Remifentanil reduces the proliferation, migration and invasion of HCC cells via lncRNA NBR2/miR‐650/TIMP3 axis

Abstract

Cancer cell hyperproliferation and metastasis are major causes of cancer‐associated mortality. Although the use of anaesthetics and analgesics may affect cancer cell metastasis, the underlying molecular mechanism remains unclear. This study aimed to explore the mechanisms of action of remifentanil on hepatocellular carcinoma (HCC) progression. Cell viability was measured by the 3‐(4, 5‐dimethyl‐2‐thiazolyl)‐2, 5‐diphenyl‐2‐h‐tetrazolium bromide assay. Quantitative real‐time polymerase chain reaction and Western blotting were performed to assess the expression levels of long non‐coding RNA (lncRNA) neighbour of BRCA1 gene 2 (NBR2), microRNA (miR)‐650 and tissue inhibitor of metalloproteinase‐3 (TIMP3) in HCC cells. Wound healing and transwell assays were employed to evaluate the migration and invasion of HCC cells respectively. The target relationships between miR‐650 and NBR2/TIMP3 were confirmed by dual luciferase reporter assay. Remifentanil reduced the viability of HCC cells in a dose‐dependent manner. Remifentanil treatment significantly increased the expression of lncRNA NBR2 and TIMP3, and repressed miR‐650 expression in HCC cells. Decreased lncRNA NBR2 or increased miR‐650 promoted the proliferation, migration and invasion of remifentanil‐treated HCC cells. LncRNA NBR2 targeted miR‐650, and miR‐650 further targeted TIMP3. Moreover, miR‐650 down‐regulation or TIMP3 up‐regulation reversed the effects of lncRNA NBR2 knockdown that caused an enhancement of cell viability, migration and invasiveness in remifentanil‐treated HCC cells. Thus remifentanil reduces the proliferation, migration and invasion of HCC cells via the lncRNA NBR2/miR‐650/TIMP3 axis in vitro.

1. INTRODUCTION

Opioid analgesics are widely used for clinical anaesthesia. ¹ Recently, growing evidence has indicated that opioids can suppress tumour growth. ² , ³ For instance, sufentanil and morphine can promote apoptosis and reduce cell viability in gastric cancer in vitro. ² , ³ As an opioid receptor agonist, remifentanil is reported to induce the apoptosis of glioma cells. ⁴ Additionally, remifentanil can also promote cellular respiration and suppress mitochondrial dysfunction in human hepatocytes. ⁵ More importantly, previous studies have indicated that remifentanil is conducive to conscious sedation in patients undergoing radiofrequency ablation of hepatocellular carcinoma (HCC). ⁶ , ⁷ However, research on the effect of remifentanil on HCC progression is relatively rare.

HCC is one of the most common malignancies with high metastasis and frequent recurrence. ⁸ It ranks as the fifth most prevalent malignancy worldwide and accounts for approximately 90% of all liver cancers. ⁹ It is reported that HCC is caused by varied risk factors, including smoking, liver cirrhosis, alcohol consumption and chronic hepatitis infection. ¹⁰ Currently, surgical resection, systemic chemotherapies and orthotopic liver transplantation are the main strategies for HCC therapies, but these treatments are hard to completely control the tumour progression. ¹¹ , ¹² Therefore, it is crucial to develop new methods for preventing and treating HCC.

Increasing attention has been paid to the association of long non‐coding RNAs (lncRNAs) with HCC. ¹³ LncRNAs are defined as transcripts with 200 nucleotides in length and unable to encode proteins. ¹⁴ Mounting studies have revealed that lncRNAs exert key roles in regulating pathological progression of HCC. ¹⁵ , ¹⁶ , ¹⁷ Li et al have suggested that lncRNA FAL1 promotes HCC progression by enhancing proliferative and migratory abilities of HCC cells. ¹⁵ Silencing of lncRNA small nucleolar RNA host gene 7 or MYCN opposite strand restrains HCC cells from proliferating, migrating and invading. ¹⁶ , ¹⁷ Notably, lncRNA neighbour of BRCA1 gene 2 (NBR2) also functions as critical regulators in diverse cancers. ¹⁸ , ¹⁹ , ²⁰ For example, lncRNA NBR2 is reported to reduce migration, invasiveness and proliferation of osteosarcoma cells. ¹⁸ Down‐regulation of lncRNA NBR2 promotes the development of thyroid cancer by increasing cell invasiveness, wound healing and proliferation. ¹⁹ Importantly, lncRNA NBR2 is unveiled to repress the proliferation, invasion and migration of HCC cells. ²⁰ However, studies of whether lncRNA NBR2 is a molecular target of remifentanil to affect HCC progression are rare.

Generally, lncRNAs exert their functions by interacting with microRNAs (miRNAs) in cancers. ²¹ miRNAs serve as the specificity factors in post‐transcriptional gene silencing being 18‐22 nucleotides in length. ²² Numerous studies have demonstrated that miRNAs are deeply involved in the pathological process of HCC. ²³ , ²⁴ Zhao et al have stated that increased miR‐124 leads to the suppression of proliferative, migratory and invasive abilities in HCC cells. ²³ Tian et al have unveiled that miR‐365b promotes HCC cells to invade and migrate in vitro. ²⁴ Of note, miR‐650 is also an important regulator in HCC progression. ²⁵ , ²⁶ Up‐regulation of miR‐650 accelerates HCC progression via enhancing of the migration and invasion in HCC. ²⁵ The inhibitory effects of Axin1 on HCC proliferation, migration and invasion are eliminated by miR‐650. ²⁶ Besides, miR‐650 is reported to interact with several lncRNAs in many diseases, such as lncRNA TALNEC2‐miR‐650 in cerebral ischaemia/reperfusion injury ²⁷ and lncRNA MEG3‐miR‐650 in lung cancer. ²⁸ However, whether miR‐650 is modulated by lncRNA NBR2 in in remifentanil‐treated HCC cells is still unclear.

miRNAs are frequently involved in pathological processes through regulating their target genes. ²⁹ , ³⁰ Tissue inhibitor of metalloproteinase‐3 (TIMP3), located on chromosome 22q12, is an endogenous inhibitor of protease activity. ³¹ Interestingly, TIMP3 can be regulated by many miRNAs in cancers, including miR‐103 in nasopharyngeal carcinoma (NPC), ³² miR‐21 in HCC ³³ and miR‐17‐5p in bladder cancer. ³⁴ More importantly, accumulating evidence has indicated that TIMP3 also affects the tumorigenesis of HCC. ³³ , ³⁵ Shen et al have suggested that up‐regulation of TIMP3 represses proliferation, migration and invasion of HCC cells. ³⁵ Li et al have reported that the impact of miR‐21 down‐regulation on proliferation and apoptosis of curcumin‐induced HCC cells can be attenuated by TIMP3 knockdown. ³³ However, whether TIMP3 interacts with lncRNA NBR2/miR‐650 axis in remifentanil‐treated HCC cells has not been explored.

In the current study, we explored the role of remifentanil in HCC cells for the first time. Then, we further verified whether remifentanil made an impact on HCC cells mediated via the lncRNA NBR2/miR‐650/TIMP3 axis in vitro.

2. MATERIALS AND METHODS

2.1. Cell culture and treatment

Human HCC cell lines (Hep3B, SK‐Hep‐1 and Huh7) were purchased from the American Type Culture Collection (ATCC). All cells were cultured in Dulbecco's modified Eagle's medium (DMEM) including 10% foetal bovine serum (FBS; Gibco), 100  U/ml penicillin (Sigma) and 100 μg/ml streptomycin (Sigma), and incubated at 37°C in a humidified air with 5% CO₂. To explore the effect of remifentanil (Sigma‐Aldrich) on HCC cells all cells were treated by different concentrations (0, 0.5, 2.5, 3.75 μg/ml) of remifentanil for 6, 12, 24 and 48 h respectively. ⁴

2.2. Quantitative real‐time polymerase chain reaction (qRT‐PCR)

Total RNAs were extracted using an RNeasy Mini Kit (Qiagen). To obtain complementary DNAs (cDNAs), the extracted RNAs were subjected to a reverse transcription system with a PrimeScript RT reagent Kit (Takara). Next, cDNAs were utilized for qRT‐PCR analysis using a SYBR Green PCR kit (Takara). The amplification conditions were listed as follows: 95°C for 5 min, 36 cycles of 95°C for 30 s, 60°C for 30 s and 72°C for 30 s. Primers for qRT‐PCR (Table 1) were bought from Sangon Biotech. Relative expression was calculated via the 2^−ΔΔCt method. The expression of lncRNA NBR2 and TIMP3 was normalized to GAPDH, and miR‐650 expression was normalized to U6.

TABLE 1.

Primers for quantitative real‐time polymerase chain reaction (qRT‐PCR)

Gene	Forward	Reverse
LncRNA NBR2	5′‐GGAGGTCTCCAGTTTCGGTA3′	5′‐TTGATGTGTGCTTCCTGGG‐3′
MiR‐650	5′‐AGAGGAGGCAGCGCTCT ‐3′	5′‐CAGTGCGTGTCGTGGAGT‐3′
TIMP3	5′‐ACCGAGGCTTCACCAAGATG‐3′	5′‐CATCATAGACGCGACCTGTCA‐3′
U6	5′‐GCTTCGGCAGCACATATACTAAAAT‐3′	5′‐CGCTTCACGAATTTGCGTGTCAT‐3′
GAPDH	5′‐GGGAGCCAAAAGGGTCAT‐3′	5′‐CCTTCCACGATACCAA‐3′

2.3. Cell transfection

The short hairpin (sh)‐negative control (NC), sh‐NBR2, pcDNA‐NC, pcDNA‐NBR2 and pcDNA‐TIMP3 were obtained from GenePharma (Shanghai, China). miR‐NC, miR‐650 mimics, inhibitor NC and miR‐650 inhibitor were purchased from GeneCopoeia. Then the above transcripts were transfected into Hep3B and SK‐Hep‐1 cells using Lipofectamine 3000 (Invitrogen) for 48 h.

2.4. Dual‐luciferase reporter (DLR) assay

The 3′‐UTR fragment of lncRNA NBR2 or TIMP3 containing the binding sites of miR‐650 was introduced into a pGL3‐promotor vector (Sangon Biotech) to construct NBR2 wild‐type (wt) or TIMP3 wt. After the binding sites of miR‐650 in lncRNA NBR2 or TIMP3 were mutated, NBR2 mutant type (mut) or TIMP3 mut was generated in a similar way. Next, the above reporter vectors, together with miR‐NC/miR‐650 mimics, were transfected into Hep3B and SK‐Hep‐1 cells via Lipofectamine 3000 (Invitrogen). Following 48 h of transfection, relative luciferase activity (the ratio of Firefly luciferase activity and Renilla luciferase activity) was evaluated using a Dual‐Glo Luciferase assay kit (Promega).

2.5. 3‐(4, 5‐Dimethyl‐2‐Thiazolyl)‐2, 5‐Diphenyl‐2‐H‐Tetrazolium Bromide (MTT) assay

Remifentanil‐treated cells were placed in a 96‐well plate at a density of 5 × 10³ cells/well. Subsequently, MTT solution (20 µl) was added to each well and incubated for 4 h. After removing medium, dimethyl sulfoxide (200 µl) was added and mixed with the cells to dissolve formazan crystals. To evaluate cell viability, the optical density (490 nm) was measured using a microplate reader (Bio‐Rad).

2.6. Wound healing assay

Hep3B and SK‐Hep‐1 cells (1 × 10⁶ cells/well) were plated into 6‐well plates and cultured in DMEM with 10% FBS until a monolayer of cells was formed. Then cells were scratched with a 200‐μl pipette tip. After being washed with PBS, cells were cultured in FBS‐free DMEM for 24 h. The wound width was observed under a light microscope and photographed at 0 h and 24 h post‐scratching. Relative wound healing rate was calculated with the following formula: (wound width at 0 h ‐ wound width at 24 h)/wound width at 0 h × 100%.

2.7. Transwell invasion assay

The transwell chamber (8 PM pore size; Millipore) pre‐coated with Matrigel was used to evaluate the invasion of Hep3B and SK‐Hep‐1 cells. Cells suspended in FBS‐free medium (200 µl) were plated to the upper chamber. Meanwhile, the lower chamber was filled with 500 µl medium supplemented with 20% FBS. After incubation for 24 h, cells penetrating across the Matrigel membrane were fixed with methanol for 15 min and then stained with 0.1% crystal violet for 20 min. The number of invasion cells in 5 random fields was calculated under an inverted microscope (Olympus).

2.8. Western blot

Total proteins from Hep3B and SK‐Hep‐1 cells were extracted via RIPA lysis buffer (Beyotime). A BCA protein assay kit II (Bio‐Rad) was used to determine protein concentration. Then proteins were separated by sodium dodecyl sulphate polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes. Next the membranes were blocked with 5% non‐fat milk for 1 h, followed by incubation with primary antibodies anti‐TIMP3 (1:1000, ab276134, Abcam) and anti‐GAPDH (1:10 000, ab181602, Abcam) overnight at 4°C. After being washed with tris‐buffered saline Tween (TBST), the protein samples were incubated with the secondary antibody (1:6,000, ab6721, Abcam) at 37°C for 2 h. Finally, blot signals were detected with ECL system (Thermo Fisher Scientific). Relative protein expression of TIMP3 over GAPDH was quantified using the ImageJ software (National Institutes of Health).

2.9. Statistical analysis

Statistical analysis was performed using SPSS Statistics 22.0. All results were shown as means ±standard deviation. The differences between two groups were assessed by Student's t‐test. One‐way analysis of variance, followed by Tukey's multiple comparisons test, was used to evaluate the differences among multiple groups. p < 0.05 indicated statistically significant.

3. RESULTS

3.1. Remifentanil reduced the viability of Hep3B, SK‐Hep‐1 and Huh7 cells

Firstly, we explored the influence of remifentanil on the viability of HCC cells. As illustrated in Figure 1, the viability of Hep3B and SK‐Hep‐1 cells was significantly reduced by remifentanil (2.5 and 3.75 μg/ml) at 24 h after remifentanil treatment (all p < 0.01). In contrast, the viability of Huh7 cells was markedly reduced by remifentanil (2.5 and 3.75 μg/ml) at 48 h after remifentanil treatment (all p < 0.01, Figure 1A). Therefore Hep3B and SK‐Hep‐1 cells and 3.75 μg/ml remifentanil were chosen in the following experiments.

FIGURE 1.

Remifentanil reduced the viability of Hep3B, SK‐Hep‐1 and Huh7 cells. ^* p <.05, ^** p < 0.01, vs. 0 μg/ml

3.2. Knockdown of lncRNA NBR2 enhanced the viability, migration and invasiveness of remifentanil‐treated Hep3B and SK‐Hep‐1 cells

To elucidate the role of lncRNA NBR2 in remifentanil‐treated Hep3B and SK‐Hep‐1 cells, lncRNA NBR2 expression was firstly determined. We found that relative expression of lncRNA NBR2 was higher in the remifentanil group than in the control group (all p < 0.01, Figure 2A). Then lncRNA NBR2 was silenced. As expected, the expression of lncRNA NBR2 was significantly reduced by transfection of sh‐NBR2 in Hep3B and SK‐Hep‐1 cells (all p < 0.01, Figure 2B). MTT assay indicated that knockdown of lncRNA NBR2 enhanced the viability of remifentanil‐induced Hep3B and SK‐Hep‐1 cells (all p < 0.01, Figure 2C). Additionally, wound healing and transwell assays showed that relative wound healing rate and relative invasion were promoted in the sh‐NBR2 group compared to the sh‐NC group (all p < 0.01, Figure 2D‐E).

FIGURE 2.

Knockdown of NBR2 enhanced the viability, migration and invasion of remifentanil‐treated HCC cells. A, Relative expression of NBR2 was determined by qRT‐PCR. ^** p < 0.01 vs. control. B, Expression of NBR2 was decreased after transfected with sh‐NBR2. ^** p < 0.01 vs. sh‐NC. (C‐E) Cell viability, migration and invasion of HCC cells was detected by MTT, wound healing and transwell assay respectively. ^** p < 0.01 vs. sh‐NC

3.3. LncRNA NBR2 targeted miR‐650

To investigate how lncRNA NBR2 exerted its role in HCC cells, the starbase v2.0 software was applied to search for its targeting miRNAs. As shown in Figure 3A binding sites for miR‐650 were identified in the 3’UTR of lncRNA NBR2. The DLR assay indicated that relative luciferase activity of Hep3B and SK‐Hep‐1 cells was notably decreased by co‐transfection of NBR2 wt and miR‐650 mimics, while it was not altered by co‐transfection of NBR2 mut and miR‐650 mimics (all p < 0.01, Figure 3B). After that, we explored whether lncRNA NBR2 could regulate miR‐650 expression, and found that the expression of miR‐650 was increased by NBR2 silencing, while was decreased by NBR2 overexpression (all p < 0.01, Figure 3D).

FIGURE 3.

NBR2 targeted miR‐650. (A) The binding sequence and (B) target relationship between NBR2 and miR‐650 was predicted by StarBase and DLR. ^**p < 0.01, vs. miR‐NC. (C) Relative expression of NBR2 and (D) miR‐650 in Hep3B and SK‐Hep‐1 cells was detected by qRT‐PCR. ^**p < 0.01 vs. sh‐NC. ^##p < 0.01 vs. pcDNA‐NC

3.4. Up‐regulation of miR‐650 facilitated cell viability migration and invasion of remifentanil‐treated Hep3B and SK‐Hep‐1 cells

Accordingly, we investigated the expression and role of miR‐650 in remifentanil‐treated Hep3B and SK‐Hep‐1 cells. As presented in Figure 4A, miR‐650 showed the lower expression in the remifentanil group than that in the control group in Hep3B and SK‐Hep‐1 cells (all p < 0.01). MiR‐650 expression was significantly increased after transfection of miR‐650 mimics (all p < 0.01, Figure 4B). Functionally, it was found that cell viability, migration and invasion were all enhanced by miR‐650 overexpression (all p < 0.01, Figure 4C‐E).

FIGURE 4.

Up‐regulation of miR‐650 promoted the viability, migration and invasion of HCC cells. (A) Relative expression of miR‐650 after remifentanil treatment and (B) miRNA transfection was determined by qRT‐PCR. (C‐E) Cell viability, migration and invasion were detected by MTT, wound healing and transwell assay respectively. ^** p < 0.01 vs. miR‐NC

3.5. TIMP3 was a target of miR‐650

To further explore the downstream mechanism of miR‐650 activity in HCC cells, we predicted its targets through PITA and miRmap and observed that TIMP3 contained the complementary sequences for the seed region of miR‐650 (Figure 5A). Meanwhile, the DLR assay indicated that miR‐650 overexpression reduced relative luciferase activity of TIMP3 wt, but it failed to change relative luciferase activity of TIMP3 mut in Hep3B and SK‐Hep‐1 cells (all p < 0.01, Figure 5B). Furthermore, we found that transfection of the miR‐650 inhibitor markedly reduced miR‐650 expression and elevated the TIMP3 protein level in both Hep3B and SK‐Hep‐1 cells (all p < 0.01, Figure 5C‐D).

FIGURE 5.

TIMP3 was a target of miR‐650. (A) The binding sequence and (B) interaction between TIMP3 and miR‐650 were predicted by PITA, miRmap and verified by DLR assay. ^**p < 0.01 vs. miR‐NC. (C) Relative expression of miR‐650 and (D) TIMP3 was detected by qRT‐PCR and Western blot respectively. ^**p < 0.01 vs. inhibitor NC

3.6. Silencing of lncRNA NBR2 promoted cell viability, migration and invasion of remifentanil‐treated Hep3B cells via sponging miR‐650 to regulate TIMP3 expression

Finally, we attempted to verify whether lncRNA NBR2 exerted it's function in remifentanil‐treated Hep3B cells via the miR‐650/TIMP3 axis. Firstly, the expression of TIMP3 was determined in remifentanil‐treated Hep3B cells, and we showed that TIMP3 was overexpressed in Hep3B cells under remifentanil treatment (p < 0.01, Figure 6A). As displayed in Figure 6B, TIMP3 was significantly boosted by transfection of pcDNA‐TIMP3 in Hep3B cells (p < 0.01). After that, rescue experiments were conducted. We demonstrated that down‐regulation of miR‐650 or up‐regulation of TIMP3 reversed the promoting effects of NBR2 silencing on cell viability, migration and invasion of remifentanil‐treated Hep3B cells (p < 0.05, Figure 6C‐E).

FIGURE 6.

Silencing of NBR2 promoted cell viability, migration and invasion of remifentanil‐treated Hep3B cells via miR‐650/TIMP3 axis. (A) Relative expression of TIMP3 after remifentanil treatment and (B) transfected with pcDNA‐TIMP3 was determined by qRT‐PCR. ^** p < 0.01 vs. control or pcDNA‐NC. (C‐E) Cell viability, migration and invasion were detected by MTT, wound healing and transwell assay respectively. ^** p < 0.01 vs. sh‐NC. ^# p < 0.05, ^## p < 0.01 vs. sh‐NBR2

4. DISCUSSION

HCC is one of the main causes of cancer‐associated deaths globally, posing a serious threat to public health. ³⁶ Recently there have been several published studies that have focused on the role(s) of opioid analgesics in anti‐tumour activity. ² , ³ , ⁴ Wu et al have suggested that sufentanil can facilitate cell apoptosis and reduce cell viability in gastric cancer in vitro. ² Qin et al found that morphine exerts similar functions in gastric cancer. ³ Notably remifentanil has been shown to induce apoptosis of glioma cells. ⁴ In the present study, we explored the effect of remifentanil on HCC cells and showed clearly that remifentanil reduced the viability of Hep3B and SK‐Hep‐1 cells, which suggested that remifentanil might exert an anticancer role in HCC as well.

Previously up‐regulation of multiple lncRNAs has been confirmed in HCC samples, including lncRNA MCM3AP‐AS1, ³⁷ lncRNA‐HEIH ³⁸ and lncRNA‐PDPK2P. ³⁹ Interestingly, we found that lncRNA NBR2 was highly expressed in remifentanil‐treated HCC cells in comparison with the control group, suggesting that lncRNA NBR2 was involved in the anticancer effect of remifentanil. Furthermore, there have been several reports showing that lncRNA NBR2 has a critical functional role in regulating progression of various cancers, including HCC. ¹⁸ , ¹⁹ , ²⁰ For example, lncRNA NBR2 is indicated to reduce migration, invasiveness and proliferation of osteosarcoma cells. ¹⁸ Down‐regulation of lncRNA NBR2 promotes the development of thyroid cancer by increasing cell invasiveness, wound healing and proliferation in vitro. ¹⁹ LncRNA NBR2 has been shown previously to reduce proliferative, invasive and migratory capabilities of HCC cells. ²⁰ IN this study, similar to previous research, we discovered that silencing of lncRNA NBR2 enhanced the viability, migration and invasiveness of remifentanil‐treated Hep3B and SK‐Hep‐1 cells. This indicates, an oncogenic effect of lncRNA NBR2 on remifentanil‐induced HCC cells. According to these results, we deduced that remifentanil might impede the progression of HCC mediated by lncRNA NBR2.

Given that lncRNAs generally fulfil their functions by interacting with miRNAs in cancers, ²¹ we searched for the downstream miRNAs of lncRNA NBR2. As our results indicated, lncRNA NBR2 could directly target miR‐650 with complementary sequences. Previous studies have shown that the progression and development of HCC is accompanied by different expression of miR‐650. ²⁵ , ²⁶ Han et al have suggested that miR‐650 is highly expressed in HCC tissues, and miR‐650 accelerates HCC progression through strengthening the migratory and invasive abilities of HCC cells. ²⁵ Qin et al observed an increased miR‐650 expression in HCC cells, whereas the suppressive impacts of Axin1 on cell proliferation, migration and invasion are abolished by miR‐650 in HCC cells. ²⁶ In the current study, we revealed that miR‐650 expression was decreased after treatment of remifentanil in Hep3B and SK‐Hep‐1 cells, and increased miR‐650 enhanced the viability, migratory and invasive abilities of remifentanil‐induced Hep3B and SK‐Hep‐1 cells. These results suggested that miR‐650 promoted HCC development in remifentanil‐induced HCC cells. For validating whether lncRNA NBR2 was involved in HCC progression by interacting with miR‐650 in remifentanil‐induced HCC cells, we explored the regulatory relation between lncRNA NBR2 and miR‐650 in a rescue assay. We discovered that miR‐650 was inversely regulated by lncRNA NBR2 in Hep3B and SK‐Hep‐1 cells, and transfection of the miR‐650 inhibitor reversed the promoting impact of lncRNA NBR2 knockdown on viability, invasion and migration of remifentanil‐induced Hep3B cells. Taken together, we deduced that knockdown of lncRNA NBR2 may interact with miR‐650 to facilitate HCC development in remifentanil‐induced HCC cells.

As previously mentioned, miR‐650 is implicated in pathological processes of varied cancers by regulating their target genes. For instance, miR‐650 can interact with serine‐threonine protein phosphatase 2 catalytic subunit alpha to display oncogenic activity. ⁴⁰ Inhibition of miR‐650 represses the proliferation, migration and invasion of human oral cancer by targeting growth factor independent 1 (GFI1). ⁴¹ Additionally, in HCC progression, miR‐650 is confirmed to target large tumour suppressor kinase 2 gene (LATS2) ²⁵ or inhibitor of growth protein 4 (ING4) ⁴² to promote the metastasis and epithelial‐mesenchymal transition of HCC, and therefore, miR‐650‐LATS2/ING4 pathways may serve as a novel prognostic biomarker in HCC. We speculated that miR‐650 may act as an oncogenic factor and can interact with different downstream targets to affect HCC tumorigenesis. As expected, TIMP3 was also identified as a target of miR‐650 in this study. TIMP3, a member of the tissue inhibitor of metalloproteinases (TIMP) family, is demonstrated to be to be expressed at a low level in HCC tissues. ³⁵ Here we observed that TIMP3 expression was boosted after remifentanil treatment in Hep3B cells, which suggested the potential role of TIMP3 in remifentanil‐induced HCC cells. Besides, growing evidence has revealed the key role of TIMP3 in HCC progression. ³³ , ³⁵ For example, TIMP3 represses proliferation, migration and invasion of HCC cells. ³⁵ The impact of miR‐21 inhibition on proliferation and apoptosis of curcumin‐induced HCC cells is attenuated by TIMP3 knockdown. ³³ Meantime, we observed an inverse regulation between the expression of TIMP3 and miR‐650 in Hep3B and SK‐Hep‐1 cells. Based on the above findings, we speculated that miR‐650 functioned as a tumour‐promoting miRNA by targeting TIMP3 in remifentanil‐induced HCC cells. More importantly, we found that TIMP3 overexpression reversed lncRNA NBR2 knockdown‐caused enhancement of cell viability, migration and invasiveness in remifentanil‐induced Hep3B cells. Altogether, we concluded that silencing of lncRNA NBR2 affects HCC development by regulating the miR‐650/TIMP3 axis in remifentanil‐treated Hep3B cells.

In summary, this study demonstrated that remifentanil reduced the viability of HCC cells, suggesting that remifentanil may be a promising agent for HCC therapy. Additionally, we indicated that lncRNA NBR2 acted as a sponge of miR‐650, while miR‐650 further targeted TIMP3. Silencing of lncRNA NBR2 enhanced cell viability and the ability to migrate and invade by sponging miR‐650 to regulate TIMP3 in remifentanil‐treated HCC cell. However, we failed to confirm the role of remifentanil, and the lncRNA NBR2/miR‐650/TIMP3 axis in in vivo experiments. Hence, more investigation is essential in the future.

CONFLICT OF INTEREST

The authors declare that they have no conflict interests.

Liang W, Ke J. Remifentanil reduces the proliferation, migration and invasion of HCC cells via lncRNA NBR2/miR‐650/TIMP3 axis. Int J Exp Path. 2022;103:44–53. doi: 10.1111/iep.12429