KEY RESOURCES TABLE.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
|
| ||
| Antibodies | ||
|
| ||
| CD4 (RM4–5) | BD Biosciences | Cat# 563726, 563151, 563106; RRID:AB_2738389, AB_2687549, AB_2687550 |
| CD4 (RM4–5) | Biolegend | Cat# 100532, 100536; RRID:AB_493373, AB_493701 |
| CD44 (IM7) | Biolegend | Cat# 103057; RRID:AB_2564214 |
| CD44 (IM7) | eBioscience | Cat# 47–0441-82; RRID:AB_1272244 |
| CD11c (HL3) | BD Biosciences | Cat# 553802; RRID:AB_395061 |
| CD11c (N418) | Biolegend | Cat# 117314, 117329; RRID:AB_492850, AB_10897814 |
| GL-7 (GL-7) | BD Biosciences | Cat# 553666; RRID:AB_394981 |
| GL-7 (GL-7) | eBioscience | Cat# 50–5902-82; RRID:AB_2574252 |
| CD95 (Jo2) | BD Biosciences | Cat# 557653; RRID:AB_396768 |
| CD23 (B3B4) | Biolegend | Cat# 101619; RRID:AB_2563438 |
| CD38 (T10) | Biolegend | Cat# 102717; RRID:AB_2072892 |
| CD138 (281–2) | Biolegend | Cat# 142504; RRID:AB_10916119 |
| B220 (RA3–6B2) | BD Biosciences | Cat# 561878, 553093, 561102, 561880, 558108; RRID:AB_10893353, AB_394622, AB_10561687, AB_10897020, AB_397031 |
| B220 (RA3–6B2) | Biolegend | Cat# 103254; RRID:AB_2563229 |
| CD19 (6D5) | Biolegend | Cat# 115524, 115519; RRID:AB_493339, AB_313654 |
| IgD (11–26c.2a) | Biolegend | Cat# 405727, 405729; RRID:AB_2562887, AB_2563340 |
| CXCR5 (2G8) | BD Biosciences | Cat# 551959; RRID:AB_394300 |
| CXCR5 (L138D7) | Biolegend | Cat# 145513; RRID:AB_2562208 |
| PD-1 (RMP1–30) | Biolegend | Cat# 109117, 109109; RRID:AB_2566549, AB_572016 |
| PD-1 (J43) | eBioscience | Cat# 25–9985-82; RRID:AB_10853805 |
| Thy1.1 (OX-7) | Biolegend | Cat# 202526; RRID:AB_1595470 |
| PSGL-1 (2PH1) | BD Biosciences | Cat# 562807, 563448; RRID:AB_2737808, AB_2738211 |
| Tbet (eBio4B10) | eBioscience | Cat# 50–5825-82; RRID:AB_10596655 |
| Tbet (4B10) | Biolegend | Cat# 644815; RRID:AB_10896427 |
| Ki67 (16A8) | Biolegend | Cat# 652417, 652419; RRID:AB_2564236, AB_2564284 |
| CD45.1 (A20) | Biolegend | Cat# 110741; RRID:AB_2563378 |
| CD45.2 (104) | Biolegend | Cat# 109831, 109823; RRID:AB_10900256, AB_830788 |
| Ly6C (HK1.4) | Biolegend | Cat# 128021; RRID:AB_10640820 |
| CD21/35 (7G6) | BD Biosciences | Cat# 553818; RRID:AB_395070 |
| Pdca-1 (927) | Biolegend | Cat# 127014; RRID:AB_1953289 |
| CXCR3 (CXCR3–173) | Biolegend | Cat# 126511; RRID:AB_1088994 |
| Ephrin B1 (polyclonal) | R&D Systems | Cat# BAF473, AF473; RRID:AB_2293418, AB_2293419 |
| APC-Cy7 Streptavidin | Biolegend | 405208 |
| Alexa Fluor 647 Streptavidin | Thermo Fisher | S21374 |
| Alexa Fluor 594 anti-Goat IgG (H+L) | Thermo Fisher | Cat# A-11058; RRID:AB_2534105 |
| APC Streptavidin | Prozyme | PJ27S |
| PE Streptavidin | Prozyme | PJRS25 |
| Peanut Agglutinin (PNA) Cy3 | Vector Labs | CL-1073–1 |
| F4/80 (BM8) | Thermo Fisher | Cat# 53–4801-82; RRID:AB_469915 |
| MadCam1 (MECA-367) | Biolegend | Cat# 120705; RRID:AB_493396 |
| InVivoMAb anti-mouse LFA-1α | Bio X Cell | Cat# BE0006; RRID:AB_1107578 |
| InVivoMAb anti-mouse/human VLA-4 | Bio X Cell | Cat# BE0071; RRID:AB_1107657 |
|
| ||
| Bacterial and virus strains | ||
|
| ||
| LCMV-Armstrong | N/A | N/A |
| Influenza A/Puerto Rico/8/1934 H1N1 (PR8) | Laboratory of A. Iwasaki, Yale University | N/A |
|
| ||
| Chemicals, peptides, and recombinant proteins | ||
|
| ||
| TO-PRO-1 Iodide | Thermo Fisher | T3602 |
| Recombinant PR8 hemagglutinin (HA) | Laboratory of Davide Angeletti, University of Gothenburg |
Angeletti et al., 2017 |
| TY 52156 | Sigma | 5330620001 |
| FTY720 | MilliporeSigma | 344597 |
| Sphingosine-1-Phosphate | Avanti Polar Lipids | 860492 |
| Tamoxifen | Sigma–Aldrich | T5648 |
| TAM diet (irradiated) | Envigo | TD.130859 |
| Corn Oil | Sigma–Aldrich | C8267 |
| Diphtheria toxin | Sigma–Aldrich | D0564 |
| BrdU | Sigma–Aldrich | B5002 |
| R848 | Invivogen | tlrl-r848 |
|
| ||
| Critical commercial assays | ||
|
| ||
| Foxp3/Transcription Factor Staining kit | eBioscience | 00–5523-00 |
| EasySep™ Mouse CD4+ T Cell Isolation Kit | StemCell | 19852 |
| RNeasy Micro Kit | Qiagen | 74004 |
| NEBNext AbSeq immune sequencing kit | New England Biolabs | |
|
| ||
| Deposited data | ||
|
| ||
| RNA-seq of B cell subsets | This paper | GSE150124 |
| RNA-seq of Tbet+CD11c+ B cell kinetics | This paper | GSE150139 |
| Ig-seq of B cell subsets | This paper | GSE192765 |
|
| ||
| Experimental models: Organisms/strains | ||
|
| ||
| Mouse: C57BL/6 | Charles River | N/A |
| Mouse: Icos−/− | Jackson Laboratories | 004859 |
| Mouse: Sh2d1a−/− | Jackson Laboratories | 025754 |
| Mouse: Tcrb−/− | Jackson Laboratories | 002118 |
| Mouse: CD11c-DTR/GFP | Jackson Laboratories | 004509 |
| Mouse: Tbet-AmCyan | Jinfang Zhu (National Institutes of Health) | Yu et al., 2015 |
| Mouse: S1PR2CreERT2 Rosa26Lox-Stop-Lox-tdTomato |
Takaharu Okada (RIKEN) | Shinnakasu et al., 2016 |
|
| ||
| Oligonucleotides | ||
|
| ||
| Hprt qPCR primers | Keck Oligo Synthesis Resource | (F) CTGGTGAAAAGGACCTCTCG (R) TGAAGTACTCATTATAGTCAAGGGCA |
| Gfp qPCR primers | Keck Oligo Synthesis Resource | (F) AAGCTGACCCTGAAGTTCATCTGC (R) CTTGTAGTTGCCGTCGTCCTTGAA |
| Itgax qPCR primers | Keck Oligo Synthesis Resource | (F) TGCCAGGATGACCTTAGTGTCG (R) CAGAGTGACTGTGGTTCCGTAG |
|
| ||
| Software and algorithms | ||
|
| ||
| Huygen’s Essential | Scientific Volume Imaging | N/A |
| Imaris | Bitplane Scientific Software | N/A |
| Flowjo | TreeStar FlowJo LLC. | N/A |
| GraphPad Prism | GraphPad Software | N/A |
| Spatstat | Baddeley and Turner, 2005 | N/A |
| pRESTO | Vander Heiden et al., 2014 | N/A |
| Immcantation | Gupta et al., 2015 | N/A |