Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2022 Feb 25;101(5):101809. doi: 10.1016/j.psj.2022.101809

Effects of stocking density on ovarian development and maturation during the rearing period in Shan-ma ducks

Dan-li Jiang *,†, Xiao-li Zhou *,†,1, Yang-long Xu *,†, Sui Liufu *,†, Xin-liang Fu *,†, Dan-ning Xu *,†, Yun-bo Tian *,†, Xu Shen ⁎,†, Yun-mao Huang ⁎,†,2
PMCID: PMC8968648  PMID: 35358924

Abstract

Stocking density critically affects the growth and subsequent performance of animals in modern poultry production. This study investigated the effects of stocking density on ovarian development, ovarian maturation, and the mRNA expression of key genes in the reproductive axis during the rearing period of Shan-ma ducks. The experiments involved 180 healthy 7-wk-old Shan-ma ducks and randomly divided into low stocking density (LSD; n = 30, density = 5 birds/m2), medium stocking density (MSD; n = 60, density = 10 birds/m2) and high stocking density groups (HSD; n = 90, density = 15 birds/m2), for rearing. After examining ovarian development and measuring hormone levels in the plasma and expression levels of key regulatory genes in the reproductive axis at 19 wk of rearing, analysis of the gonad index analysis, reflecting stocking density, uncovered statistically significant differences. The gonad index of the LSD group was significantly higher than those of the MSD and HSD groups (P < 0.01), while no significant difference was observed between the MSD and HSD groups. pre-ovulatory follicles (POFs) and small yellow follicles (SYFs) development was only apparent in the LSD group, with the large white follicles (LWFs) number of this group being significantly higher than that of the MSD group (P < 0.05). The blood levels of E2 (estradiol), P4 (progesterone), and T (testosterone) were significantly higher in the LSD group than in the MSD and HSD groups (P < 0.05 or 0.01). Also, the levels of both P4 and T were significantly higher in the MSD group than in the HSD group (P < 0.01). The gene expression levels of GnRHR, FSH, AMHR, and FSHR were significantly increased in the LSD group compared to the MSD and HSD groups (P < 0.05 or 0.01), while the expression levels of GnIHR and GDF9 were significantly decreased in the LSD and MSD groups compared to the HSD group (P < 0.05 or 0.01). Steroid biosynthesis pathway genes such as StAR, CYP11A1, 3β-HSD, CYP19A1, and BMP15 were significantly downregulated at greater stocking densities (P < 0.05 or 0.01). Likewise, the protein expression of StAR, 3β-HSD, and CYP19A1 was also significantly decreased (P < 0.05 or 0.01). These results demonstrate that both medium and high stocking densities suppressed the expression of the key reproduction-promoting factors, while the expression level of the key reproductive inhibitory factors was enhanced. Therefore, rates of ovarian development and maturation could be reduced by a high stocking density leading to a delay in reproduction performance during the rearing period of Shan-ma ducks.

Key words: stocking density, growing period, ovarian development, reproductive axis

INTRODUCTION

The egg-laying traits of poultry are mainly affected by the genetics, nutrition, and development of the ovaries. Well-developed ovaries ensure the high egg-laying performance of the poultry. In modern poultry production, stocking density has a major impact on ovarian development and egg production (Cai et al., 2019; Li et al., 2019). Rearing poultry at high stocking densities reduces sex hormone levels, retards ovarian development, and causes follicular atresia, resulting in poor laying performance (Rosenfeld et al., 2001; Miller and Auchus, 2011; Luo et al., 2016; Hou et al., 2018; Krause and Schrader, 2019). Presently, the poultry breeding industry is somewhat focused on the influence of the environment on egg production. Stocking density is an important environmental factor for the layer hen (Krause and Schrader, 2019). However, no standard regulations of stocking density have yet been established for the Shan-ma duck in China. A high stocking density is often selected to achieve high production efficiency. However, high stocking densities affect health status, immunity, and oxidation resistance, particularly influencing the reproductive development and laying performance of the ducks (El-Tarabany, 2016; Weimer et al., 2019).

Currently, most studies about the effects of stocking density on gonad development mainly focus on the laying stage; few focus on the rearing period (Geng et al., 2020; Pu et al., 2021). During the growth and development of the poultry ovary and follicle, multiple genes regulate various physiological processes such as the expression of the gonadotropin receptors, steroid biosynthesis, and cell proliferation (Liu and Zhang, 2008). The present study investigated the influences of different stocking densities on ovarian development, hormone levels in the plasma, and key regulatory factors in the reproductive axis of Shan-ma ducks during the growing period. This study reveals the implication of stocking density on ovarian development and maturation during the rearing period of Shan-ma ducks – information that could guide poultry production.

MATERIALS AND METHODS

Ethics Statement

This study was conducted in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of Zhongkai University of Agriculture and Engineering (NO.2020071109). The protocol was approved by the Committee on the Ethics and Welfare of Animal Experiments of Zhongkai University of Agriculture and Engineering. All efforts were made to minimize suffering of the animals.

Animals and Experimental Design

This study selected a total of 180 seven-wk-old Shan-ma ducks randomly placed into the low stocking density (LSD; n = 30), medium stocking density (MSD; n = 60), and high stocking density groups (HSD; n = 90). The ducks were reared semi-openly on land and water, with a shed: ground: pool area ratio of 6: 6: 3 m2. The stocking densities for the LSD, MSD, and HSD groups were 5, 10, and 15 birds/m2, corresponding to 30, 60, and 90 ducks. Each group of ducks was further subdivided equally into 3 repeats. Three duck pens with the same feeding conditions and of the same size were used. The duck pens were built with concrete floors and movable metal enclosures for the poultry. The distribution of each pen was consistent, including duck sheds (3 × 2 m; 6 m2), sports grounds (3 × 2 m; 6 m2), and pools (3 × 1 m; 3 m2). The indoor temperature was 25 ± 3°C and the relative humidity was 75 to 85%. Natural ventilation was adopted in the shed. Natural light was used during the day while incandescent bulbs were used to control lighting at night. Energy-saving lamps were placed 2 m above the ground, generating an average light intensity of 30 lux. In the first week of the experiment, the light controller was set for 10 h illumination, and the illumination was extended for 1 h every other week until the illumination stabilized at 17 h. During the experiment, ducks were fed in accordance with the standard production diet for such poultry. All ducks were managed as per a standardized feeding schedule for 12 wk. Dietary composition and nutrient levels are in accordance with the laboratory's original feeding standards (Wang et al., 2021). The number of feeding troughs and drinking water tanks in each group was controlled to ensure that the feeding level and drinking water area was the same for all ducks.

Sample Collection

Six Shan-ma ducks (n = 6) were randomly selected from each group and weighed at the end of the experiment (19 wk) to determine ovarian development and calculate the gonadosomatic index (ovarian weight/body weight*100%). All follicle types were counted, that is, pre-ovulatory follicles (POFs, ⌀ > 8 mm), small yellow follicles (SYFs, ⌀ = 6–8 mm), and large white follicles (LWFs, ⌀ = 3–6 mm). The hypothalamus, hypophysis, and ovarian tissues (after removal of surface follicles >3 mm in diameter) were collected, flash-frozen in liquid nitrogen and stored at −80°C. Blood samples were also taken.

Measurement of the Serum Hormone

Blood was collected from the wing vein. After standing at room temperature for 2 h, the serum samples were obtained by centrifuging at 4,000 r/min for 10 min and the serum was stored at −20°C. The E2 (estradiol), P4 (progesterone), and T (testosterone) hormones were measured according to the instructions of the ELISA kits, E2 ELISA kit was purchased from CUSABIO (Shanghai, China), P4 and T ELISA kits were purchased from Elabscience (Shanghai, China) Co., Ltd.

RNA Extraction and qRT-PCR Analysis

Total RNA was extracted by Trizol (Thermo Fisher, Carlsbad, CA) and reverse transcribed using the ReverTra Ace qPCR RT kit (Toyobo, Japan). The synthesized cDNA was stored at −20°C. The relative expression of the genes GnRH and GnIH in the hypothalamus, GnRHR, GnIHR, and FSHR in the hypophysis, and FSHR, LHR, StAR, CYP11A1, 3β-HSD, CYP19A1, AMH, AMHRII, GDF9, and BMP15 in the ovary were quantified. The primers for the quantitative real-time PCR (RT-qPCR) were designed using the mRNA sequences of the related genes in ducks (Table 1) and then synthesized by Sangon Biotech (Shanghai, China) Co., Ltd. A 20-μL reaction volume was prepared according to the instructions of the manufacturer of the SYBR Green PCR Master Mix (Thermo Fisher) for real-time fluorescence quantification using the cDNA as templates. The reaction system comprised 10 μL of SYBR Green PCR Master Mix, upstream and downstream primers (0.5 μL each), ddH2O (8 μL), and cDNA (1 μL). The PCR procedure comprised pre-denaturation at 50°C for 2 min and then at 95°C for 10 min, all for one cycle; 95°C for 15 s and then the annealing temperature for 1 min, all for 40 cycles. Three replicates were undertaken for each sample.

Table 1.

Primers for real-time quantitative PCR.

Genes Primer sequence (5’-3’) The length of the product (bp)
β-Actin1 F: CCTCTTCCAGCCATCTTTCTT 109
R:TGTTGGCATACAGGTCCTTAC
GAPDH F: GCTGATGCTCCCATGTTCGTGAT 85
GTGGTGCAAGAGGCATTGCTGAC
GnRH F: CTGGGACCCTTGCTGTTTTG 209
R:AGGGGACTTCCAACCATCAC
GnIH F: AAAGTGCCAAATTCAGTTGCT 128
R:GCTCTCTCCAAAAGCTCTTCC
GnRHR F: TCTGCTGGACCCCCTACTAC 127
R:TCCAGGCAGGCATTGAAGAG
GnIHR F: TGGCCCTCATCGTTGTCA 116
R:CTTCCTGCGAGACACCTT
FSH F: GTGGTGCTCAGGATACTGCTTCA 209
R:GTGCAGTTCAGTGCTATCAGTGTCA
FSHR F: AGCACCTTCCAAGCCTTAGA 209
R:TGACCATGGAAGGCAGATGT
LHR F: GTAACACTGGAATAAGGGAAT 191
R:GAAGGCATGACTGTGGATA
StAR F: CTGCCCATCTCCTACCGCCCAC 263
R:CTGCTCCACCACCACCTCCA
CYP11A1 F: ACAGGGAGAAGTTGGGTGTC 145
R:GTAGGGCTTGTTGCGGTAGT
3β-HSD F: AGAAGTGACAGGCCCAAACT 187
R:ACATGGATCTCAGGGCACAA
CYP19A1 F: GGATGGGAGTAGGTAATGCC 273
R:ACAAGACCAGGACCAGACAG
AMH F: GACCCTGGCCATCAGACATC 108
R:GGTGTCATCCTGGTGAAGCA
AMHRⅡ F: CTTCCTGTGCGACACCATCA 111
R:ACGATGTCTCTCATGGTGTC
GDF9 F: ATCTGTTCCCAAGCCCTCT 141
R:GGATTCACCCACTACCGAC
BMP15 F: TCCTCTTCCTCAATGACACTC 133
R:AGGGAGCAGTCGCTTTTATC
Open in a new tab

Western Blot Analysis

The total proteins of the ovarian tissues were crushed in liquid nitrogen, dissolved in lysis buffer (Biyotime Biotechnology, China), sonicated, and centrifuged at 4°C for 20 min at 12,000 rpm, and the protein concentrations were quantified by the bicinchoninic acid (BCA) method (Thermo Fisher). After denaturing using sodium dodecyl sulfate (SDS), the proteins were loaded on 10% SDS-PAGE gels (Epizyme Biomedical Technology, China), and the upper gel was electrophoresed at 80 V for 20 min and the lower gel at 120 V for 60 min. The proteins after electrophoresis were transferred to the PVDF membranes at 200 mA for 60 min and the membranes were then blocked in 5% skimmed milk for 1 h at room temperature. The membranes were then incubated with the primary antibody at 4°C overnight. The primary antibodies used were rabbit polyclonal StAR (Affinity Biosciences, China), 3β-HSD (Affinity Biosciences, China), CYP19A1 (Abcam, UK), and mouse monoclonal β-actin (Affinity Biosciences). Subsequently, the rinsed membranes were incubated with the secondary antibody at room temperature for 1 h and rinsed 5 times with TBST for 3 min each. The secondary antibodies were goat anti-mouse IgG (H+L) HRP (Affinity Biosciences) and goat anti-rabbit IgG (H+L) HRP (Affinity Biosciences). The chemiluminescence images of the membranes were captured using a chemical luminescence immunity analyzer (Tanon, China) after incubation with an ECL kit. The western blot protein bands were analyzed in grayscale using the Image J software (https://imagej.en.softonic.com/).

Statistics and Data Analysis

The RT-qPCR results were analyzed using the 2−△△CT method (Livak and Schmittgen, 2001). All the experimental data were analyzed by one-way ANOVA using the SPSS 19.0 software (SPSS Inc, Chicago, IL), and significant differences between the stocking density groups were tested for with the LSD multiple comparison method. The results were presented as the mean ± SEM, with P < 0.05 and P < 0.01 indicating significant differences, and P > 0.05 indicating no significant differences.

RESULTS

The Effects of Stocking Density on Ovary Development

Stocking density plays a pivotal role in ovarian follicular development in the Shan-ma duck. The ovaries of the LSD group were fully developed, with numerous developing follicles and dominant follicles, while only small white follicles were observed in the MSD group and no follicle development was apparent in the HSD group (Figure 1). The gonad index was calculated and the number of follicles at different stages in the ovaries was counted (Table 2). The gonad index decreased gradually with increasing stocking density, where the gonad index of the LSD group was significantly higher than those of the MSD and HSD groups (P < 0.01), while there was no significant difference between the latter 2 groups. POFs and SYFs were formed only in the LSD group, and the number of LWFs was significantly higher in the LSD group than in the MSD group (P < 0.01).

Figure 1.

Figure 1

Open in a new tab

Stocking density affected ovarian development in the Shan-ma duck. (LSD) Ovary morphology in low stocking density group, (MSD) ovary morphology in medium stocking density group, (HSD) ovary morphology in high stocking density group. The LSD group were fully developed and mature for egg production, while the ovaries of the ducks of the MSD group only formed large white follicles, and there was no obvious ovarian development in the ducks of the HSD group.

Table 2.

Effects of stocking densities on the ovarian index and follicular development of ducks.

Indicators LSD MSD HSD
GSI% 3.94 ± 0.37a 0.25 ± 0.06c 0.19 ± 0.04c
POF 8.00 ± 0.50a 0c 0c
SYF 2.40 ± 0.22a 0c 0c
LWF 23.00 ± 1.35a 2.16 ± 1.25c 0c
Open in a new tab

Note: Data are presented as the mean ± SEM, n = 6.

Abbreviations: HSD, high stocking density group; LSD, low stocking density group; MSD, medium stocking density group.

ac

Adjacent letters indicate significant differences (P < 0.05) and interphase letters indicate extremely significant differences (P < 0.01).

Influence of Stocking Density on Reproductive Hormone Levels

As shown in Figure 2, the serum levels of P4 and T were significantly higher in the LSD group than in the MSD and HSD groups (P < 0.01). Also, the serum levels of P4 and T in the MSD group were significantly higher than in the HSD group (P < 0.01). The serum level of E2 was significantly higher in the LSD group than in the MSD (P < 0.01) and the HSD groups (P < 0.05), while there was no significant difference between MSD group and HSD group.

Figure 2.

Figure 2

Open in a new tab

Stocking density effect on serum reproductive hormone levels. (LSD) Serum reproductive hormone levels in low stocking density group, (MSD) serum reproductive hormone levels in medium stocking density group, (HSD) serum reproductive hormone levels in high stocking density group. Data are presented as the mean ± SEM, n = 6. Adjacent letters indicate significant differences (P < 0.05) and interphase letters indicate extremely significant differences (P < 0.01).

The Effects of Stocking Density on Gene Expression of Key Reproduction Regulatory Factors

The expression levels of the key regulatory factors in the reproductive axis are illustrated in Figure 3. As observed, the expression levels of GnRH, GnRHR, and FSH in the hypothalamus-pituitary axis gradually declined as stocking density increased. In the hypothalamus and pituitary, the expression levels of GnRHR were significantly higher in the LSD group than in the HSD and MSD groups (P < 0.01), and the expression levels of FSH were significantly higher in the LSD than in the HSD group (P < 0.01). Similarly, the expression levels of GnIH and GnIHR gradually increased, with the expression levels of GnIHR being significantly lower in the LSD group than in the HSD group (P < 0.05). At the gonad level, the expression of AMH, AMHRII, FSHR, and LHR decreased with increasing stocking density, and the expression levels of AMHRII and FSHR were significantly higher in the LSD group than in the MSD and HSD groups (P < 0.05). The increase in the stocking density increased the expression levels of GDF9 in the ovaries, and the GDF9 level was significantly lower in the LSD group than in the MSD and HSD groups (P < 0.01), with the GDF9 expression being significantly higher in the HSD group than in the MSD group (P < 0.01).

Figure 3.

Figure 3

Open in a new tab

Effects of different stocking densities on reproductive axis gene expression. (A) Relative mRNA expression of GnRH and GnIH in hypothalamus; relative mRNA expression of GnRHR, GnIHR, and FSH in the pituitary. (B) Relative mRNA expression of FSHR, LHR, AMH, AMHRII, GDF9, and BMP15 in ovarian tissue. Data are presented as the mean ± SEM, n = 6. Adjacent letters indicate significant differences (P < 0.05) and interphase letters indicate extremely significant differences (P < 0.01).

The Effects of Stocking Density on the Steroid Biosynthesis Pathway

The key genes and expressions of proteins involved in the steroid biosynthesis pathway in the ovarian tissues were characterized and determined in Figure 4, Figure 5. The expression levels of CYP19A1, CYP11A1, 3β-HSD, and StAR decreased with the increase in stocking density. The expression levels of CYP19A1, CYP11A1, 3β-HSD, and BMP15 in the LSD group were significantly higher than those in the HSD group (P < 0.05 or 0.01). The expression of the proteins CYP19A1, 3β-HSD, and StAR were consistent with the expression levels of the corresponding genes and decreased with the increase in stocking density. The protein expression was significantly higher in the LSD group than in the MSD and HSD groups (P < 0.05 or 0.01).

Figure 4.

Figure 4

Open in a new tab

Effects of stocking densities on the expression of genes related to ovarian steroid biosynthesis. Relative mRNA expression of CYP19A1, CYP11A1, 3β-HSD, and StAR in ovarian tissue. Data are presented as the mean ± SEM, n = 6. Adjacent letters indicate significant differences (P < 0.05) and interphase letters indicate extremely significant differences (P < 0.01).

Figure 5.

Figure 5

Open in a new tab

Effects of stocking densities on protein levels of the ovarian steroid biosynthesis pathway. The protein expression levels of CYP19A1, 3β-HSD, and StAR in ovarian tissue. Data are presented as the mean ± SEM, n = 6. Adjacent letters indicate significant differences (P < 0.05) and interphase letters indicate extremely significant differences (P < 0.01).

DISCUSSION

The reproductive activity of poultry is closely related to the development of the reproductive system during the rearing period and to the farm management during the egg-laying period (Shi et al., 2020). Previous studies have found that in poultry rearing, stocking density affects the development of the reproductive system during the brooding period and egg production during the laying period (Lewis et al., 1997). The subsequent ovarian development and egg production of poultry is directly affected by the development of the oviducts, ovaries, stroma, and follicles during the rearing period (Renema et al., 1999; Cui et al., 2019). High stocking densities decrease the level of sex hormones, retarding ovarian development and resulting in follicular atresia and rapid decline in egg-laying performance (Hou et al., 2018). Increasing the stocking density could lead to a decrease in egg production and weight of the quails (Soares et al., 2018). In the present study, the increase in stocking density was found to significantly decrease the ovary weights and gonad index. The ovaries of the LSD group were fully developed and exhibited a high number of POFs, SYFs, and LWFs. In contrast, the ovaries of the MSD group only formed a few LWFs, with no follicular development in the HSD group. Our results indicate that stocking density significantly affected the ovarian development of the egg-laying ducks during the growing period. Both the gonad index and degree of ovarian development of the egg-laying ducks significantly decreased with increasing stocking density, and the ovarian development and maturity were retarded in the medium and high stocking densities.

The ovarian and follicular development of poultry is mainly under the regulation of the reproductive axis (Long et al., 2017; Hanlon et al., 2021). The serum levels of the reproductive hormones of the different groups were detected and the results indicate that increasing the stocking density decreased the blood levels of E2, P4, and T, which were significantly higher in the LSD group than in the MSD and HSD groups. Variations in the levels of the reproductive hormones in the blood were consistent with the follicular development in those groups, indicating that the increase in the stocking density regulates ovarian development by affecting the reproductive endocrine system (Zakaria et al., 1983; Baarends et al., 1995; Cai et al., 2015). The expression levels of the key regulatory factors in the reproductive axis were investigated. The gene expression levels of the main reproductive regulatory factors of the reproductive axis were further assessed, and it was found that the gene expression levels of GnRH, GnRHR, and FSH decreased, while the gene expression levels of GnIH increased. These results suggested that increased stocking density can significantly inhibit the activity of the reproductive axis and delay gonad development. Our results were consistent with the findings from previous reports (Maddineni et al., 2008).

FSH and LH secreted by the pituitary regulate the follicular development and synthesis of the steroid hormones by binding to the FSHR and LHR at the gonad level (Johnson and Woods, 2009; Liu et al., 2021). AMH is mainly secreted by ovarian granulosa cells and plays an important role in inhibiting the growth of the primary follicles in the ovary, as well as the follicular recruitment and sensitivity to FSH (Durlinger et al., 2001). The expression levels of AMH and AMHR have been demonstrated to gradually decrease with the development of the follicles (Johnson et al., 2008). AMH and AMHR expression in quails were found to significantly decrease because light was found to promote reproductive activity. On the contrary, the AMH and AMHR expression was found to significantly increase since short light periods inhibit testes development (Otake and Park, 2016). Exogenous administering of AMH was found to inhibit follicular development and egg production in hens, while active immunization with AMH was found to promote the expression of FSHR and LHR, steroid production, and follicular development in geese (Chen et al., 2020). The present study reported a significant decrease in the expression levels of FSHR and LHR with increasing stocking density. The FSHR expression level was significantly higher in the LSD group than in the MSD and HSD groups, which was consistent with the results of relevant studies. There was a declining trend in AMH and AMHR expression as the stocking density increased, which was inconsistent with previous reports. This may be due to the fact that only the rearing period of egg-laying ducks was observed in the present study and not the egg-laying period. Actually, AMH is mainly synthesized and secreted by follicular granulosa cells and is directly related to the degree of ovarian development (Chen et al., 2020). In beef heifers, circulating AMH concentrations were approximately 6- and 2-fold greater in animals with high (25 follicles 3 mm in diameter) or intermediate (16–24 follicles) compared with a low (15 follicles) antral follicle count during follicular waves (Ireland et al., 2008; Mossa et al., 2017). AMH secretion increased in the LSD group due to adequate ovarian development and more follicles (3 mm in diameter), while AMH secretion decreased significantly in the MSD and HSD groups due to insufficient ovarian development and fewer granulosa cells. This provides mechanisms explaining why increased stocking density leads to retarded ovarian development.

BMP15 and GDF9 are important intraovarian regulatory factors of the transfer growth factor-β (TGF-β) superfamily secreted by the oocyte. They are structurally homologous and functionally similar (Belli and Shimasaki, 2018). BMP15 regulates follicular development and steroidogenesis either as a homodimer or as a heterodimer (Elis et al., 2007). In the current study, the expression level of BMP15 gradually decreased with increasing stocking density; BMP15 was significantly lower in the HSD group than in the LSD and MSD groups. The expression level of GDF9 tended to increase with increasing stocking density, possibly due to the differences between BMP15 and GDF9 in influencing early embryonic development (Spicer et al., 2008). BMP15 stimulates the granulosa cells and prompts follicular cell development by enhancing proliferation and inhibiting apoptosis of the granulosa cells. Therefore, BMP15 expression in the LSD group significantly increased with follicular development, whereas BMP15 expression was significantly decreased in the MSD and HSD groups due to the delayed ovarian development. GDF9 promotes the development of the original follicles into secondary follicles, particularly in the early stages of follicular development in response to the reproductive hormones. In this study, the ovarian development was delayed in both the MSD and HSD groups compared to the LSD group, where the HSD group was the slowest – the follicles were at the initial stage of development. Therefore, the GDF9 expression level was found to decrease gradually with the decrease in stocking density and the gradual acceleration in ovarian development. However, many questions about the mechanism by which BMP15/GDF9 regulates follicular development await resolution. BMP15/GDF9 affects the ovulation rate in sheep, promoting ovulation in heterozygotes and causing sterility in homozygotes, and the interspecific differences in the ovulation rate were closely related to the BMP15/GDF9 ratio (Crawford and Mcnatty, 2012). BMP15/GDF9 ratio could promote the expansion of the cumulus oophorus and the related gene expression by generating the SMAD2/3 signals via ALK4/5/7 and BMPR2 (Peng et al., 2013).

Additionally, the gene and protein expression levels of the steroid hormone biosynthesis pathway factors, like CYP19A1, CYP11A1, 3β-HSD, and StAR, were investigated. The results of the expression were consistent with the ovarian development and expression levels of the key regulatory factors in the reproductive axis, both of which gradually decreased with the increase in the stocking density. The results further revealed that the stocking density directly influences ovarian development by affecting the reproductive axis, thus affecting the ovarian function, follicular development, and maturity of the egg-laying ducks during the growing period.

CONCLUSIONS

The present study indicated that both medium and high stocking densities may play a key role in inhibiting the expression of reproductive-promoting genes and inducing the expression of reproductive-suppressing genes, which can delay ovarian development and maturation of the Shan-ma duck.

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundation of China (32072730), Major Fundamental Research Project of Educational Department of Guangdong Province (2018KZDXM039), Project Supported by GDUPS (2018)

Author contributions: DJ, XZ, and YH contributed to hypothesis generation, experimental design, data interpretation, and manuscript preparation. YX, SLF, and XF conducted the experiments. XS, DX, and YT contributed to the data interpretation

DISCLOSURES

The authors declare that they have no competing interests.

Footnotes

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.psj.2022.101809.

Appendix. Supplementary materials

mmc1.docx (14.2KB, docx)

REFERENCES

  1. Baarends W.M., Uilenbroek J.T., Kramer P., Hoogerbrugge J.W., van Leeuwen E.C., Themmen A.P., Grootegoed J.A. Anti-mullerian hormone and anti-mullerian hormone type II receptor messenger ribonucleic acid expression in rat ovaries during postnatal development, the estrous cycle, and gonadotropin-induced follicle growth. Endocrin. 1995;136:4951–4962. doi: 10.1210/endo.136.11.7588229. [DOI] [PubMed] [Google Scholar]
  2. Belli M., Shimasaki S. Molecular aspects and clinical relevance of GDF9 and BMP15 in ovarian function. Vitam. Horm. 2018;107:317–348. doi: 10.1016/bs.vh.2017.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cai C.H., Zhao R.X., Wang P., Wang J.S., Li K.X., Zhan X.A., Wang K.Y. Effects of different stocking densities on growth performance, antioxidant ability, and immunity of finishing broilers. Anim. Sci. J. 2019;90:583–588. doi: 10.1111/asj.13148. [DOI] [PubMed] [Google Scholar]
  4. Cai L., Sun A., Li H., Tsinkgou A., Yu J., Ying S., Chen Z., Shi Z. Molecular mechanisms of enhancing porcine granulosa cell proliferation and function by treatment in vitro with anti-inhibin alpha subunit antibody. Reprod. Biol. Endocrinol. 2015;13:26. doi: 10.1186/s12958-015-0022-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen R., Dai Z.C., Zhu H.X., Lei M.M., Li Y., Shi Z.D. Active immunization against AMH reveals its inhibitory role in the development of pre-ovulatory follicles in Zhedong White geese. Theriogenology. 2020;144:185–193. doi: 10.1016/j.theriogenology.2020.01.011. [DOI] [PubMed] [Google Scholar]
  6. Crawford J.L., McNatty K.P. The ratio of growth differentiation factor 9: bone morphogenetic protein 15 mRNA expression is tightly co-regulated and differs between species over a wide range of ovulation rates. Mol. Cell Endocrinol. 2012;348:339–343. doi: 10.1016/j.mce.2011.09.033. [DOI] [PubMed] [Google Scholar]
  7. Cui Y.M., Wang J., Hai-Jun Z., Feng J., Wu S.G., Qi G.H. Effect of photoperiod on ovarian morphology, reproductive hormone secretion, and hormone receptor mRNA expression in layer ducks during the pullet phase. Poult. Sci. 2019;98:2439–2447. doi: 10.3382/ps/pey601. [DOI] [PubMed] [Google Scholar]
  8. Durlinger A.L., Gruijters M.J., Kramer P., Karels B., Kumar T.R., Matzuk M.M., Rose U.M., de Jong F.H., Uilenbroek J.T., Grootegoed J.A., Themmen A.P. Anti-Mullerian hormone attenuates the effects of FSH on follicle development in the mouse ovary. Endocrin. 2001;142:4891–4899. doi: 10.1210/endo.142.11.8486. [DOI] [PubMed] [Google Scholar]
  9. Elis S., Dupont J., Couty I., Persani L., Govoroun M., Blesbois E., Batellier F., Monget P. Expression and biological effects of bone morphogenetic protein-15 in the hen ovary. J. Endocrinol. 2007;194:485–497. doi: 10.1677/JOE-07-0143. [DOI] [PubMed] [Google Scholar]
  10. El-Tarabany M.S. Impact of cage stocking density on egg laying characteristics and related stress and immunity parameters of Japanese quails in subtropics. J. Anim. Physiol. Anim. Nutr. 2016;100:893–901. doi: 10.1111/jpn.12404. [DOI] [PubMed] [Google Scholar]
  11. Geng A.L., Liu H.G., Zhang Y., Zhang J., Wang H.H., Chu Q., Yan Z.X. Effects of indoor stocking density on performance, egg quality, and welfare status of a native chicken during 22 to 38 weeks. Poult. Sci. 2020;99:163–171. doi: 10.3382/ps/pez543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hanlon C., Takeshima K., Bedecarrats G.Y. Changes in the control of the hypothalamic-pituitary gonadal axis across three differentially selected strains of laying hens (Gallus gallus domesticus) Front. Physiol. 2021;12 doi: 10.3389/fphys.2021.651491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hou Z.S., Wen H.S., Li J.F., He F., Li Y., Tao Y.X. Expression of estrogen receptors in female rainbow trout (Oncorhynchus mykiss) during first ovarian development and under dense rearing condition. Gen. Comp. Endocrinol. 2018;259:1–11. doi: 10.1016/j.ygcen.2017.10.001. [DOI] [PubMed] [Google Scholar]
  14. Ireland J.L., Scheetz D., Jimenez-Krassel F., Themmen A.P., Ward F., Lonergan P., Smith G.W., Perez G.I., Evans A.C., Ireland J.J. Antral follicle count reliably predicts number of morphologically healthy oocytes and follicles in ovaries of young adult cattle. Biol. Reprod. 2008;79:1219–1225. doi: 10.1095/biolreprod.108.071670. [DOI] [PubMed] [Google Scholar]
  15. Johnson A.L., Woods D.C. Dynamics of avian ovarian follicle development: cellular mechanisms of granulosa cell differentiation. Gen. Comp. Endocrinol. 2009;163:12–17. doi: 10.1016/j.ygcen.2008.11.012. [DOI] [PubMed] [Google Scholar]
  16. Johnson P.A., Kent T.R., Urick M.E., Giles J.R. Expression and regulation of anti-Mullerian hormone in an oviparous species, the Hen1. Biol. Reprod. 2008;78:13–19. doi: 10.1095/biolreprod.107.061879. [DOI] [PubMed] [Google Scholar]
  17. Krause E.T., Schrader L. Suggestions to derive maximum stocking densities for layer pullets. Animals. 2019;9:348. doi: 10.3390/ani9060348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lewis P.D., Perry G.C., Morris T.R. Effect of size and timing of photoperiod increase on age at first egg and subsequent performance of two breeds of laying hen. Br. Poult. Sci. 1997;38:142–150. doi: 10.1080/00071669708417959. [DOI] [PubMed] [Google Scholar]
  19. Li X.M., Zhang M.H., Liu S.M., Feng J.H., Ma D.D., Liu Q.X., Zhou Y., Wang X.J., Xing S. Effects of stocking density on growth performance, growth regulatory factors, and endocrine hormones in broilers under appropriate environments. Poult. Sci. 2019;98:6611–6617. doi: 10.3382/ps/pez505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Liu G., Zeng M., Li X., Rong Y., Hu Z., Zhang H., Liu X. Expression and analysis of ESR1, IGF-1, FSH, VLDLR, LRP, LH, PRLR genes in pekin duck and black muscovy duck. Gene. 2021;769 doi: 10.1016/j.gene.2020.145183. [DOI] [PubMed] [Google Scholar]
  21. Liu H.Y., Zhang C.Q. Effects of daidzein on messenger ribonucleic Acid expression of gonadotropin receptors in chicken ovarian follicles. Poult. Sci. 2008;87:541–545. doi: 10.3382/ps.2007-00274. [DOI] [PubMed] [Google Scholar]
  22. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  23. Long L., Wu S.G., Yuan F., Zhang H.J., Wang J., Qi G.H. Effects of dietary octacosanol supplementation on laying performance, egg quality, serum hormone levels, and expression of genes related to the reproductive axis in laying hens. Poult. Sci. 2017;96:894–903. doi: 10.3382/ps/pew316. [DOI] [PubMed] [Google Scholar]
  24. Luo M., Li L., Xiao C., Sun Y., Wang G.L. Heat stress impairs mice granulosa cell function by diminishing steroids production and inducing apoptosis. Mol. Cell. Biochem. 2016;412:81–90. doi: 10.1007/s11010-015-2610-0. [DOI] [PubMed] [Google Scholar]
  25. Maddineni S.R., Ocon-Grove O.M., Krzysik-Walker S.M., Hendricks G.R., Ramachandran R. Gonadotropin-inhibitory hormone (GnIH) receptor gene is expressed in the chicken ovary: potential role of GnIH in follicular maturation. Reproduction. 2008;135:267–274. doi: 10.1530/REP-07-0369. [DOI] [PubMed] [Google Scholar]
  26. Miller W.L., Auchus R.J. The molecular biology, biochemistry, and physiology of human steroidogenesis and its disorders. Endocr. Rev. 2011;32:81–151. doi: 10.1210/er.2010-0013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Mossa F., Jimenez-Krassel F., Scheetz D., Weber-Nielsen M., Evans A., Ireland J.J. Anti-Mullerian hormone (AMH) and fertility management in agricultural species. Reproduction. 2017;154:R1–R11. doi: 10.1530/REP-17-0104. [DOI] [PubMed] [Google Scholar]
  28. Otake S., Park M.K. Expressional changes of AMH signaling system in the quail testis induced by photoperiod. Reproduction. 2016;152:575–589. doi: 10.1530/REP-16-0175. [DOI] [PubMed] [Google Scholar]
  29. Peng J., Li Q., Wigglesworth K., Rangarajan A., Kattamuri C., Peterson R.T., Eppig J.J., Thompson T.B., Matzuk M.M. Growth differentiation factor 9: bone morphogenetic protein 15 heterodimers are potent regulators of ovarian functions. Proc. Natl. Acad. Sci. U. S. A. 2013;110:E776–E785. doi: 10.1073/pnas.1218020110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pu F., Xiong X., Li Y., Xi Y., Ma S., Bai L., Zhang R., Liu H., Yang C. Transcriptome analysis of oviduct in laying ducks under different stocking densities. Br. Poult. Sci. 2021:1–8. doi: 10.1080/00071668.2021.1983917. [DOI] [PubMed] [Google Scholar]
  31. Renema R.A., Robinson F.E., Proudman J.A., Newcombe M., McKay R.I. Effects of body weight and feed allocation during sexual maturation in broiler breeder hens. 2. Ovarian morphology and plasma hormone profiles. Poult. Sci. 1999;78:629–639. doi: 10.1093/ps/78.5.629. [DOI] [PubMed] [Google Scholar]
  32. Rosenfeld C.S., Wagner J.S., Roberts R.M., Lubahn D.B. Intraovarian actions of oestrogen. Reproduction. 2001;122:215–226. doi: 10.1530/rep.0.1220215. [DOI] [PubMed] [Google Scholar]
  33. Shi L., Sun Y., Xu H., Liu Y., Li Y., Huang Z., Ni A., Chen C., Li D., Wang P., Fan J., Ma H., Chen J. Effect of age at photostimulation on sexual maturation and egg-laying performance of layer breeders. Poult. Sci. 2020;99:812–819. doi: 10.1016/j.psj.2019.12.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Soares D.F., Pizzolante C.C., Duarte K., Moraes J.E., Budino F., Soares W., Kakimoto S.K. Welfare indicators for laying Japanese quails caged at different densities. An. Acad. Bras. Cienc. 2018;90:3791–3797. doi: 10.1590/0001-3765201820180276. [DOI] [PubMed] [Google Scholar]
  35. Spicer L.J., Aad P.Y., Allen D.T., Mazerbourg S., Payne A.H., Hsueh A.J. Growth differentiation factor 9 (GDF9) stimulates proliferation and inhibits steroidogenesis by bovine theca cells: influence of follicle size on responses to GDF9. Biol. Reprod. 2008;78:243–253. doi: 10.1095/biolreprod.107.063446. [DOI] [PubMed] [Google Scholar]
  36. Wang J.H., Deng Z.X., LI S.C., Shen X., Huang Y.M., Jiang D.L. Effects of stocking density on serum Immune and antioxidant indices and stress response of laying ducks. Chin. J. Anim. Sci. 2021;58:229–233. [Google Scholar]
  37. Weimer S.L., Robison C.I., Tempelman R.J., Jones D.R., Karcher D.M. Laying hen production and welfare in enriched colony cages at different stocking densities. Poult. Sci. 2019;98:3578–3586. doi: 10.3382/ps/pez107. [DOI] [PubMed] [Google Scholar]
  38. Zakaria A.H., Miyaki T., Imai K. The effect of aging on the ovarian follicular growth in laying hens. Poult. Sci. 1983;62:670–674. doi: 10.3382/ps.0620670. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx (14.2KB, docx)

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES