grant 3DEpi) and by the CNRS (for GC and FB). MHB obtained a PhD fellowship from the French « Ministère de L’Enseignement Supérieur et de la Recherche », LHMV from the Mexican CONACYT and AB from a CNRS- Conseil Régional Midi-Pyrénées co-financing and then from the ARC. V.L. was supported by a doctoral fellowship from the Laboratory of Excellence EpiGenMed and the ARC. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Ohno S., Evolution by Gene Duplication. 1970, Springer-Verlag. [Google Scholar]
  • 2.Zhang J., Evolution by gene duplication—an update. 2003, Trends Ecol. Evol. p. 292–298. [Google Scholar]
  • 3.Lundin L.G., Gene duplications in early metazoan evolution. Semin Cell Dev Biol, 1999. 10(5): p. 523–30. doi: 10.1006/scdb.1999.0333 [DOI] [PubMed] [Google Scholar]
  • 4.He X. and Zhang J., Rapid subfunctionalization accompanied by prolonged and substantial neofunctionalization in duplicate gene evolution. Genetics, 2005. 169(2): p. 1157–64. doi: 10.1534/genetics.104.037051 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sundström G., Larsson T.A., and Larhammar D., Phylogenetic and chromosomal analyses of multiple gene families syntenic with vertebrate Hox clusters. BMC Evol Biol, 2008. 8: p. 254. doi: 10.1186/1471-2148-8-254 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Long H.K., Prescott S.L., and Wysocka J., Ever-Changing Landscapes: Transcriptional Enhancers in Development and Evolution. Cell, 2016. 167(5): p. 1170–1187. doi: 10.1016/j.cell.2016.09.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Rubinstein M. and de Souza F.S., Evolution of transcriptional enhancers and animal diversity. Philos Trans R Soc Lond B Biol Sci, 2013. 368(1632): p. 20130017. doi: 10.1098/rstb.2013.0017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Carroll S.B., Evo-devo and an expanding evolutionary synthesis: a genetic theory of morphological evolution. Cell, 2008. 134(1): p. 25–36. doi: 10.1016/j.cell.2008.06.030 [DOI] [PubMed] [Google Scholar]
  • 9.Levine M., Transcriptional enhancers in animal development and evolution. Curr Biol, 2010. 20(17): p. R754–63. doi: 10.1016/j.cub.2010.06.070 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Vlad D., et al., Leaf shape evolution through duplication, regulatory diversification, and loss of a homeobox gene. Science, 2014. 343(6172): p. 780–3. doi: 10.1126/science.1248384 [DOI] [PubMed] [Google Scholar]
  • 11.Cheng Y., et al., Co-regulation of invected and engrailed by a complex array of regulatory sequences in Drosophila. Dev Biol, 2014. 395(1): p. 131–43. doi: 10.1016/j.ydbio.2014.08.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Barrio R., et al., Identification of regulatory regions driving the expression of the Drosophila spalt complex at different developmental stages. Dev Biol, 1999. 215(1): p. 33–47. doi: 10.1006/dbio.1999.9434 [DOI] [PubMed] [Google Scholar]
  • 13.Nellesen D.T., Lai E.C., and Posakony J.W., Discrete enhancer elements mediate selective responsiveness of enhancer of split complex genes to common transcriptional activators. Dev Biol, 1999. 213(1): p. 33–53. doi: 10.1006/dbio.1999.9324 [DOI] [PubMed] [Google Scholar]
  • 14.Gómez-Skarmeta J.L., et al., Cis-regulation of achaete and scute: shared enhancer-like elements drive their coexpression in proneural clusters of the imaginal discs. Genes Dev, 1995. 9(15): p. 1869–82. doi: 10.1101/gad.9.15.1869 [DOI] [PubMed] [Google Scholar]
  • 15.Couderc J.L., et al., The bric à brac locus consists of two paralogous genes encoding BTB/POZ domain proteins and acts as a homeotic and morphogenetic regulator of imaginal development in Drosophila. Development, 2002. 129(10): p. 2419–33. doi: 10.1242/dev.129.10.2419 [DOI] [PubMed] [Google Scholar]
  • 16.Salomone J.R., et al., The evolution of Bab paralog expression and abdominal pigmentation among Sophophora fruit fly species. Evol Dev, 2013. 15(6): p. 442–57. doi: 10.1111/ede.12053 [DOI] [PubMed] [Google Scholar]
  • 17.Roeske M.J., et al., Cis-regulatory evolution integrated the Bric-à-brac transcription factors into a novel fruit fly gene regulatory network. Elife, 2018. 7. doi: 10.7554/eLife.32273 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Williams T.M., et al., The regulation and evolution of a genetic switch controlling sexually dimorphic traits in Drosophila. Cell., 2008. 134(4): p. 610–23. doi: 10.1016/j.cell.2008.06.052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gompel N. and Carroll S.B., Genetic mechanisms and constraints governing the evolution of correlated traits in drosophilid flies. Nature, 2003. 424(6951): p. 931–5. doi: 10.1038/nature01787 [DOI] [PubMed] [Google Scholar]
  • 20.Kopp A., Duncan I., and Carroll S.B., Genetic control and evolution of sexually dimorphic characters in Drosophila. Nature, 2000. 408(6812): p. 553–9. doi: 10.1038/35046017 [DOI] [PubMed] [Google Scholar]
  • 21.Baanannou A., et al., Drosophila distal-less and Rotund bind a single enhancer ensuring reliable and robust bric-a-brac2 expression in distinct limb morphogenetic fields. PLoS Genet, 2013. 9(6): p. e1003581. doi: 10.1371/journal.pgen.1003581 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Godt D., et al., Pattern formation in the limbs of Drosophila: bric a brac is expressed in both a gradient and a wave-like pattern and is required for specification and proper segmentation of the tarsus. Development., 1993. 119(3): p. 799–812. doi: 10.1242/dev.119.3.799 [DOI] [PubMed] [Google Scholar]
  • 23.Godt D. and Laski F.A., Mechanisms of cell rearrangement and cell recruitment in Drosophila ovary morphogenesis and the requirement of bric à brac. Development, 1995. 121(1): p. 173–87. doi: 10.1242/dev.121.1.173 [DOI] [PubMed] [Google Scholar]
  • 24.Sahut-Barnola I., et al., Drosophila ovary morphogenesis: analysis of terminal filament formation and identification of a gene required for this process. Dev Biol, 1995. 170(1): p. 127–35. doi: 10.1006/dbio.1995.1201 [DOI] [PubMed] [Google Scholar]
  • 25.Junion G., et al., Genome-wide view of cell fate specification: ladybird acts at multiple levels during diversification of muscle and heart precursors. Genes Dev, 2007. 21(23): p. 3163–80. doi: 10.1101/gad.437307 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Camara N., et al., Doublesex controls specification and maintenance of the gonad stem cell niches in. Development, 2019. 146(11). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Duan J., et al., Bab2 Functions as an Ecdysone-Responsive Transcriptional Repressor during Drosophila Development. Cell Rep, 2020. 32(4): p. 107972. doi: 10.1016/j.celrep.2020.107972 [DOI] [PubMed] [Google Scholar]
  • 28.Zhao Y., et al., Bab2 activates JNK signaling to reprogram Drosophila wing disc development. bioRxiv. 10.1101/2020.12.30.424794 [DOI] [Google Scholar]
  • 29.Mojica-Vázquez L.H., et al., Tissue-specific enhancer repression through molecular integration of cell signaling inputs. PLoS Genet, 2017. 13(4): p. e1006718. doi: 10.1371/journal.pgen.1006718 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kojima T., The mechanism of Drosophila leg development along the proximodistal axis. Dev Growth Differ, 2004. 46(2): p. 115–29. doi: 10.1111/j.1440-169X.2004.00735.x [DOI] [PubMed] [Google Scholar]
  • 31.Kojima T., Developmental mechanism of the tarsus in insect legs. Curr Opin Insect Sci, 2017. 19: p. 36–42. doi: 10.1016/j.cois.2016.11.002 [DOI] [PubMed] [Google Scholar]
  • 32.Estella C., Voutev R., and Mann R.S., A dynamic network of morphogens and transcription factors patterns the fly leg. Curr Top Dev Biol, 2012. 98: p. 173–98. doi: 10.1016/B978-0-12-386499-4.00007-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Campbell G., Regulation of gene expression in the distal region of the Drosophila leg by the Hox11 homolog, C15. Dev Biol, 2005. 278(2): p. 607–18. doi: 10.1016/j.ydbio.2004.12.009 [DOI] [PubMed] [Google Scholar]
  • 34.Kojima T., Tsuji T., and Saigo K., A concerted action of a paired-type homeobox gene, aristaless, and a homolog of Hox11/tlx homeobox gene, clawless, is essential for the distal tip development of the Drosophila leg. Dev Biol, 2005. 279(2): p. 434–45. doi: 10.1016/j.ydbio.2004.12.005 [DOI] [PubMed] [Google Scholar]
  • 35.Natori K., et al., Progressive tarsal patterning in the Drosophila by temporally dynamic regulation of transcription factor genes. Dev Biol, 2012. 361(2): p. 450–62. doi: 10.1016/j.ydbio.2011.10.031 [DOI] [PubMed] [Google Scholar]
  • 36.Greenberg L. and Hatini V., Essential roles for lines in mediating leg and antennal proximodistal patterning and generating a stable Notch signaling interface at segment borders. Dev Biol, 2009. 330(1): p. 93–104. doi: 10.1016/j.ydbio.2009.03.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Lim B., et al., Visualization of Transvection in Living Drosophila Embryos. Mol Cell, 2018. 70(2): p. 287–296.e6. doi: 10.1016/j.molcel.2018.02.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Loubiere V., et al., Widespread activation of developmental gene expression characterized by PRC1-dependent chromatin looping. Sci Adv, 2020. 6(2): p. eaax4001. doi: 10.1126/sciadv.aax4001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Yeung K., et al., Integrative genomic analysis reveals novel regulatory mechanisms of eyeless during Drosophila eye development. Nucleic Acids Res, 2018. 46(22): p. 11743–11758. doi: 10.1093/nar/gky892 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.McKay D.J. and Lieb J.D., A common set of DNA regulatory elements shapes Drosophila appendages. Dev Cell, 2013. 27(3): p. 306–18. doi: 10.1016/j.devcel.2013.10.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Davie K., et al., Discovery of transcription factors and regulatory regions driving in vivo tumor development by ATAC-seq and FAIRE-seq open chromatin profiling. PLoS Genet, 2015. 11(2): p. e1004994. doi: 10.1371/journal.pgen.1004994 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Newcomb S., et al., cis-regulatory architecture of a short-range EGFR organizing center in the Drosophila melanogaster leg. PLoS Genet, 2018. 14(8): p. e1007568. doi: 10.1371/journal.pgen.1007568 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Chu J., Dong P.D., and Panganiban G., Limb type-specific regulation of bric a brac contributes to morphological diversity. Development, 2002. 129(3): p. 695–704. doi: 10.1242/dev.129.3.695 [DOI] [PubMed] [Google Scholar]
  • 44.Galindo M.I., et al., Leg patterning driven by proximal-distal interactions and EGFR signaling. Science, 2002. 297(5579): p. 256–9. doi: 10.1126/science.1072311 [DOI] [PubMed] [Google Scholar]
  • 45.Wiegmann B.M., et al., Episodic radiations in the fly tree of life. Proc Natl Acad Sci U S A, 2011. 108(14): p. 5690–5. doi: 10.1073/pnas.1012675108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wiegmann B.M. and Richards S., Genomes of Diptera. Curr Opin Insect Sci, 2018. 25: p. 116–124. doi: 10.1016/j.cois.2018.01.007 [DOI] [PubMed] [Google Scholar]
  • 47.Vicoso B. and Bachtrog D., Numerous transitions of sex chromosomes in Diptera. PLoS Biol, 2015. 13(4): p. e1002078. doi: 10.1371/journal.pbio.1002078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Clark A.G., et al., Evolution of genes and genomes on the Drosophila phylogeny. Nature., 2007. 450(7167): p. 203–18. doi: 10.1038/nature06341 [DOI] [PubMed] [Google Scholar]
  • 49.Ohler U., et al., Computational analysis of core promoters in the Drosophila genome. Genome Biol, 2002. 3(12): p. RESEARCH0087. doi: 10.1186/gb-2002-3-12-research0087 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Meers M.P., et al., Transcription start site profiling uncovers divergent transcription and enhancer-associated RNAs in Drosophila melanogaster. BMC Genomics, 2018. 19(1): p. 157. doi: 10.1186/s12864-018-4510-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Gilchrist D.A., et al., Pausing of RNA polymerase II disrupts DNA-specified nucleosome organization to enable precise gene regulation. Cell, 2010. 143(4): p. 540–51. doi: 10.1016/j.cell.2010.10.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Muse G.W., et al., RNA polymerase is poised for activation across the genome. Nat Genet., 2007. 39(12): p. 1507–11. Epub 2007 Nov 11. doi: 10.1038/ng.2007.21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Lee C., et al., NELF and GAGA factor are linked to promoter-proximal pausing at many genes in Drosophila. Mol Cell Biol, 2008. 28(10): p. 3290–300. doi: 10.1128/MCB.02224-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Kwak H., et al., Precise maps of RNA polymerase reveal how promoters direct initiation and pausing. Science, 2013. 339(6122): p. 950–3. doi: 10.1126/science.1229386 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Hong J.W., Hendrix D.A., and Levine M.S., Shadow enhancers as a source of evolutionary novelty. Science, 2008. 321(5894): p. 1314. doi: 10.1126/science.1160631 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Kim S. and Shendure J., Mechanisms of Interplay between Transcription Factors and the 3D Genome. Mol Cell, 2019. 76(2): p. 306–319. doi: 10.1016/j.molcel.2019.08.010 [DOI] [PubMed] [Google Scholar]
  • 57.Sabari B.R., Dall’Agnese A., and Young R.A., Biomolecular Condensates in the Nucleus. Trends Biochem Sci, 2020. doi: 10.1016/j.tibs.2020.06.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.de Celis Ibeas J.M. and Bray S.J., Bowl is required downstream of Notch for elaboration of distal limb patterning. Development, 2003. 130(24): p. 5943–52. doi: 10.1242/dev.00833 [DOI] [PubMed] [Google Scholar]
  • 59.Panganiban G., et al., The development of crustacean limbs and the evolution of arthropods. Science, 1995. 270(5240): p. 1363–6. doi: 10.1126/science.270.5240.1363 [DOI] [PubMed] [Google Scholar]
  • 60.Vandesompele J., et al., Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol, 2002. 3(7): p. RESEARCH0034. doi: 10.1186/gb-2002-3-7-research0034 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Gregory P Copenhaver, Artyom Kopp

13 Dec 2021

Dear Dr BOUBE,

Thank you very much for submitting your Research Article entitled 'A shared ancient enhancer element differentially regulates the bric-a-brac tandem gene duplicates in the developing Drosophila leg' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some concerns that we ask you address in a revised manuscript. We therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer.

In addition we ask that you:

1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.

We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

Please let us know if you have any questions while making these revisions.

Yours sincerely,

Artyom Kopp

Associate Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: This revised and improved manuscript by Bourbon et al. has addressed the majority of reviewers’ suggestions and concerns. In particular, the manuscript has been streamlined to include the most convincing observations of the original manuscript, which support the authors’ conclusions that: 1) bab1/2 are co-regulated by a common set of transcription factors acting through a leg-antennal enhancer (LAE); 2) the LAE is required for a subset of both bab1/2 expression along P/D axis of legs 3); the LAE is essential for bab2-specific expression in the ts1 and ts5 leg segments 4) the LAE function is partially redundant with sequences in the 15kb ESR, and 5) bab1 and bab2 arose from a tandem duplication in the Muscomorpha lineage.

While the revised manuscript is substantially improved, most revisions involved removal of data, such as the extensive, but incomplete, analysis of the ESR (previously called the BER). This has strengthened the document and has made it easier to follow, but it might have been further improved by additional analysis, suggested by another reviewer, that tests their idea that privileged interactions between the LAE and the bab2 promoter underlies LAE-mediated bab2-specific expression. Nonetheless, their conclusions overall are well supported by substantial and compelling observations, and this work provides important new insights into the origin and regulation of duplicated genes.

Reviewer #2: The authors investigate the role and the evolution of regulatory sequences driving bab1 and bab2 expression in Drosophila leg imaginal disc in parallel with bab duplication history in Dipterans.

The authors show that the transcription factors regulating bab2 expression in leg disc via the LAE enhancer also regulate bab1 expression in leg disc suggesting that the LAE enhancer regulate both genes.

The deletion of the LAE enhancer by CRISPR/CAs9 leads to an ectopic sexcomb on the second tarsal segment, a phenotype similar to that of bab2 hypomorphic mutants. Thus it is distinct from the stronger phenotype observed in bab1 and bab2 double mutants. Only bab1 expression is reduced in leg discs of the LAE deleted mutant as measured by RT-qPCR. However expression reduction of both genes along the proximodistal axis is revealed by immunostaining. The residual and significant expression must therefore be controlled by other redundant regulatory sequences. The authors very nicely exclude a potential transvection effect caused by the LAE-GFP transgene as the residual expression is observed in the absence of this transgene.

To identify the redundant regulatory sequences driving bab1 and bab2 expression in leg discs, the authors turn to chromatin analysis. They used available HI-C data from L3 leg disc and eye antennal disc and identify a topologically associated domain (TAD) covering bab1 and interacting with bab1-2 promoters. Using FAIRE-seq, ATAC-seq and active histone marks characterizing enhancers they identify enhancer signature along a 15Kb region covering bab1. In addition, ChIP seq data identify binding sites for DLL, an activator of bab genes in leg discs, in bab1 region. The authors use successfully a transvection assay to show that the redundant regulatory sequences present in bab1 are able to activate bab2 promoter (even if bab2 expression is noisy). Thus bab1 transcription unit likely contains enhancer sequences acting redundantly with LAE in controlling the expression of bab genes in leg disc.

Rescue experiments with BAC constructs containing regions of bab2 with intact or deleted LAE in a bab1-2 double mutant indicate that in the absence of the redundant regulatory sequences, the LAE is essential for bab2 expression in leg disc. Rescue experiment of the bab1-2 double mutant with a BAC containing entirely bab1 but not LAE indicate that this BAC contains the redundant regulatory sequences controlling bab genes expression in leg disc. Because of the large size and the complexity of this region (which contains also two distinct enhancers involved in bab1-2 expression in abdominal epidermis), the authors do not investigate further this region in this article.

The authors use then an evolutionary approach to reconstruct the evolution of bab gene family and their regulatory sequences in dipterans. bab1 and bab2 paralogues were identified in muscomorpha but a single bab genes was found in more distant dipterans (with a few exceptions). A maximum likelihood phylogeny with the protein sequences of bab genes was performed. bab1 and bab2 clades do not group together. The authors interpret it as consistent with an ancient duplication of bab1-2 genes within the muscomorpha lineage (I have comments on the interpretation of the phylogeny see bellow). Independent bab duplications have occurred in biblionomorpha and psychodomorpha lineages.

Sub-regions of the LAE enhancer can be identified in all Brachycera family. It is located as in Drosophila melanogaster between bab1 and bab2 in muscomorphan species, and 20 kb upstream of the singleton bab in the asilomorphan P. coquilletti. Thus the LAE element arose early in the Brachycera suborder. Other enhancers known to regulate bab1-2 expression in other tissue cannot be traced back in species as distant from D. melanogster as for the LAE element and were likely acquired after the bab1/2 duplication.

bab1 and bab2 promoter share some conservation which suggests that the promoter of the ancestral gene was also duplicated. bab1 promoter is more conserved in dipterans than bab2 promoter, which is consistent with a more rapid evolution of bab2.

In the discussion, the authors summarize their results on the early birth of the LAE enhancer that predates bab1/2 duplication and propose how their finding and previously published data could explain the differences of bab1 and bab2 expression in leg disc, based on different interactions between the LAE enhancer and bab2 promoter.

I enjoyed reading this very interesting manuscript, clearly written and well referenced. The methodology is rigorous. Many data have been generated using different approaches, which makes this work original. It allows the authors to illustrate how regulatory sequences evolve in parallel with gene duplication. More data on the redundant regulatory sequences present in bab1 would be a nice addition to this work, but I agree that the detailed investigation of these regulatory sequences is out of the scope of this paper as the authors write, because of the size and the complexity of this region. This work will appeal to a broad readership, in particular researchers in genetics and genomics, and fully deserves publication in PLOS Genetics after minor revisions (see bellow).

Comments:

Introduction : lines 70-73, it is written that phenotypic novelties are linked to the emergence or the modification of cis-regulatory elements. This is true generally for morphological evolution, but the modification of protein sequence has been shown to play a very important role in physiological evolution. We know many examples of adaptive evolution linked to protein sequence evolution (opsin, globin, venom proteins, temperature receptors, protein involved in resistance to plant toxin, etc...). I think this distinction between morphological and physiological evolution should be made.

There are other examples in drosophila of gene complexes in which particular paralogues have been shown to be regulated by shared enhancers (achaete-scute complex, spalt complex, Enhancer of split etc...). They could be briefly presented in the introduction.

Line 83, it is written that yellow expression takes place in histoblast nests. However at the stage when yellow is expressed, the histoblast nests have finished proliferating. Left and right sides have fused. I think it is more appropriate to use the term “epidermis”.

In the introduction, the effect of bab2 loss of function on leg development could be described. Only the effect of bab1 loss of function or loss of function of both bab1 and bab2 is described.

Only one control gene was used to normalize bab1 and bab2 expression in RT-qPCR (Figure S2). It is usually advised to use several ones. I think at least one other control gene should be measured.

In Figure 3, the scale bar of 10Kb is missing.

In Figure 5A, I think it would be better to provide a tree showing evolutionary relationships of dipterans extracted from published dipteran phylogenies (such as Wiegmann et al., 2011; There are also more recent phylogenies on some Dipteran sub-groups).

The phylogenetic reconstruction using bab gene protein sequences is not enough detailed in the Material and Methods. Were highly diverging regions excluded from the analysis or were all sites used? If all sites were used, how did the authors deal with regions impossible to align?

In the phylogeny presented in Fig 5B bab1 and bab2 clades do not group together. The authors interpret it as consistent with an old duplication and a faster evolution of bab2 genes. However, if the phylogeny is taken for granted, the grouping of bab1 with bab singleton clade indicate that they are orthologous and that bab2 was lost in an ancestor of species containing only one bab gene. Thus it does not corresponds to the authors’ interpretation. However, the support for bab clade grouping with the singleton bab clade is low. Thus the more basal position of bab2 is more likely artificial and caused by long branch attraction if bab2 is evolving rapidly. I therefore agree with the authors’ conclusion but I think that this should be discussed. There is also a phylogeny of bab genes in Figure S3A. Many more species are included than in the tree from figure 5B. In this tree, bab1 and bab2 paralogues group together (although with a low support) and two bab1 paralogues group artificialy before bab1/bab2 split. This difference between the two trees should be commented.

I think that he leg phenotype with the ectopic sexcomb of the LAE CRISPR/Cas9 deleted flies (Figure S2) is very nice and should be included in Figure 2 in order to be present in the main article.

Thanks for the opportunity to review this very nice work!

Reviewer #3: The manuscript by Bourbon et al. is a revised and concise version of a manuscript I reviewed last spring. In this new submission, the authors omitted the parts of the manuscript that were ambiguous and focused on the solid parts of the study. Namely, they focus on the question of how regulatory information is rewired after gene duplication. The authors use the tandemly duplicated Drosophila bric-a-brac (bab) paralogs, bab1 and bab2 to address this question. Building on their previous work on the bab2 LAE enhancer, that drives expression in eye-antenna and leg imaginal discs, they show that LAE also regulates bab1 expression in these tissues by using the same set of transcription factors. Interestingly, they find that the LAE enhancer can drive both redundant and unique expression patterns and suggest that the unique expression patterns result from specific interactions with the promoter of each paralog. The authors performed a comprehensive phylogenomic analysis to trace the evolutionary origin of the bab genes and their regulatory sequences. They show that the LAE enhancer region predated the gene duplication event, and suggest that after the duplication, paralogous-specific regulatory connections were generated between the duplicated gene and the enhancer. This work provides interesting new insights into the mechanisms by which new regulatory linkages are form during gene duplication and I think is appropriate for publication in Plos Genetics it its current format (with two minor comments).

Minor comments:

1. Please follow the journal Figure File Requirements (For example: text within the Figures should be Ariel or Times).

2. Line 383: it would be more accurate to state that “This work raises some hypotheses” instead of “This work brings some clues…” as no functional data was presented to support these “clues”.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Decision Letter 1

Gregory P Copenhaver, Artyom Kopp

7 Feb 2022

Dear Dr BOUBE,

We are pleased to inform you that your manuscript entitled "A shared ancient enhancer element differentially regulates the bric-a-brac tandem gene duplicates in the developing Drosophila leg" has been editorially accepted for publication in PLOS Genetics. Congratulations!

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

Artyom Kopp

Associate Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: 

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-21-01427R1

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

Acceptance letter

Gregory P Copenhaver, Artyom Kopp

10 Mar 2022

PGENETICS-D-21-01427R1

A shared ancient enhancer element differentially regulates the bric-a-brac tandem gene duplicates in the developing Drosophila leg

Dear Dr BOUBE,

We are pleased to inform you that your manuscript entitled "A shared ancient enhancer element differentially regulates the bric-a-brac tandem gene duplicates in the developing Drosophila leg" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Katalin Szabo

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Contrary to Bowl, Rotund gain-of-function differentially affects bab1 and LAE-GFP (bab2) expression.

    (A) The bab1 paralog is expressed in a subset of LAE-GFPZH2A (bab2)-expressing cells, both proximally and distally within the developing tarsus. Merged Bab1 (red) immunostaining and GFP fluorescence (green) as well as each marker in isolation in (A’) and (A”), respectively, are shown for a wild-type L3 leg disc expressing LAE-GFPZH2A (medial confocal view). Positions of LAE-GFPZH2A (bab2)-expressing ts1-5 cells and of the non-expressing pre-tarsal (pt) cells are indicated in (A) and (A’). Brackets indicate paralog-specific expression in bab2-expressing (GFP+) ts1 and ts5 cells, as detected as green- instead of yellow-colored cells in (A) (see also white arrows in (A’)). Of note, bab1 is only expressed in distal ts1 cells, while LAE-GFPZH2A (bab2) expression extends proximally. (B) Rotund TF gain-of-function within the developing Dll-expressing cells differentially activates the bab gene paralogs along the P-D leg axis. Merged Bab1 (red) immunostaining and GFP (green) fluorescence, as well as each marker in isolation in (B’) and (B”), respectively, are shown for a leg disc dissected from a L3 larvae harboring both UAS-Rn and DllEM212-Gal4 transgenes. Contrary to a distal domain (circled with a dashed line) in which both bab1 and LAE-GFPZH2A (bab2) are strictly co-expressed, many proximalmost Dll-expressing GFP+ cells neither activate bab1 (some are indicated by white arrows). (C) Ectopic Bowl TF stabilization, through clonal Lines protein depletion, is sufficient to down-regulate both bab1 and LAE-GFPZH2A (bab2) expression. Merged Bab1 (cyan) immunostaining, RFP (red) and GFP (green) fluorescence, as well as the two former markers in isolation in (C’) and (C”), respectively, are shown for a L3 leg disc expressing LAE-RFPZH2A. Flip-out (FO) mitotic clones are detected through GFP expression in (C), and are circled with dashed lines in (C’) and (C”). Within the developing tarsus Bowl stabilization leads to cell-autonomous repression of both bab1 and LAE-RFPZH2A (bab2).

    (TIF)

    S2 Fig. LAE deletion mutant behaves as a hypomorphic allele.

    (A) Targeted deletion of the LAE with CRIPSR/Cas9 genome editing. The sequences flanking LAE from the wild-type (Wt) and six deleted chromosomes (M1-6) are shown. LAE sequences are depicted in orange while exogenous sequences in mutant chromosomes are indicated by distinctly-colored lower case letters (unmodified nucleotides are upper case ones). (B) Overall bab1-2 expression from wild-type and homozygous babΔLAE L3 leg discs, as determined from reverse transcription quantitative PCR analyses. mRNA levels are normalized from expression of three housekeeping genes: Rpl32, Mlc-c and Gpdh1. Results show the mean and the standard error of the mean of 4 independent experiments (Wilcoxon test p value < 0.05 is indicated by *).

    (TIF)

    S3 Fig. Predicted structural organizations of bab-related gene complexes among nematocerans.

    bric-a-brac paralogs from the fungus gnat Coboldia fuscipes (Psychodomorpha) and the gall midge Mayetiola destructor (Bibionomorpha), are shown. GenBank identifiers of the corresponding genomic sequences are indicated.

    (TIF)

    S4 Fig. LAE sequence conservation among the Brachycera.

    (A) Structural conservation of the Dmel LAE enhancer among Drosophilidae. The locations of CR1-3 sequences, conserved among 12 reference drosophilid genomes, are boxed in green. (B-C) Alignments of brachyceran CR1 (B) and CR2 (C) sequences are shown. The four-letter species abbreviations are listed in S1 Data. Strictly conserved positions are indicated by white characters on a red background while partially ones conserved (>50%) are in black characters on a yellow background. The sequence LOGOs for the evolutionarily-conserved C15, Dll and Bowl binding sites are indicated above the aligned sequences.

    (TIF)

    S5 Fig. Cardiac and abdominal enhancer sequence conservation among schizophorans.

    (A) Schematic view of the DE and CE enhancers within the Dmel bab locus. The tandem bab1 (blue) and bab2 (magenta) transcription units are depicted as in Fig 4A. Positions of the evolutionarily-conserved cores within the cardiac CE and abdominal DE sequences are shown in beneath. (B-C) Evolutionary conservation of CE (B) and DE (C) core sequences among schizophorans. The four-letter species abbreviations are listed in S1 Data. Strictly conserved positions are indicated by white characters on a red background while partially conserved ones (>50%) are in black characters on a yellow background. The sequence LOGOs for bona fide (Dsx and Abd-B) or predicted (Twist-Da, Lbe and Pan) transcription factor binding sites are shown above or below the alignments.

    (TIF)

    S6 Fig. bab1-2 promoter sequence conservation among brachycerans.

    (A) Sequence homology between the Dmel twin bab gene promoters. Positions of initiator (Inr) and pause button (PB) sequences are indicated above the aligned sequences. Transcription start site (TSS) is indicated by a vertical arrow. (B-C) Evolutionary conservation of bab1 (B) and bab2 (C) promoter sequences, among selected dipteran lineages (as indicated on the left side). The four-letter species abbreviations are listed in S1 Data. Strictly conserved positions are indicated by white characters on a red background while partially conserved ones are in black characters on a yellow background. Inr, PB and TSS locations are depicted as in (A).

    (TIF)

    S1 Data. p.2. Abbreviations of investigated species.

    p.3-20. Predicted sequences for BTB-BabCD proteins. p.21-22. Bab1 sequence conservation among cyclorrhaphans. p.23-24. Bab2 sequence conservation among cyclorrhaphans. p.25-29 Sequence conservation between Bab1/2 paralogs Sequence conservation between paralogous Bab1/2 proteins among cyclorrhaphans. The four-letter species abbreviations are as listed above (p.2). Strictly conserved amino-acid residues are indicated by white characters on a red background while partially conserved ones are in black characters on a yellow background. Locations of the strongly-conserved BTB and BabCD domains are indicated along the right side (see black lines). p.30-39 Enhancer sequence conservation among Drosophilidae. Conservation among twelve reference drosophilids of D. melanogaster LAE, CE, AE and DE sequences. The four-letter Drosophilidae species abbreviations are as listed below (page 2). Sequence LOGOs of (predicted) binding sites for the Dll, Bowl, C15, Rn, Pan, Lbe, Twist, Abd-B and Dsx transcription factors are depicted above or below the alignments.

    (PDF)

    Attachment

    Submitted filename: response to reviewers 2022 01 31.pdf

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLoS Genetics are provided here courtesy of PLOS

    RESOURCES