Abstract
Background
Peripheral blood mononuclear cells (PBMCs) have been identified as a possible marker of inflammation in obesity. Understanding the expression of pro‐ and anti‐inflammatory cytokines in PBMCs in obese dogs will help control obesity‐related inflammatory diseases.
Objectives
The aim of this study was to evaluate the role of PBMCs in obesity‐associated chronic inflammation by analyzing the expression of adipokines and inflammatory cytokines.
Methods
Blood samples were obtained from 25 subjects and real‐time quantitative polymerase chain reaction determinations were performed to quantify the gene expression levels of adipokines and inflammatory cytokines, including TNF‐α, IL‐17, leptin, MCP‐1, and adiponectin, in the PBMCs.
Results
The results showed that the gene expression levels of TNF‐α (p < 0.001), IL‐17 (p < 0.0001), and leptin (p < 0.0001) were strongly upregulated in the PBMCs of obese dogs compared to that in non‐obese dogs.
Conclusions
The changes in gene expression levels of inflammation‐related adipokines and pro‐inflammatory cytokines occur in PBMCs, which may contribute to the low‐grade chronic inflammation that is present in obesity.
Keywords: adipokine, canine, obesity, peripheral blood mononuclear cell, pro‐inflammatory cytokine
1. INTRODUCTION
Obesity is the state of having an increased adipose tissue mass as a result of an imbalance between energy intake and output. It is also considered a form of chronic low‐grade inflammation in humans. Furthermore, human obesity has been proven to be associated with type 2 diabetes mellitus, osteoarthritis, cardiovascular diseases, systemic hypertension and as a risk factor for various kinds of cancer (Enns et al., 2011). To identify how obesity contributes to the development of a chronic inflammatory state, several studies have been conducted to analyse gene expression levels of pro‐inflammatory cytokines and adipokines in relation to body mass index and body weight. As in humans, some findings suggest that canine obesity may be related to diseases like osteoarthritis, insulin resistance, pancreatitis and respiratory disease (Piantedosi et al., 2016). However, limited studies have investigated the difference in gene expression between obese and normal dogs.
Peripheral blood mononuclear cells (PBMCs) are conventional and universal blood samples that are used to analyse biomarkers at a transcriptional level. PBMCs are mainly composed of lymphocytes, monocytes and natural killer cells, which are all essential components of the immune system. They are generally useful in identifying changes in cytokine activity during inflammation since direct measurement of blood concentration level is limited due to the short half‐life of cytokines and the presence of many inhibitors in the blood serum (Friberg et al., 1994). In addition, a more suitable amount of sample can be obtained when using PBMCs to confirm gene expression levels, in contrast to other test samples such as fat and muscles (de Mello et al., 2008). Several studies have compared adipokine and cytokine gene expressions in circulating PBMCs to discuss the correlation between obesity and inflammation in humans. However, in veterinary medicine, most studies have evaluated the correlation between obesity and inflammation by comparing cytokine concentration in serum samples, and only one study utilised gene expression (Vendramini et al., 2020). However, this study used whole blood samples instead of PBMCs; hence, there is a need for further research in this area.
In this study, we aimed to evaluate how obesity affects the expression of inflammation‐related adipokines in circulating PBMCs. We analyzed the messenger RNA (mRNA) expression of not only adipokines and chemokines such as leptin, adiponectin and monocyte chemoattractant protein‐1 (MCP‐1), but also pro‐inflammatory cytokines such as tumour necrosis factor‐alpha (TNF‐α), and interleukin‐17 (IL‐17). The haematological effects of obesity were also considered and analysed by comparing the results of general blood tests on obese and non‐obese dogs.
2. MATERIALS AND METHODS
2.1. Animals
All animals included in this study were client‐owned, young, healthy dogs with no known systemic disease and were brought in for blood donation. Informed consent was obtained from the owners before each procedure. Using a thorough physical examination and the BCS 9 score system, dogs with BCS 7–9 were defined as obese dogs, while dogs with BCS 4–6 were classified as the normal group (Laflamme, 1997). The blood samples taken for analysis were part of their health screening, which is also evaluated and discussed in this study. Furthermore, circulating PBMC samples were taken from whole blood and used to analyse gene expression.
2.2. Sample collection
All dogs included in this study underwent over 12 hours of fasting. A physical examination was done, after which, blood samples were obtained by venipuncture from either the jugular or cephalic vein.
2.3. Complete blood count and serum biochemistry
Blood samples treated with EDTA were used for complete blood count (CBC) while samples taken in SST tubes were centrifuged and used for the serum chemistry panel including serum triglycerides (TG) and total cholesterol (T‐chol) level measurements.
2.4. PBMC isolation, RNA extraction and real‐time quantitative PCR
PBMCs were isolated from the EDTA‐treated blood samples by using density‐gradient sedimentation with Ficoll—Paque reagent (GE Healthcare, Little Chalfont, Bucks, UK). Total RNA was extracted from the PBMCs using easy‐BLUE reagent (iNtRON, Sungnam, Republic of Korea) after following the manufacturer's instructions. With this RNA, 20 μl of cDNA was synthesized with CellScript cDNA Master Mix (Cell‐Safe, Suwon, Korea). Each patient's target gene expression was evaluated in duplicate.
Target adipokines and cytokines included TNF‐α, IL‐17, MCP‐1, leptin, adipokine and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH). Adipokine and cytokine gene expression was quantified by quantitative polymerase chain reaction (RT‐qPCR) using AMPIGENE qPCR Green Mix Hi‐ROX with SYBR Green Dye (Enzo Life Sciences, Farmingdale, NY, USA). This was evaluated in duplicate, and GAPDH, being a housekeeping gene, was used as a reference. The sequences of primers used are listed in Table 1.
TABLE 1.
Primer sequences used to detect gene expression of adipokines, chemokines, cytokines and housekeeping gene
| Gene | 5′‐3′ Primer sequence | References | |
|---|---|---|---|
| Leptin | Forward | TTCCTGTGGCTTTGGCCCTAT | (Ishioka et al., 2006) |
| Reverse | GCCACCACCTCTGTGGAGTA | ||
| Adiponectin | Forward | CCGTGATGGCAGAGATGGC | (Saengsoi, 2018) |
| Reverse | AGCCTCGGGGACCTTCAAC | ||
| Monocyte chemoattractant protein 1 | Forward | GCTCACCCAGCCAGATGC | (Ryan, 2008) |
| Reverse | GCAGTTTGGGTTTGGCTTTT | ||
| Interleukin‐17 | Forward | CCGATCTACCTCACCTTGGA | (Schmitz et al., 2015) |
| Reverse | TCGCAGAACCAGGATCTCTT | ||
| Tumor necrosis factor‐alpha | Forward | TCATCTTCTCGAACCCCAAG | (Rai et al., 2008) |
| Reverse | ACCCATCTGACGGCACTATC | ||
| Glyceraldehyde‐3‐phoaphate dehydrogenase | Forward | TATGACATCAAGAAGGTAGTAA | (Kim et al., 2019) |
| Reverse | GTAGCCAAATTCATTGTCATACCAG | ||
2.5. Statistical analysis
All data are presented as mean values and standard error of the mean (SEM). Statistical comparisons between the two groups were performed using an unpaired two‐tailed Student's t test. p‐values < 0.05 were considered statistically significant. All statistical analyses were performed using GraphPad Prism v 6.01 (GraphPad Software Inc., La Jolla, CA, USA).
3. RESULTS
3.1. General characteristics of patients
The general characteristics of each patient are shown in Table 2. A total of 25 dogs participated; five dogs were classified in the obese group (BCS above 7) and the other 20 were classified in the non‐obese control group. All patients are large breed dogs, mainly Labradors and Golden Retrievers. The mean BCS of the obese dogs was at 7.2 ± 0.2, while the non‐obese dogs had a mean BCS of 5.333 ± 0.1436; the mean body weight of the obese dogs was 36.16 ± 2.347 kg, while the non‐obese dogs have a mean body weight of 32.04 ± 0.9925 kg; and the mean age of the obese dogs was 5.8 ± 1.158 years, while the non‐obese dogs had a mean age of 4.9 ± 0.362 years (Table 3).
TABLE 2.
Characteristics including breed, age and sex, of the 25 study dogs, across body condition scores (BCS)
| Gourp | Breed | BCS (/9) | Age | Sex |
|---|---|---|---|---|
| Obese | Labrador retriever | 7 | 5 yrs | MC |
| Labrador retriever | 7 | 6 yrs | MC | |
| Golden retriever | 7 | 2 yrs | IF | |
| Labrador retriever | 7 | 7 yrs | FS | |
| Labrador retriever | 8 | 9 yrs | MC | |
| Non‐obese | Labrador retriever | 5 | 4 yrs | MC |
| Labrador retriever | 6 | 3 yrs | MC | |
| Poongsan Dog | 6 | 5 yrs | MC | |
| Labrador retriever | 4 | 4 yrs | MC | |
| Labrador retriever | 6 | 3 yrs | MC | |
| Labrador retriever | 5 | 5 yrs | IF | |
| Labrador retriever | 6 | 5 yrs | MC | |
| Golden retriever | 5 | 2 yrs | MC | |
| Labrador retriever | 6 | 8 yrs | FS | |
| Labrador retriever | 5 | 7 yrs | MC | |
| Golden retriever | 5 | 6 yrs | MC | |
| Labrador retriever | 5 | 3 yrs | FS | |
| Labrador retriever | 5 | 3 yrs | MC | |
| Great Pyrenees | 4 | 6 yrs | M | |
| Golden retriever | 5 | 6 yrs | FS | |
| Golden retriever | 6 | 5 yrs | MC | |
| Old English sheepdog | 6 | 6 yrs | IM | |
| Labrador retriever | 5 | 4 yrs | MC | |
| Labrador retriever | 6 | 7 yrs | MC | |
| English sheepdog | 6 | 6 yrs | MC |
TABLE 3.
Mean BCS, body weight and age of obese and non‐obese dogs
| Non‐obese | Obese | |||
|---|---|---|---|---|
| Mean ± SEM | Median (range) | Mean ± SEM | Median (range) | |
| BCS | 5.333 ± 0.1436 | 5 (4‐6) | 7.2 ± 0.2 | 7 (7‐8) |
| Body weight (Kg) | 32.04 ± 0.9925 | 31.9 (24.7‐38.2) | 36.16 ± 2.347 | 35 (31.5‐44.4) |
| Years | 4.9 ± 0.362 | 5 (3‐8) | 5.8 ± 1.158 | 6 (2‐9) |
3.2. Hematochemical parameters
The results of the blood analysis are shown in Table 4. Among the hematologic tests and chemistry panels performed, only the blood TG concentration level was significantly different between the obese and non‐obese dogs (p < 0.0001).
TABLE 4.
Complete blood count, serum chemistry, electrolytes of obese and non‐obese dogs
| Parameter | Unit | Reference range | Non obese group (Mean ± SEM; n = 20) | Obese group (Mean ± SEM, n = 5) | p value |
|---|---|---|---|---|---|
| WBC | /uL | 5200‐17000 | 7719 ± 325.2 | 7914 ± 525.4 | 0.7877 |
| N/L ratio | 2.19 ± 0.1967 | 2.969 ± 0.4829 | 0.0943 | ||
| PCV | % | 37.1‐57.0 | 47.26 ± 0.6217 | 44.68 ± 1.7 | 0.0977 |
| PLT | 10000/uL | 14.3‐40.0 | 47.26 ± 0.6217 | 25 ± 2.901 | 0.4686 |
| ALT | U/L | 5.8‐83.3 | 45.7 ± 2.861 | 50.2 ± 6.733 | 0.5027 |
| AST | U/L | 11.7‐42.5 | 29.75 ± 1.048 | 29.2 ± 4.283 | 0.8523 |
| ALP | U/L | 0‐97.9 | 34.25 ± 3.39 | 25 ± 3.435 | 0.2039 |
| GGT | U/L | 0‐14 | 3.4 ± 0.613 | 3.2 ± 1.158 | 0.8842 |
| T‐bil | mg/dL | 0‐0.2 | 0.096 ± 0.01032 | 0.064 ± 0.01503 | 0.1614 |
| BUN | mg/dL | 9.6‐31.4 | 15.85 ± 0.8328 | 12.02 ± 1.373 | 0.0456 |
| CREA | mg/dL | 0.4‐1.3 | 1.03 ± 0.03112 | 1.072 ± 0.08315 | 0.5768 |
| Calcium | mg/dL | 9.0‐11.9 | 10.06 ± 0.1025 | 10.26 ± 0.2227 | 0.3874 |
| IP | mg/dL | 1.3‐6.3 | 3.895 ± 0.2188 | 3.22 ± 0.4176 | 0.1777 |
| Total protein | g/dL | 5.7‐7.5 | 6.712 ± 0.09902 | 6.928 ± 0.22 | 0.3489 |
| Albumin | g/dL | 2.6‐4.4 | 3.85 ± 0.06835 | 3.832 ± 0.05826 | 0.9027 |
| T‐Chol | mg/dL | 112‐312 | 252.2 ± 14.34 | 191.8 ± 16.19 | 0.0661 |
| TG | mg/dL | 21‐133 | 52.87 ± 3.348 | 111.5 ± 17.04 | < 0.0001 |
| Glu | mg/dL | 74.5‐120 | 104.5 ± 2.472 | 106 ± 4.29 | 0.7770 |
| Na | mmol/L | 145.1‐152.6 | 146.4 ± 0.2532 | 146.5 ± 0.405 | 0.7941 |
| K | mmol/L | 3.6‐5.5 | 4.323 ± 0.05241 | 4.5 ± 0.1118 | 0.1434 |
| Cl | mmol/L | 113.2‐122.9 | 116.6 ± 0.3952 | 115.7 ± 0.9958 | 0.3702 |
3.3. Gene expression of pro‐inflammatory cytokines and adipokines
In comparing the gene expression levels between the obese and non‐obese dogs, TNF‐α, IL‐17 and leptin showed a statistically significant increase in obese dogs (p < 0.001) while MCP‐1 (p = 0.7068) and adiponectin (p = 0.3800) showed a tendency to increase and decrease in obese dogs, respectively. Diagrams comparing the expression of mRNAs are given in Figure 1.
FIGURE 1.
mRNA expression of pro‐inflammatory cytokines and Adipokines in PBMC of obese dogs. Expression of pro‐inflammatory cytokines such as TNF‐α and IL‐17 and Adipokine such as Leptin, MCP‐1, adiponectin were analyzed using RT‐qPCR. Results are shown as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001. ns, not significant
4. DISCUSSION
The aim of this study was to compare the expression levels of pro‐inflammatory cytokines and adipokines in the PBMCs of obese and non‐obese dogs. Previous studies have confirmed that the gene expression in PBMCs is related to the amount of visceral fat (Yamaoka et al., 2012) and varies depending on the presence of systemic inflammation (Ghanim et al., 2004). Since PBMCs significantly reflect the expression of obesity‐related systemic cytokines and adipokines as well as represent a more convenient sample extraction process in contrast to the use of adipose, liver and muscle tissues, many studies on human obesity and inflammation have been conducted on PBMCs. In this study, PBMCs were used as a novel sample to identify in vivo cytokine gene expression to characterize the effects of dog obesity on adipokine expression and systemic inflammation.
As pro‐inflammatory cytokines TNF‐α and IL‐17 significantly increased in the circulating PBMCs of obese dogs, it can be established that obese dogs are in a low‐grade chronic inflammatory status. Studies done in the early 1990s in obese mice showed an increase in the expression of TNF‐α. TNF‐α is expressed and secreted in adipose tissue; therefore, its expression increases as the degree of obesity increases, thereby causing clinical symptoms such as insulin resistance (Hotamisligil et al., 1993). Additionally, TNF‐α also has tumour‐promoting activity; hence, the correlation between obesity and cancer in humans, which is also a major factor discussed in recent studies. IL‐17, a cytokine derived mainly from T cells and secreted by adipose tissues, plays a major role in the initiation of inflammation. It is also known to be involved in glucose homeostasis and adipogenesis (Zúñiga et al., 2010). Studies also reported that IL‐17 promotes inflammatory response in obese mice (Lee et al., 2017) and is associated with autoimmune diseases and chronic inflammation in humans with obesity (Chehimi et al., 2017).
Upon comparison of the expression of adipokines and chemokines such as leptin, adiponectin and MCP‐1 in circulating PBMCs, a difference between obese and non‐obese dogs was found. Among them, leptin is an adipokine produced in adipocytes and is known to be greatly affected by adipose tissue (Münzberg & Morrison, 2015). Obesity can result in an increase in blood leptin levels that can lead to various clinical symptoms due to its effects on glucose and lipid metabolism, angiogenesis, cell‐mediated immunity, blood pressure homeostasis, body temperature regulation and appetite regulation (Francisco et al., 2018). However, so far, there has been no study confirming the expression level of leptin in the PBMC of obese dogs. Interestingly, in this study, it was confirmed that the expression of leptin was significantly increased in PBMC of obese dogs.
This study is the first to discuss changes in the pro‐inflammatory cytokine and adipokine expression in the circulating PBMCs of obese dogs. Confirmation of results at the actual protein level was not performed, nevertheless, the significant results of this study can serve as a major foundation for studying the correlation between obesity and immune cells, in addition to the existing studies on serum cytokine and adipokine concentrations in obese dogs. A follow‐up study confirming the change in expression of more cytokines and adipokines in the circulating PBMCs is recommended. Since dogs and humans share a similar environment, this study can also serve as an important reference for mediating research.
Blood tests clearly indicated an increase in the TG levels of obese dogs. Although no significant difference was found in the T‐chol levels, some studies have shown that T‐chol in obese dogs (José Lahm Cardoso et al., 2016; Piantedosi et al., 2016; Tropf et al., 2017) could be used to evaluate the effects of obesity on hyperlipidemia. Therefore, hyperlipidemia can be regarded as a clinical symptom associated with obesity in dogs, as in humans. The risk of metabolic syndrome, in which type 2 diabetes mellitus, cardiovascular diseases and high blood pressure appear together, has been very well established. Obesity has also been presented as a problem in dogs, furthering interest in metabolic syndrome. Our results support previous evidence that confirmed the presence of hyperlipidemia in obese dogs, and thus, contribute to the clinical significance of metabolic syndrome in obese dogs.
The neutrophil‐lymphocyte ratio (N/L ratio) has been used as a marker of systemic inflammation and as an indicator of some inflammatory diseases in dogs (Benvenuti et al., 2020; Pierini et al., 2019). In this experiment, we were able to confirm if the N/L ratio increased in obese dogs. Several studies conducted on human obesity have reported an increase in the N/L ratio (Furuncuoğlu et al., 2016; Rodríguez‐Rodríguez et al., 2020); however, based on the author's knowledge, no previous studies regarding changes in the N/L ratio have been conducted on dogs. Therefore, we recommend further discussion on the use of the N/L ratio as an inflammatory marker in future studies on dog obesity.
Another limitation of this study is the imbalance in the number of dogs included in the obese group (n = 5) and the control group (n = 20). Analysis of small breeds was also limited, and advanced tests such as blood insulin concentration and lymphocyte differentiation were not performed. Nevertheless, the results of this experiment confirmed that the expression of inflammatory cytokines and adipokines was significantly high in obese dogs, it could serve as the basis for further research on larger population sizes, more diverse breeds and more comprehensive laboratory blood test items.
5. CONCLUSIONS
This is the first study to confirm changes in the expression levels of inflammatory cytokines and adipokines in PBMCs of obese dogs. Our findings could serve as a basis for further research on the association of obesity with chronic inflammation as well as its correlation with the incidence of systemic diseases associated with adipokines in dogs.
CONFLICT OF INTEREST
The authors declare that they have no conflict of interest.
ETHICS STATEMENT
All animal experiments in this study were approved by the institutional animal care and use committee of Seoul National University (SNU), Republic of Korea; all protocols were in accordance with the approved guidelines (SNU, protocol no. SNU‐200519‐6). The clients agreed to provide peripheral blood mononuclear cells of the dog to the laboratory of Veterinary Internal Medicine, Seoul National University and to fully assume the future management. All informed consents are documented.
AUTHOR CONTRIBUTIONS
Conceptualization: An JH, Youn HY; Data curation: Hwang SY, An JH, Kim KB, Lee JH, Park SM, Oh YI, Chae HK, Youn HY; Formal analysis: Hwang SY, An JH, Youn HY; Funding acquisition: Hwang SY, An JH, Youn HY; Investigation: Hwang SY, An JH, Youn HY; Methodology: Hwang SY, An JH, Youn HY; Project administration: Hwang SY, An JH, Youn HY; Resources: Hwang SY, An JH, Youn HY; Software: Youn HY; Supervision: Youn HY; Validation: Youn HY; Visualization: Youn HY; Writing ‐ original draft: Hwang SY, An JH; Writing ‐ review & editing: An JH, Youn HY.
PEER REVIEW
The peer review history for this article is available at https://publons.com/publon/10.1002/vms3.713.
ACKNOWLEDGEMENTS
This study was supported by the Research Institute for Veterinary Science, Seoul National University and the Basic Science Research Program of the National Research Foundation of Korea.
Hwang, S.‐Y. , An, J.‐H. , Kim, K.‐B. , Lee, J.‐H. , Park, S.‐M. , Oh, Y.‐i. , Chae, H. K. , & Youn, H.‐Y. (2022). Gene expression of adipokines and inflammatory cytokines in peripheral blood mononuclear cells of obese dogs. Veterinary Medicine and Science, 8, 517–523. 10.1002/vms3.713
Seo‐Young Hwang and Ju‐Hyun An are co‐first authors and contributed equally.
DATA AVAILABILITY STATEMENT
Data openly available in a public repository that issues datasets with DOIs.
REFERENCES
- Benvenuti, E. , Pierini, A. , Gori, E. , Lucarelli, C. , Lubas, G. , & Marchetti, V. (2020). Neutrophil‐to‐lymphocyte ratio (NLR) in canine inflammatory bowel disease (IBD). Veterinary Sciences, 7, 141–147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chehimi, M. , Vidal, H. , & Eljaafari, A. (2017). Pathogenic role of IL‐17‐producing immune cells in obesity, and related inflammatory diseases. Journal of Clinical Medicine, 6, 68–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- de Mello, V. D. , Kolehmainen, M. , Schwab, U. , Mager, U. , Laaksonen, D. E. , Pulkkinen, L. , Niskanen, L. , Gylling, H. , Atalay, M. , & Rauramaa, R. (2008). Effect of weight loss on cytokine messenger RNA expression in peripheral blood mononuclear cells of obese subjects with the metabolic syndrome. Metabolism, 57, 192–199. [DOI] [PubMed] [Google Scholar]
- Enns, J. E. , Taylor, C. G. , & Zahradka, P. (2011). Variations in adipokine genes AdipoQ, Lep, and LepR are associated with risk for obesity‐related metabolic disease: The modulatory role of gene‐nutrient interactions. Journal of Obesity, 2011, 168659 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Francisco, V. , Pino, J. , Campos‐Cabaleiro, V. , Ruiz‐Fernández, C. , Mera, A. , Gonzalez‐Gay, M. A. , Gómez, R. , & Gualillo, O. (2018). Obesity, fat mass and immune system: Role for leptin. Frontiers in Physiology, 9, 640–659. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Friberg, D. , Bryant, J. , Shannon, W. , & Whiteside, T. (1994). In vitro cytokine production by normal human peripheral blood mononuclear cells as a measure of immunocompetence or the state of activation. Clinical and Diagnostic Laboratory Immunology, 1, 261–268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Furuncuoğlu, Y. , Tulgar, S. , Dogan, A. , Cakar, S. , Tulgar, Y. , & Cakiroglu, B. (2016). How obesity affects the neutrophil/lymphocyte and platelet/lymphocyte ratio, systemic immune‐inflammatory index and platelet indices: A retrospective study. European Review for Medical and Pharmacological Sciences, 20, 1300–1306. [PubMed] [Google Scholar]
- Ghanim, H. , Aljada, A. , Hofmeyer, D. , Syed, T. , Mohanty, P. , & Dandona, P. (2004). Circulating mononuclear cells in the obese are in a proinflammatory state. Circulation, 110, 1564–1571. [DOI] [PubMed] [Google Scholar]
- Hotamisligil, G. S. , Shargill, N. S. , & Spiegelman, B. M. (1993). Adipose expression of tumor necrosis factor‐alpha: Direct role in obesity‐linked insulin resistance. Science, 259, 87–91. [DOI] [PubMed] [Google Scholar]
- Ishioka, K. , Omachi, A. , Sagawa, M. , Shibata, H. , Honjoh, T. , Kimura, K. , & Saito, M. (2006). Canine adiponectin: CDNA structure, mRNA expression in adipose tissues and reduced plasma levels in obesity. Research in Veterinary Science, 80, 127–132. [DOI] [PubMed] [Google Scholar]
- José Lahm Cardoso, M. , Fagnani, R. , Zaghi Cavalcante, C. , de Souza Zanutto, M. , Júnior, A. Z. , Holsback da Silveira Fertonani, L. , Calesso, J. R. , Melussi, M. , Pinheiro Costa, H. , & Yudi Hashizume, E. (2016). Blood pressure, serum glucose, cholesterol, and triglycerides in dogs with different body scores. Veterinary Medicine International, 2016, 8675283. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim, S.‐M. , Li, Q. , An, J.‐H. , Chae, H.‐K. , Yang, J.‐I. , Ryu, M.‐O. , Nam, A. , Song, W.‐J. , & Youn, H.‐Y. (2019). Enhanced angiogenic activity of dimethyloxalylglycine‐treated canine adipose tissue‐derived mesenchymal stem cells. Journal of Veterinary Medical Science, 81(11), 1663–1670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Laflamme, D. (1997). Development and validation of a body condition score system for dogs. Canine Practice (Santa Barbara, Calif.: 1990)(USA), 22(4), 10–15. [Google Scholar]
- Lee, S. H. , Jhun, J. , Byun, J.‐K. , Kim, E.‐K. , Jung, K. , Lee, J. E. , Choi, J. Y. , Park, S.‐H. , & Cho, M.‐L. (2017). IL‐17 axis accelerates the inflammatory progression of obese in mice via TBK1 and IKBKE pathway. Immunology Letters, 184, 67–75. [DOI] [PubMed] [Google Scholar]
- Münzberg, H. , & Morrison, C. D. (2015). Structure, production and signaling of leptin. Metabolism, 64, 13–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Piantedosi, D. , Di Loria, A. , Guccione, J. , De Rosa, A. , Fabbri, S. , Cortese, L. , Carta, S. , & Ciaramella, P. (2016). Serum biochemistry profile, inflammatory cytokines, adipokines and cardiovascular findings in obese dogs. The Veterinary Journal, 216, 72–78. [DOI] [PubMed] [Google Scholar]
- Pierini, A. , Gori, E. , Lippi, I. , Ceccherini, G. , Lubas, G. , & Marchetti, V. (2019). Neutrophil‐to‐lymphocyte ratio, nucleated red blood cells and erythrocyte abnormalities in canine systemic inflammatory response syndrome. Research in Veterinary Science, 126, 150–154. [DOI] [PubMed] [Google Scholar]
- Rai, M. F. , Rachakonda, P. S. , Manning, K. , Vorwerk, B. , Brunnberg, L. , Kohn, B. , & Schmidt, M. F. (2008). Quantification of cytokines and inflammatory mediators in a three‐dimensional model of inflammatory arthritis. Cytokine, 42, 8–17. [DOI] [PubMed] [Google Scholar]
- Rodríguez‐Rodríguez, E. , López‐Sobaler, A. M. , Ortega, R. M. , Delgado‐Losada, M. L. , López‐Parra, A. M. , & Aparicio, A. (2020). Association between neutrophil‐to‐lymphocyte ratio with abdominal obesity and healthy eating index in a representative older Spanish population. Nutrients, 12, 855–871. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ryan, V. H. (2008). Studies on the expression and secretion of adipokines in canine white adipose tissue. University of Liverpool. [Google Scholar]
- Saengsoi, W. (2018). The role of adipose tissue in canine cranial cruciate ligament disease. University of Liverpool. [Google Scholar]
- Schmitz, S. , Glanemann, B. , Garden, O. , Brooks, H. , Chang, Y. , Werling, D. , & Allenspach, K. (2015). A prospective, randomized, blinded, placebo‐controlled pilot study on the effect of Enterococcus faecium on clinical activity and intestinal gene expression in canine food‐responsive chronic enteropathy. Journal of Veterinary Internal Medicine, 29, 533–543. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tropf, M. , Nelson, O. , Lee, P. , & Weng, H. (2017). Cardiac and metabolic variables in obese dogs. Journal of Veterinary Internal Medicine, 31, 1000–1007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yamaoka, M. , Maeda, N. , Nakamura, S. , Kashine, S. , Nakagawa, Y. , Hiuge‐Shimizu, A. , Okita, K. , Imagawa, A. , Matsuzawa, Y. , & Matsubara, K.‐i. (2012). A pilot investigation of visceral fat adiposity and gene expression profile in peripheral blood cells. PLoS One, 7(10), e47377–e47383. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zúñiga, L. A. , Shen, W.‐J. , Joyce‐Shaikh, B. , Pyatnova, E. A. , Richards, A. G. , Thom, C. , Andrade, S. M. , Cua, D. J. , Kraemer, F. B. , & Butcher, E. C. (2010). IL‐17 regulates adipogenesis, glucose homeostasis, and obesity. The Journal of Immunology, 185, 6947–6959. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data openly available in a public repository that issues datasets with DOIs.