Activity of Gemifloxacin against Penicillin- and Ciprofloxacin-Resistant Streptococcus pneumoniae Displaying Topoisomerase- and Efflux-Mediated Resistance Mechanisms

Abstract

Nine penicillin-resistant Streptococcus pneumoniae clinical isolates from Northern Ireland, resistant to ciprofloxacin (MICs, 2 to 64 μg/ml) through topoisomerase- and/or reserpine-sensitive efflux mechanisms, were highly susceptible to gemifloxacin (MICs, 0.03 to 0.12 μg/ml). Two strains (requiring a ciprofloxacin MIC of 64 μg/ml) carried known quinolone resistance mutations in parC, parE, and gyrB, resulting in S79F, D435V, and E474K changes, respectively. Thus, gemifloxacin is active against clinical strains exhibiting altered topoisomerase and efflux phenotypes.

The emergence and global spread of penicillin-resistant Streptococcus pneumoniae pose a major challenge to the effective control of pneumococcal disease (reviewed in references 1, 4, 8, 13, and 28). Over the last two decades, pneumococci with diminished penicillin susceptibility due to multiple alterations in penicillin binding proteins have been reported in New Guinea, South Africa, Spain, Hungary, France, and the United States, reaching a prevalence of 25 to 40% in many areas and up to 70% in Hungary. Penicillin resistance can occur independently or in association with reduced susceptibility to other antipneumococcal drugs, such as trimethoprim, tetracycline, chloramphenicol, erythromycin, and related antibiotics. Although the mechanisms of resistance to these antibiotics are thought to be distinct (e.g., resistance to erythromycin occurs through the modification of the ribosome or through altered macrolide efflux [16, 27]), diminished susceptibility to all these drugs is more common in penicillin-resistant than in penicillin-susceptible strains. Recent interest has therefore focused on agents that act by alternative mechanisms, notably the fluoroquinolones, such as ciprofloxacin, which kill bacteria by inhibiting DNA synthesis through interaction with either or both of the target enzymes DNA gyrase and topoisomerase IV (12, 14). Gyrase, an A₂B₂ tetramer encoded by the gyrA and gyrB genes, catalyzes ATP-dependent DNA supercoiling during DNA replication, whereas topoisomerase IV is made up of two C and two E subunits, specified by the parC and parE genes, and facilitates chromosome segregation (7, 29). Though the activity of ciprofloxacin against S. pneumoniae is borderline, the new fluoroquinolones that are coming into clinical use possess significantly greater antipneumococcal activity (25).

Gemifloxacin (SB265805, LB20304) is a highly potent fluoroquinolone which exhibits broad-spectrum activity with particular potency against penicillin-susceptible and -resistant strains of S. pneumoniae (5, 18). These features indicate that gemifloxacin could be useful in the treatment of community-acquired respiratory infections. However, one factor that could influence the utility of gemifloxacin and other new fluoroquinolones is the occurrence of quinolone-resistant pneumococcal strains selected by prior exposure to other quinolones. Such strains are currently uncommon but are being identified through surveillance (6). Resistance can arise either through altered efflux or through mutations in defined regions, termed the quinolone resistance-determining regions (QRDRs), of the topoisomerase IV and gyrase genes (7, 17, 19). Activity of gemifloxacin against clinical isolates with defined topoisomerase and altered efflux resistance mechanisms has not been reported thus far. To address this issue, we describe the first detailed characterization and drug responses of a panel of novel penicillin-resistant S. pneumoniae clinical strains from Northern Ireland (10), some of which display concomitant resistance to ciprofloxacin (11).

Table 1 presents the antibiotic susceptibility profiles of 10 isolates, B1 through 33, collected from 1988 to 1995 by the Public Health Laboratory, Belfast City Hospital (unrelated susceptible strains 7785 and D5 are included for comparison). The strains belong to serotype 6B or 9V as determined by the standard Quellung method (sera from Statens Seruminstitut, Copenhagen, Denmark). By pulsed-field gel electrophoresis (PFGE) of chromosomal SmaI DNA fragments according to the method of Lefevre et al. (15) (Pharmacia PFGE apparatus), strains B1, 27, 28, and 33 were indistinguishable from the Spanish/French 9V clone, whereas B5 and 24 were indistinguishable from the Spanish 6B clone, suggesting that these six strains may have originated from continental Europe. Strains B6, B10, and 4 each had a PFGE pattern that differed from each other and those of the other isolates. MICs were measured by twofold agar dilution (19). All 10 strains displayed intermediate- or high-level resistance to penicillin G (MIC ≥ 0.1 μg/ml), and 5 of 10 isolates were also highly resistant to erythromycin (MIC ≥ 16 μg/ml). With the exception of strain B10, for which the ciprofloxacin MIC of 1 μg/ml was in line with those for the susceptible strains 7785 and D5 (19), the other nine isolates were resistant to ciprofloxacin, requiring MICs of 2 to 64 μg/ml. Ofloxacin and sparfloxacin were effective against most strains. However, isolates 27 and 28 (which may be related) were highly resistant to ciprofloxacin and ofloxacin, requiring MICs of 64 and 16 μg/ml, respectively. Interestingly, all the isolates required gemifloxacin MICs in the range of 0.03 to 0.12 μg/ml (Table 1). Even strains 27 and 28, which were highly resistant to ciprofloxacin, required gemifloxacin MICs of only 0.12 μg/ml, the lowest for the quinolones tested.

TABLE 1.

Drug susceptibilities and topoisomerase QRDR statuses of S. pneumoniae clinical isolates from Northern Ireland^a

Strain	Serotype	PFGE patternb	MIC (μg/ml) of:							Mutation(s) in the QRDR ofc:
			PENd	ERYd	EBR	CIP (+ RES)	OFL	SPAR	GEMI	GyrA	ParC	GyrB	ParE
B1	9V	A	1	0.25	32–64	4 (1–2)	2	0.5	0.12	None	None	None	I460V
B5	6B	B	2	0.25	32–64	4 (0.5)	2	0.5	0.06	None	None	None	I460V
B6	9V	Unique	2	>16	32	4 (2)	2	0.5	0.06	None	None	None	I460V
B10	6B	Unique	1	0.25	8	1 (0.5)	1	0.5	0.03	None	None	None	None
4	9V	Unique	5	0.25	32	2 (0.5)	2	0.5	0.06	None	None	None	I460V
24	6B	B	1	>16	32	2–4 (1–2)	1	0.5	0.03	None	None	None	None
25	NT	ND	2	16	32	2 (0.5–1)	2	0.5	0.06	None	None	None	I460V
27	9V	A	1	>16	32–64	64 (8)	16	1	0.12	None	S79F	E474K	D435V, I460V
28	9V	A	1	>16	32–64	64 (8)	16	1	0.12	None	S79F	E474K	D435V, I460V
33	9V	A	1	0.25	32	2 (0.5)	2	0.5	0.06	None	None	None	I460V
7785	ND	ND	ND	ND	16	1–2 (ND)	2	0.5	0.06	None	None	None	None
D5	ND	ND	ND	ND	8–16	1 (ND)	ND	ND	ND	None	None	None	None

^aPEN, penicillin G; ERY, erythromycin; EBR, ethidium bromide; CIP, ciprofloxacin; RES, reserpine (at 7.5 μg/ml); OFL, ofloxacin; SPAR, sparfloxacin; GEMI, gemifloxacin; ND, not determined; NT, not typeable. 

^bA, identical to that of the Spanish/French 9V clone; B, same as that of the Spanish 6B clone. 

^cWith the exception of 7785 and D5, all strains harbored a silent mutation (GTT→GTC) at codon 88 of the gyrA sequence. Mutations (by reference to the 7785 DNA sequence) were as follows: ParC, S79F (TCT→TTT); GyrB, E474K (GAA→AAA); and ParE, I460V (ATC→GTC) and D435V (GAC→GTC). 

^dData from the National Public Health Laboratory, Colindale, London, United Kingdom. 

To clarify the molecular basis underlying the enhanced activity of gemifloxacin over that of ciprofloxacin and other quinolones, it was important to determine the resistance mechanisms operating in these strains. Recent studies have suggested that altered efflux is commonly involved in the ciprofloxacin resistance of S. pneumoniae clinical isolates (2, 3, 9). Reversal of resistance to ciprofloxacin by the efflux pump inhibitor reserpine and an increased MIC of the pump substrate ethidium bromide are both routinely taken as evidence indicating an efflux phenotype (2, 3). We found that reserpine at 7.5 μg/ml lowered the ciprofloxacin MICs for all the clinical isolates we tested two- to eightfold (Table 1) but by itself had no effect on bacterial growth (not shown). Moreover, compared to ciprofloxacin-susceptible strains B10, D5, and 7785, the same strains required two- to eightfold increases in the ethidium bromide MIC. These data are consistent with the operation of an efflux system which appears relatively inefficient in extruding sparfloxacin and gemifloxacin in many of these strains.

PCR was used to amplify the gyrA, gyrB, parC, and parE QRDRs of clinical isolates, with chromosomal DNA as a template and with the primer pairs shown in Table 2. Conditions for PCR and for asymmetric PCR (to provide single-stranded DNA) prior to DNA sequence analysis were as described previously (19, 21, 22). The gyrA sequences were identical among the strains, and to that of 7785 and D5, except for a silent mutation at codon 88 (Table 1) (19, 23). Similarly, the parC and gyrB sequences were identical to that of strain 7785, except for isolates 27 and 28, in which the sequences encoded changes of S79F in ParC and E474K in GyrB (Table 1). In addition, the sequences in strains 27 and 28 encoded a D435V ParE change. Finally, except for those in isolates B10 and 24, the parE QRDR specified an I460V alteration (whose presence did not correlate with ciprofloxacin MICs). No other mutations were detected in the QRDRs. The parC mutation converting S79 (the equivalent residue to the quinolone resistance hot spot S83 in Escherichia coli GyrA [30]) to Phe is known to confer ciprofloxacin resistance on S. pneumoniae (26). Similarly, the parE mutation changes D435 to Val in a highly conserved EGDSA motif at the position equivalent to D426 in E. coli GyrB (31), whose mutation to Asn is known to confer quinolone resistance (24). Finally, the gyrB mutation resulting in a E474K alteration at the protein level downstream of the PLRGK motif has been reported previously for a first-step S. pneumoniae mutant selected with clinafloxacin (22). Thus, it is likely that all three topoisomerase mutations, along with altered efflux, contribute to the high-level ciprofloxacin resistance of strains 27 and 28.

TABLE 2.

Oligonucleotides used to amplify or sequence QRDRs of S. pneumoniae gyrase and topoisomerase IV genes

Oligonucleotide (gene)	Use(s)a	Sequence (nucleotide position, 5′→3′)b
VGA9 (gyrA)	P	AAGTGAAGGCAAGGGCG (184 to 167)c
VGA4 (gyrA)	P, As	ACCAGTTGCTCCATTAAC (513 to 496)
VGA3 (gyrA)	S	ACCGTCGCATTCTTTACG (128 to 145)
M0362 (parC)	P	ATGTGAATGACTATGTC (−377 to −361)
M5884 (parC)	P	ATACGAAGAGCATCACGG (893 to 876)
M4721 (parC)	As	TGCTGGCAAGACCGTTGG (471 to 454)
M0363 (parC)	S	TGGGTTGAAGCCGGTTCA (105 to 122)
M4025 (gyrB)	P	TTCTCCGATTTCCTCATG (1096 to 1113)
M4026 (gyrB)	P, As	AGAAGGGTACGAATGTGG (1563 to 1546)
VGBQ (gyrB)	S	AACCTTCCAGGGAAACTAGC (1231 to 1250)
XS01 (parE)	P	TGAAGCGATTGAGTTCCA (651 to 668)
M0361 (parE)	P	ATCCGACTCTAATTTCCA (−376 to −393)d
S6399 (parE)	As	TCTGCTCCAACACCCGCA (1469 to 1452)
S6398 (parE)	S	AAGGCGCGTGATGAGAGCC (1180 to 1198)

^aOligonucleotides were used for PCR amplification (P) and asymmetric PCR (As) and as primers for DNA sequence analysis (S). 

^bBased on sequences in references 20 and 23. Oligonucleotides VGA9, VGA4, M5884, M4721, M4026, M0361, and S6399 are based on noncoding strand nucleotide sequences. 

^cNucleotide positions refer to the ldh gene upstream of gyrA (23). 

^dNucleotide positions in the parC gene downstream of parE (20). 

The results described here indicate that gemifloxacin is highly potent against multidrug-resistant S. pneumoniae clinical isolates whose ciprofloxacin resistance accrues from altered topoisomerase targets and/or putative efflux mechanisms. Activity against strains 27 and 28 was particularly impressive, requiring a gemifloxacin MIC of 0.12 μg/ml, which is 500-fold lower than that of ciprofloxacin. The presence of a parC mutation in strains 27 and 28 affecting S79 in ParC is consistent with selection by ciprofloxacin, which targets topoisomerase IV (17, 19, 24). However, association of the parC change with the particular parE and gyrB mutations identified here (Table 1) has not been reported previously. Ciprofloxacin normally selects parC (or parE) changes and then gyrA mutations (19). Conceivably, the relatively small effects of the topoisomerase mutations on gemifloxacin MICs for strains 27 and 28 (compared to those on the ciprofloxacin MIC) could arise from gemifloxacin targeting GyrA. These aspects are presently under investigation. Irrespective of these various considerations, the data presented here suggest that gemifloxacin may be useful in the treatment of both ciprofloxacin-resistant and multidrug-resistant S. pneumoniae infections.