Bergenin, a PPARγ agonist, inhibits Th17 differentiation and subsequent neutrophilic asthma by preventing GLS1-dependent glutaminolysis

Abstract

Bergenin is a natural PPARγ agonist that can prevent neutrophil aggregation, and often be used in clinics for treating respiratory diseases. Recent data show that Th17 cells are important for neutrophil aggregation and asthma through secreting IL-17A. In this study, we investigated the effects of bergenin on Th17 differentiation in vitro and subsequent neutrophilic asthma in mice. Naïve T cells isolated from mouse mesenteric lymph nodes were treated with IL-23, TGF-β, and IL-6 to induce Th17 differentiation. We showed that in naïve T cells under Th17-polarizing condition, the addition of bergenin (3, 10, 30 μM) concentration-dependently decreased the percentage of CD4⁺ IL-17A⁺ T cells and mRNA expression of specific transcription factor RORγt, and function-related factors IL-17A/F, IL-21, and IL-22, but did not affect the cell vitality and apoptosis. Furthermore, bergenin treatment prevented GLS1-dependent glutaminolysis in the progress of Th17 differentiation, slightly affected the levels of SLC1A5, SLC38A1, GLUD1, GOT1, and GPT2. Glutamine deprivation, the addition of glutamate (1 mM), α-ketoglutarate (1 mM), or GLS1 plasmid all significantly attenuated the above-mentioned actions of bergenin. Besides, we demonstrated that bergenin (3, 10, and 30 μM) concentration-dependently activated PPARγ in naïve T cells, whereas PPARγ antagonist GW9662 and siPPARγ abolished bergenin-caused inhibition on glutaminolysis and Th17 differentiation. Furthermore, we revealed that bergenin inhibited glutaminolysis by regulating the level of CDK1, phosphorylation and degradation of Cdh1, and APC/C-Cdh1-mediated ubiquitin-proteasomal degradation of GLS1 after activating PPARγ. We demonstrated a correlation existing among bergenin-affected GLS1-dependent glutaminolysis, PPARγ, “CDK1-APC/C-Cdh1” signaling, and Th17 differentiation. Finally, the therapeutic effect and mechanisms for bergenin-inhibited Th17 responses and neutrophilic asthma were confirmed in a mouse model of neutrophilic asthma by administration of GW9662 or GLS1 overexpression plasmid in vivo. In conclusion, bergenin repressed Th17 differentiation and then alleviated neutrophilic asthma in mice by inhibiting GLS1-dependent glutaminolysis via regulating the “CDK1-APC/C-Cdh1” signaling after activating PPARγ.

Introduction

Th17 cells are an important subtype of CD4⁺ T cells, specifically, express the specific transcription factor RORγt, and regulate the progress of inflammation and immune response by secreting function-related cytokines such as IL-17A/F, IL-21, and IL-22 [1]. Among them, IL-17A is especially important and owns the ability to recruit neutrophils by activating the downstream target cells including epithelial cells, endothelial cells, and fibroblasts, which then triggers inflammation in tissues and the body’s immune imbalance, and eventually causes diseases including asthma [2, 3]. Researches have shown that the level of IL-17A in plasma of asthmatic patients is significantly higher than that of healthy people and positively correlated with the disease severity [4]. The neutralizing antibody of IL-17A inhibits ROCK-I/II activity and alleviates inflammation in the lungs of asthmatic mice [5]. Furthermore, rMS-Ag85a-IL-17A, constructed by mycobacterium smegmatis, induces the production of IL-17A autoantibodies and alleviates the symptoms of asthma [6].

The process of Th17 differentiation is complex, and an expanding spectrum of research efforts has extended the concept that metabolism and differentiation of immune cells are linked. In the resting state, T cells give preference to fatty acid oxidation. However, upon T cell receptor ligation and co-stimulation, they mainly obtain energy through glycolysis and glutaminolysis. Of note, compared to Th0 cells, the oxygen consumption rate that characterizes the degree of glutaminolysis is significantly increased, but the extracellular acidification rate that characterizes the degree of glycolysis slightly changes, suggesting an important role of glutaminolysis in Th17 differentiation [7]. Under Th17-skewing conditions, the expressions of glutamine metabolism-related enzymes glutaminase 1 (GLS1), glutamate dehydrogenase 1 (GLUD1), and glutamic-pyruvic transaminase 2 (GPT2) are significantly upregulated [7, 8]. Both GLS1 shRNA and its selective inhibitor BPTES restrains Th17 differentiation, and oxaloacetic transaminase 1 (GOT1) inhibitor (aminooxy)-acetic acid (AOA) promotes the conversion of Th17 cells toward Treg cells by intervening in the GOT1/α-ketoglutarate axis [9]. Therefore, inhibition of glutaminolysis is an effective way to inhibit Th17 differentiation and improve the related diseases.

Bergenin is the major bioactive ingredient of compound bergenin tablets, which have been used in clinical for the treatment of respiratory diseases in China for many years. Our previous research reported that bergenin could activate PPARγ in macrophages, and the classical PPARγ agonist pioglitazone has been demonstrated to inhibit glutaminolysis in NCI-H2347 cells and limit Th17 differentiation. In addition, Yang SQ et al. reported that bergenin could alleviate the neutrophil aggregation in the lungs of mice with lipopolysaccharide (LPS)-induced acute lung injury [10–13]. Therefore, this subject mainly studies the effect and mechanisms of bergenin on Th17 response and neutrophilic asthma from the perspective of glutaminolysis.

Materials and methods

Chemicals and reagents

Bergenin (C₁₄H₁₆O₉, MW: 328.27; purity > 98%) was purchased from ZeLang Biological Technology Co., Ltd. (Nanjing, China); House dust mites (HDM, XPB82D3A2.5) was purchased from Greer Laboratories (Lenoir, NA, USA); Rosiglitazone (RGZ, CSN12512) was purchased from CSNpharm Co. Ltd. (Chicago, IL, USA); GW9662 (a specific PPARγ antagonist, T2260) was purchased from Target Mol (Shanghai, China); Dexamethasone (DEX, 015191012) was purchased from Shanghai Pharmaceutical Group Co. Ltd. Xinyi Pharmaceutical Factory (Shanghai, China); LPS (L2880) were purchased from Sigma Chemical Co., Ltd. (St. Louis, MO, USA); FITC-anti-CD4 (MA110219) and purified anti-mouse CD3 (16003282)/CD28 (16028185) mAbs were purchased from eBioscience (San Diego, CA, USA); APC-anti-IL-17 (506916) was purchased from BioLegend (San Diego, CA, USA); rh TGF-β1 (10021), rh IL-23 (20023), rm IL-6 (21616) were purchased from PeproTech Inc. (Cranbury, NJ, USA); Mouse CD4⁺ CD62L⁺ T Cell Isolation Kit (MB17R20229) was purchased from Miltenyi Biotec Inc. (Cologne, Germany); RPMI-1640 (31800022) was purchased from Gibco BRL (Grand Island, NY, USA); Fetal bovine serum (FBS, 110118611) was purchased from Sijiqing (Hangzhou, China); 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, M6494) and TRIzol reagent (10296028) were purchased from Invitrogen Corp. (Carlsbad, CA, USA); Annexin V-FITC/PI double staining apoptosis detection kit (BD00731), cell counting kit-8 (CCK-8, BD00791) and β-actin antibody (AP0714) were purchased from Bioworld Technology, Inc. (Atlanta, GA, USA); Peroxidase-conjugated secondary antibodies (A0208), protein A + G agarose (BD0048) and luciferase reporter gene assay kit (RG052S) were purchased from Beyotime (Shanghai, China); Glutamine (A07311), glutamate (A07411) and α-ketoglutarate (A07410) assay kits were purchased from JianCheng Bioengineering Institute (Nanjing, China); Glutamate (30377) and α-ketoglutarate (33693) were purchased from Cayman (Ann Arbor, MI, USA); siPPARγ, siCdh1 and siCtrl were purchased from RiboBio Co. (Guangzhou, China); GLS1, CDK1 and WT plasmids were purchased from Jiman (Shanghai, China); HiScript^TM reverse transcriptase system (R30201) and SYBR^® green master mix (Q51102) were purchased from Vazyme Biotech Co., Ltd. (Nanjing, China); PPARγ (sc7273), SMRT (sc1610), APC (sc9998) and IgG (sc69786) antibodies were purchased from Santa Cruz Biotechnology (Delaware, CA, USA); Ubiquitin antibody (bs1549R) was purchased from Beijing Boaosen Biotechnology Co., Ltd. (Beijing, China); GLUD1 (D264000), GPT2 (D164119) and GOT1 (D221954) antibodies were purchased from Biotech Engineering Co., Ltd. (Shanghai, China); GLS1 (12855) and Cdh1 (16368) antibodies were purchased from ProteinTech (Chicago, IL, USA); Lamin B (WL01775), CDK1 (WL01613) antibodies and nuclear and cytoplasmic protein extraction kit (WLA020) were purchased from Wanlei Biotechnology Co., Ltd. (Shenyang, China); Phenylmethanesulfonyl fluoride (PMSF, KGP610) was purchased from KeyGen Biotech (Nanjing, China); Enhanced chemiluminescent (ECL) plus reagent kit (E41201) was purchased from Tianneng Technology Co., Ltd. (Shanghai, China).

Animals

The female C57BL/6 mice (6–8 weeks old, weighing 18–22 g) were obtained from the Comparative Medicine of Yangzhou University (Yangzhou, China). They were kept with a 12 h light/dark cycle at about 25 °C with free access to pathogen-free food and tap water. The protocol was approved by the Animal Ethics Committee of China Pharmaceutical University (Approval No. 202004004). All animal experiments were strictly performed in accordance with the Guide for the Care and Use of Laboratory Animals and made to minimize suffering and reduce the number of animals used.

Cell culture

The EL-4 cells were obtained from the Cell Bank of Shanghai (Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, China), and maintained in RPMI-1640 medium supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin. All the cells were passaged within multiple generations of 30.

The lymphocytes were isolated from mesenteric lymph nodes of C57BL/6 mice and purified with magnetic beads of mouse CD4⁺ CD62L⁺ T Cell isolation kit according to the manufacturer’s instructions to obtain the naïve T cells (Miltenyi Biotech, Cologne, Germany) [14]. In addition, they were maintained in RPMI-1640 medium supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin.

Cell viability and apoptosis

The lymphocytes were seeded into 96-well plates and treated with bergenin (1, 3, 10, 30, and 100 μM) for 68 h. Subsequently, MTT (20 μL) or CCK-8 solution (10 μL) were added, and further incubated for an additional 4 h. For the MTT assay, the supernatants were removed, formazan crystals were dissolved in 200 μL dimethyl sulfoxide, and the optical absorbance at 570 nm was read by a Microplate Reader (1500, Thermo, Waltham, MA, USA). In addition, for the CCK-8 assay, the supernatants were retained and optical absorbance at 450 nm was also read by a Microplate Reader.

The lymphocytes were seeded into 96-well plates and treated with bergenin (1, 3, 10, 30, and 100 μM) for 72 h. Subsequently, the apoptosis of lymphocytes was evaluated by using Annexin V-FITC/PI assay according to the manufacturer’s instructions. Then, the frequencies of apoptotic cells were detected by using flow cytometry (Treestar, Ashland, OR, USA).

Flow cytometry

The naïve T cells were treated with anti-CD3/CD28 (2 μg/mL), rh TGF-β1 (5 ng/mL), rm IL-6 (20 ng/mL), and rh IL-23 (10 ng/mL) as well as bergenin (3, 10, and 30 μM) for 72 h. Subsequently, they were stained with FITC-anti-CD4 for 30 min at 4 °C, followed by fixation and permeabilization for 0.5 h. Then, they were stained with APC-anti-IL-17 antibodies for another 1 h, washed with fluorescence-activated cell sorting staining buffer, and analyzed by FACS Calibur (BD Biosciences, San Jose, USA). All the results were analyzed by using FlowJo7.6 software (Treestar, Ashland, OR, USA).

Quantitative-polymerase chain reaction (Q-PCR)

The naïve T cells were treated with anti-CD3/CD28 (2 μg/mL), rh TGF-β1 (5 ng/mL), rm IL-6 (20 ng/mL) and rh IL-23 (10 ng/mL) as well as bergenin (3, 10, and 30 μM) for 72 h. Subsequently, the total RNA was isolated by using TRIzol extraction reagent according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA). Then, RNA (2 μg) was reversed transcribed into cDNA by using HiScript QRTSuperMix. The cDNA template (2 μL) was added to a 20 µL PCR reaction, which contained the sequence-specific primers and the AceQ qPCR SYBR Green Master Mix reagent. The cycle conditions included an initial step at 95 °C for 5 min, followed by 40 cycles at 95 °C for 10 s and 55–60 °C for 30 s. The primers used in Q-PCR were listed in Table 1.

Table 1.

Primers used in Q-PCR

Primers		Sequence (5′-3′)
β-actin	Forward	ATCACTATTGGCAACGAGCGGTTC
	Reverse	CAGCACTGTGTTGGCATAGAGGTC
RORγt	Forward	CTACCTCCACCATGCCAAGT
	Reverse	CACACAGGATGGCTTGAAGA
IL-17A	Forward	GATGAGCAGGTCCGAGGTTAC
	Reverse	TGCCAGTGTGTCTTCCAAGG
IL-17F	Forward	ACGTGCACAATCTCAACTCG
	Reverse	AGCACCACCTCAGCTAGGAAG
IL-21	Forward	CTCCTCTCTTGACTCGCCAT
	Reverse	CGGTGTAACCCCTCCAAGTC
IL-22	Forward	GTGGATCTGGCACGACTGTCA
	Reverse	TTGAGGTTCAGCAGGTCATAGTGG
SLC1A5	Forward	GTTACCGCCATCACCTCCATCAAC
	Reverse	GGAAGGCAGCAGACACCAGATTG
SLC38A1	Forward	GAGCACAGGCGACATTCTCATCC
	Reverse	CATGGCGGCACAGGTGGAAC
GLS1	Forward	GTCCTGAGGCAGTTCGGAATACACG
	Reverse	AGGAGGAGACCAACACATCATGC
Apo-A	Forward	CCTACCTTGAACGAGTACCACACCC
	Reverse	TGGCCTTGTCGATCACACTCTG
HMGCS2	Forward	GGCACCGAGACCATCATTGACAAGA
	Reverse	TCCAGTTGGCAGCATTGAAGAGG
PDK1	Forward	ACCAGCAGACACCTCCGAAGC
	Reverse	GGCTCAGGAGATTGTCGTAGTTGC
UBC	Forward	CCTGGTCCTTCGCCTCAGAGG
	Reverse	TGTGGTGAGGAAGGTACGTCTGTC
CD36	Forward	GTGGATCTGGCACGACTGTCA
	Reverse	TTGAGGTTCAGCAGGTCATAGTGG
aP2	Forward	GTTACCGCCATCACCTCCATCAAC
	Reverse	GGAAGGCAGCAGACACCAGATTG

ELISA

The naïve T cells were treated with anti-CD3/CD28 (2 μg/mL), rh TGF-β1 (5 ng/mL), rm IL-6 (20 ng/mL), and rh IL-23 (10 ng/mL) as well as bergenin (3, 10, and 30 μM) for 72 h. The cells plus culture medium were centrifuged at 1200 r/min for 5 min, supernatants and cell pellets were separately collected. Then, cell pellets were lysed and homogenized with phosphate buffer solution, centrifuged at 3000 r/min for 15 min. Finally, the levels of glutamine, glutamate, and α-ketoglutarate were determined by using kits according to the manufacturer’s instructions.

Western blotting

The naïve T cells were treated with anti-CD3/CD28 (2 μg/mL), rh TGF-β1 (5 ng/mL), rm IL-6 (20 ng/mL), and rh IL-23 (10 ng/mL) as well as bergenin (3, 10, and 30 μM) for 72 h. The total protein was extracted by using lysis buffer, and cytoplasmic and nuclear proteins were isolated by using the extraction kits (Beyotime, Nanjing, China). Then, proteins were separated by using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto the polyvinylidene fluoride (PVDF) membranes. The membranes were probed with primary antibodies overnight at 4 °C and then incubated with HRP-coupled secondary antibodies for 2 h at 37 °C. The final detection was performed by using ECL reagents.

Transfection

The naïve T cells were transfected with siPPARγ, siCdh1, siCtrl, GLS1 plasmid, CDK1 plasmid, or WT plasmid according to the methods that we have described previously [14].

Co-immunoprecipitation assay

The total protein was extracted from the EL-4 or naïve T cells by using lysis buffer. The supernatants were collected and incubated with 1 μg PPARγ or GLS1 antibody overnight at 4 °C and precipitated with protein A + G agarose beads for another 4 h. Then, the precipitated proteins were washed with NP40 buffer and separated by SDS-PAGE as described in the Western blotting assay.

Luciferase reporter assay

The EL-4 cells were seeded into 12-well plates, and co-transfected with PPARγ luciferase reporter plasmid by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) for 24 h. Subsequently, they were suspended in a fresh culture medium and exposed to bergenin (3, 10, 30 μM) for 24 h. Then, cells were collected, and luciferase activity was measured by using a luciferase assay kit according to the manufacturer’s instructions.

Electrophoretic mobility shift assay

The EL-4 cells were seeded into 6-well plates and incubated with bergenin (3, 10, and 30 μM) for 24 h, and nuclear proteins were extracted. Then, biotin-labeled PPARγ-specific oligonucleotides were prepared as the labeled probe according to the manufacturer’s instructions. The nuclear extracts were incubated with poly (dI-dC), labeled probe, and binding buffer at room temperature for 10 min. Then, reaction mixtures were separated with 5% non-denatured polyacrylamide gels at 1 mA/cm at 4 °C for 1.5 h and transferred onto PVDF membranes. The biotin end-labeled DNA was tested with a streptavidin–HRP conjugate and ECL reagents. Finally, membranes were detected with X-ray film and analyzed with the Quantity One software.

The induction of neutrophilic asthma in mice and drug administration

On day 0, mice were sensitized with HDM (10 μg; i.n.) and LPS (5 μg; i.n.) and then challenged with HDM (10 μg; i.n.) and LPS (5 μg; i.n.) on day 7–11 [15–17]. Bergenin (100 mg/kg; i.g.), RGZ (5 mg/kg; i.g.), and DEX (5 mg/kg; i.g.) were administered daily from day 1 to 15; GW9662 (1 mg/kg; i.p.) was administered daily from day 1 to 15; GLS1 plasmid (i.n.) was mixed with equal volume entranster in vivo transfection reagent, and administrated weekly for consecutive 15 days.

To identify the inhibition of bergenin on neutrophilic asthma and the involvement of PPARγ and GLS1-dependent glutaminolysis, mice were randomly divided into nine groups as follows: normal group, HDM + LPS (i.n.) group, bergenin (100 mg/kg; i.g.) group, GW9662 (1 mg/kg; i.p.) group, bergenin + GW9662 group, GLS1 plasmid (10 μg; i.n.) group, bergenin + GLS1 plasmid group, RGZ (5 mg/kg; i.g.) group, and DEX (5 mg/kg; i.g.) group. In addition, 4 days after the last challenge, broncho-alveolar lavage fluid (BALF), lungs, and pulmonary mediastinal lymph nodes were collected. The number of neutrophils in BALF, the expressions of RORγt, IL-17A, IL-17F, IL-21, IL-22, GLS1, CDK1, and Cdh1 in lungs, and the percentages of Th17 cells in pulmonary mediastinal lymph nodes were detected.

Histological scores

The lungs were fixed in 10% formalin, embedded in paraffin, sectioned, and stained with hematoxylin and eosin for the histological evaluation. The histological scores were graded as follows: 0, no inflammatory cell infiltration; 1, little inflammatory cell infiltration; 2, one layer of inflammatory cells around the airway; 3, two to four layers of inflammatory cells around the airway; 4, four, or more layers of inflammatory cells around the airway.

Statistical analysis

In this study, SPSS statistical software (SPSS, Chicago, IL, USA) was used to perform the statistical analysis, and data were expressed as means ± SEM. t Test was used to compare the mean differences between two groups; the comparison of more than two groups of data was evaluated by one-way ANOVA. If the variance was not different, the LSD test was used for evaluation. In contrast, when the variance was different, the Games–Howell test was used for evaluation. A value of P < 0.05 was accepted as a significant difference.

Results

Bergenin can inhibit the Th17 differentiation

The compound bergenin tablets have been used in clinical for the treatment of respiratory diseases in China for many years, and bergenin works as the major bioactive ingredient and owns a well immunomodulatory effect. Recent literatures indicate the therapeutic action of bergenin on Th17 response-related diseases such as rheumatoid arthritis and ulcerative colitis, but the direct intervention of Th17 differentiation is unknown [18]. In this study, the effect of bergenin on viability and apoptosis of lymphocytes was firstly inspected by using MTT, CCK-8, and Annexin V-FITC/PI assays. As shown in Fig. 1a–c, bergenin (1, 3, 10, 30, and 100 μM) did not affect the viability and apoptosis of lymphocytes, and the concentrations that could be used in the subsequent experiments were preliminarily determined. Moreover, the direct influence of bergenin on Th17 differentiation was investigated, and bergenin (3, 10, and 30 μM) concentration-dependently downregulated the percentages of CD4⁺ IL-17A⁺ T cells (Th17 cells) and mRNA expressions of RORγt, IL-17A, IL-17F, IL-21, as well as IL-22 in naive T cells under Th17-skewing conditions, suggesting that bergenin could restrict Th17 differentiation (Fig. 1d–f).

Fig. 1. The effect of bergenin on Th17 differentiation.

a–c The lymphocytes were isolated from mesenteric lymph nodes of mice, and treated with bergenin (1, 3, 10, 30, and 100 μM). The cell viability was detected by MTT (a) and CCK-8 (b) assays. The cell apoptosis was detected by Annexin V-FITC/PI assay (c). d–f The naïve T cells were cultured under Th17-polarizing conditions, and treated with bergenin (3, 10, and 30 μM) for 72 h. The percentages of CD4⁺ IL-17A⁺ T cells were detected by using flow cytometric assay (d). The mRNA expressions of RORγt (e), IL-17A, IL-17F, IL-21, and IL-22 (f) were detected by using Q-PCR assay. Results were representative of three independent experiments, and all data were presented as mean ± SEM. ^##P < 0.01 vs. the group without any treatment; ^*P < 0.05 and ^**P < 0.01 vs. the group under Th17-polarizing condition

Bergenin inhibits GLS1-dependent glutaminolysis under Th17-polarizing condition

Data in mountain show that the cellular energy metabolism can control the process of cell differentiation, proliferation, and so on, and glutaminolysis is necessary for Th17 differentiation [7, 8]. The process of glutaminolysis begins with the uptake of glutamine into the cytosol through amino acid transporters. Then, glutamine is deaminated to glutamate via GLS and subsequently converted to α-KG by GLUD, GOT or GPT. As shown in Fig. 2a–c, bergenin (10 and 30 μM) obviously upregulated the level of intracellular glutamine and downregulated levels of intracellular glutamate and α-ketoglutarate. However, a slight regulation of bergenin (3, 10, and 30 μM) on levels of SLC1A5, SLC38A1, and extracellular glutamine in the naïve T cells under Th17-polarizing condition was shown in Fig. 2d, e. Of note, bergenin (10 and 30 μM) significantly reduced the protein level of GLS1 but not GLUD1, GPT2, or GOT1, and the mRNA level of GLS1 was also not affected (Fig. 2f, g). All these results indicating a well inhibition of bergenin on GLS1 protein-dependent glutaminolysis under Th17-polarizing condition.

Fig. 2. The effect of bergenin on glutaminolysis under Th17-polarizing condition.

The naïve T cells were cultured under Th17-polarizing condition, and treated with bergenin (3, 10, 30 μM) for 72 h. a–c The levels of intracellular glutamine, glutamate, and α-ketoglutarate were detected by ELISA. d The mRNA expressions of SLC1A5 and SLC38A1 were detected by Q-PCR assay. e The level of extracellular glutamine was detected by ELISA. f The protein levels of GLS1, GLUD1, GPT2, and GOT1 were detected by Western blotting assay. g The mRNA expression of GLS1 was detected by Q-PCR assay. Results were representative of three independent experiments, and all data were presented as mean ± SEM. ^#P < 0.05 and ^##P < 0.01 vs. the group without any treatment; ^**P < 0.01 vs. the group under Th17-polarizing condition

The importance of GLS1-dependent glutaminolysis in bergenin-limited Th17 differentiation

By using the methods of glutamine deprivation, exogenous addition of glutamate and α-ketoglutarate or overexpression of GLS1, the importance of GLS1-dependent glutaminolysis in bergenin-inhibited Th17 differentiation was further confirmed. As shown in Fig. 3a–f, glutamine (0, 0.1, 0.2, and 2 mM) concentration-dependently increased the percentages of Th17 cells and promoted the mRNA expressions of RORγt, IL-17A, IL-17F, IL-21, and IL-22 in naïve T cells under Th17-polarizing condition. Glutamine (0 and 0.1 mM) did not induce the formation of Th17 cells, and bergenin (30 μM) also showed a slight effect. When the concentrations of glutamine were upregulated to 0.2 or 2 mM, bergenin (30 μM) significantly limited the Th17 differentiation as well as the expressions of RORγt, IL-17A, IL-17F, IL-21, and IL-22. In addition, exogenous addition of glutamate (1 mM) and α-ketoglutarate (1 mM), as well as overexpression of GLS1, significantly interfered the inhibitory effect of bergenin (30 μM) on Th17 differentiation (Fig. 3g–k).

Fig. 3. The participation of glutaminolysis in bergenin-inhibited Th17 differentiation.

a–f The naïve T cells were cultured in the media containing L-glutamine (0, 0.1, 0.2, and 2.0 mM) under Th17-polarizing condition, and treated with bergenin (30 μM) for 72 h. The percentages of CD4⁺ IL-17A⁺ T cells were detected by flow cytometric assay (a). The mRNA expressions of RORγt (b), IL-17A (c), IL-17F (d), IL-21 (e), and IL-22 (f) were detected by Q-PCR assay. g The naïve T cells were cultured under Th17-polarizing conditions and treated with glutamate, α-ketoglutarate, bergenin (30 μM) for 72 h. The percentage of CD4⁺ IL-17A⁺ T cells was detected by flow cytometric assay. h–k The naïve T cells were transfected with GLS1 plasmid, cultured under Th17-polarizing condition, and treated with bergenin (30 μM) for 72 h. The protein level of GLS1 was detected by Western blotting assay (h). The percentage of CD4⁺ IL-17A⁺ T cells was detected by flow cytometric assay (i). The mRNA expressions of RORγt, IL-17A, IL-17F, IL-21, and IL-22 were detected by Q-PCR assay (j, k). Results were representative of three independent experiments, and all data were presented as mean ± SEM. ^#P < 0.05 and ^##P < 0.01 vs. the group without any treatment; ^**P < 0.01 vs. the group under Th17-polarizing condition; ^$$P < 0.01 vs. the group treated with bergenin (30 μM)

The involvement of PPARγ in bergenin-inhibited glutaminolysis and Th17 differentiation

Our previous study indicated that bergenin could activate PPARγ in macrophages, and the classical PPARγ agonists RGZ and pioglitazone could show well inhibition of Th17 responses [10, 12, 19]. Therefore, the effect of bergenin on PPARγ activation in T cells was detected, and RGZ was used as the positive drug [19, 20]. As shown in Supplementary Fig. S1a–f, bergenin (3, 10, and 30 μM) slightly affected mRNA levels of PPARα target genes Apo-A and HMGCS2 as well as PPARβ target genes PDK1 and UBC, but concentration-dependently upregulated the mRNA levels of PPARγ target genes aP2 and CD36. Moreover, bergenin (10 and 30 μM) obviously weakened the association of PPARγ and the inhibitory protein of peroxisome proliferator response element SMRT, promoted the nuclear translocation and transcriptional activity of PPARγ, and upregulated the binding capacity of PPARγ to peroxisome proliferator response element (PPRE) (Supplementary Fig. S1g–j). All these results suggestted that bergenin could activate PPARγ but not PPARα and PPARβ in T cells.

Subsequently, the combined utilization of GW9662 or siPPARγ with bergenin or RGZ was performed, the levels of GLS1 protein and the glutaminolysis metabolites glutamine, glutamate, and α-ketoglutarate as well as percentages of Th17 cells were detected. As shown in Fig. 4a-n, GW9662 (1 μM) and siPPARγ almost reversed bergenin-reduced levels of GLS1 protein, glutamine, glutamate, α-ketoglutarate, and the percentages of Th17 cells. In addition, RGZ-reduced level of GLS1 protein and percentages of Th17 cells was also obviously recovered by GW9662 (1 μM) and siPPARγ (Supplementary Fig. S2a–d).

Fig. 4. The dependence of PPARγ in bergenin-inhibited glutaminolysis and subsequent Th17 differentiation.

The naïve T cells were cultured under Th17-polarizing condition, treated with bergenin (30 μM), GW9662 (1 μM), bergenin (30 μM) + GW9662 (1 μM) or rosiglitazone (RGZ, 30 μM), or pre-transfected with siPPARγ and treated with bergenin (30 μM) or RGZ (30 μM) for 72 h. a, b The protein level of GLS1 was detected by Western blotting assay. c–h The levels of intracellular glutamine (c, d), glutamate (e, f), and α-ketoglutarate (g, h) were detected by ELISA. i, j The percentages of CD4⁺ IL-17A⁺ T cells were detected by flow cytometric assay. k–n The mRNA expressions of RORγt, IL-17A, IL-17F, IL-21, and IL-22 were detected by Q-PCR assay. Results were representative of three independent experiments, and all data were presented as mean ± SEM. ^##P < 0.01 vs. the group without any treatment; ^*P < 0.05 and ^**P < 0.01 vs. the group under Th17-polarizing condition; ^$P < 0.05 and ^$$P < 0.01 vs. the group treated with bergenin (30 μM)

Bergenin facilitates the ubiquitin-proteasome degradation of GLS1 after activating PPARγ under Th17-polarizing condition

The inhibition of PPARγ agonists on glutaminolysis and Th17 differentiation has been confirmed, but the mechanisms are still unclear. Therefore, we further explore how bergenin inhibits glutaminolysis and subsequent Th17 differentiation after activating PPARγ, and try to provide a reasonable explanation from the angle of ubiquitin-proteasome degradation, which plays as an important controller for the GLS1 protein. As shown in Fig. 5a–c, bergenin (10 and 30 μM) and RGZ (30 μM) significantly increased the ubiquitin of GLS1. At the presence of the protein synthesis inhibitor CHX (15 μg/mL), the protein level of GLS1 protein was also down-regulated by bergenin (30 μM). Moreover, the proteasome inhibitor MG132 (5 μM) obviously reversed bergenin (30 μM) or RGZ (30 μM)-reduced level of GLS1 protein. In addition, GW9662 (1 μM) and siPPARγ obviously weakened the promotion of bergenin or RGZ on ubiquitination of GLS1 (Fig. 5d, e, Supplementary Fig. S3a–c). All these results indicated that bergenin and RGZ facilitated the ubiquitin-proteasome degradation of GLS1 after activating PPARγ.

Fig. 5. The effect of bergenin on proteasome ubiquitination and degradation of GLS1.

a The naïve T cells were cultured under Th17-polarizing condition, and treated with bergenin (3, 10, and 30 μM) or rosiglitazone (RGZ, 30 μM) for 72 h. The cell lysates were immunoprecipitated with antibody for GLS1, and precipitated GLS1 was detected by Western blotting with special antibody against ubiquitin. b The naïve T cells were cultured under Th17-polarizing condition, and treated with bergenin (30 μM) + cycloheximide (CHX, 15 μg/mL) for 0, 1, 3, 5, or 7 h. The protein level of GLS1 was detected by Western blotting assay.c The naïve T cells were cultured under Th17-polarizing condition and treated with bergenin (30 μM), MG132 (5 μM), bergenin (30 μM) + MG132 (5 μM) or RGZ (30 μM) for 72 h. The protein level of GLS1 was detected by Western blotting assay. d The naïve T cells were cultured under Th17-polarizing condition, and treated with bergenin (30 μM), GW9662 (1 μM), bergenin (30 μM) + GW9662 (1 μM) or RGZ (30 μM) for 72 h. The cell lysates were immunoprecipitated with antibody for GLS1, precipitated GLS1 was detected by Western blots with special antibody against ubiquitin. e The naïve T cells were transfected with siPPARγ, cultured under Th17-polarizing condition, and treated with bergenin (30 μM) or RGZ (30 μM) for 72 h. The cell lysates were immunoprecipitated with antibody for GLS1, and precipitated GLS1 was detected by Western blots with special antibody against ubiquitin. Results were representative of three independent experiments, and all data were presented as mean ± SEM. ^##P < 0.01 vs. the group without any treatment; ^*P < 0.05 and ^**P < 0.01 vs. the group under Th17-polarizing condition; ^$$P < 0.01 vs. the group treated with bergenin (30 μM)

The participation of “CDK1/APC/C-Cdh1” signals in bergenin-promoted ubiquitin-proteasome degradation of GLS1 after activating PPARγ

The ubiquitin ligase APC/C can be activated after binding to the activator Cdh1, and then degrades GLS1 and other proteins that have Lys-Glu-Asn box (KEN box) and destruction box (D box) motifs [21]. In addition, the protein kinase CDK1 can phosphorylate Cdh1 and promote its degradation, which in turn leads to the inactivation of APC/C, and there is a compact correlation between CDK1 and PPARγ [22–24]. Therefore, the effect of bergenin on “CDK1/APC/C-Cdh1” signals was further detected. As shown in Fig. 6a, under Th17-polarizing condition, APC/C slightly bound to GLS1 in naïve T cells, and bergenin (10 and 30 μM) and RGZ (30 μM) promoted their association. In addition, the protein level of Cdh1 was significantly upregulated by bergenin (10 and 30 μM) and RGZ (30 μM), and the siCdh1 almost reversed the inhibition of bergenin or RGZ on ubiquitination and protein level of GLS1 as well as Th17 differentiation (Fig. 6b–f, Supplementary Fig. S3d–f). Furthermore, the protein level of CDK1 in naїve T cells under Th17-polarizing condition was significantly up-regulated, bergenin (10 and 30 μM) and RGZ (30 μM) showed an obvious reduction, and CDK1 plasmid significantly weakened the action of bergenin or RGZ (Fig. 6g–k, Supplementary Fig. S3g–i). Next, GW9662 and siPPARγ were used to investigate the involvement of PPARγ in bergenin-regulated “CDK1/APC/C-Cdh1” signals. As shown in Fig. 7a–d and Supplementary Fig. S3j–m, both GW9662 (1 μM) and siPPARγ obviously attenuated the regulation of bergenin or RGZ on the protein levels of CDK1 and Cdh1 in naїve T cells under Th17-polarizing condition.

Fig. 6. The effect of bergenin on “APC/C-CDK1-Cdh1” signals under Th17-polarizing condition.

a, b The naïve T cells were cultured under Th17-polarizing condition, and treated with bergenin (3, 10, and 30 μM) or rosiglitazone (RGZ, 30 μM) for 72 h. The association of GLS1 and APC/C was detected by using immunoprecipitation assay (a). The protein level of Cdh1 was detected by Western blotting assay (b). c–f The naïve T cells were transfected with siCdh1, cultured under Th17-polarizing condition, and treated with bergenin (30 μM) and RGZ (30 μM) for 72 h. The protein level of Cdh1 (c) and GLS1 (d) was detected by Western blotting assay. The cell lysates were immunoprecipitated with an antibody for GLS1, and precipitated GLS1 was detected by Western blots with a special antibody against ubiquitin (e). The percentages of CD4⁺ IL-17A⁺ T cells were detected by flow cytometric assay (f). g The naïve T cells were cultured under Th17-polarizing condition, and treated with bergenin (3, 10, and 30 μM) and RGZ (30 μM) for 72 h. The protein level of CDK1 was detected by Western blotting assay. h-k The naïve cells were transfected with CDK1 plasmid, cultured under Th17-polarizing condition, and treated with bergenin (30 μM) and RGZ (30 μM) for 72 h. The protein levels of CDK1 (h) and GLS1 (i) were detected by Western blotting assay. The cell lysates were immunoprecipitated with an antibody for GLS1 and precipitated GLS1 was detected by Western blots with a special antibody against ubiquitin (j). The percentages of CD4⁺ IL-17A⁺ T cells were detected by flow cytometric assay (k). Results were representative of three independent experiments, and all data were presented as mean ± SEM. ^##P < 0.01 vs. the group without any treatment; ^**P < 0.01 vs. the group under Th17-polarizing condition; ^$P < 0.05 and ^$$P < 0.01 vs. the group treated with bergenin (30 μM)

Fig. 7. The participation of PPARγ in bergenin-regulated “CDK1-Cdh1-GLS1” signals under Th17-polarizing conditions.

a, b The naïve T cells were cultured under Th17-polarizing condition and treated with bergenin (30 μM), GW9662 (1 μM), bergenin (30 μM) + GW9662 (1 μM) and rosiglitazone (RGZ, 30 μM) for 72 h. The protein levels of CDK1 and Cdh1 were detected by Western blotting assay. c, d The naïve T cells were transfected with siPPARγ, cultured under Th17-polarizing condition, and treated with bergenin (30 μM) and RGZ (30 μM) for 72 h. The protein levels of CDK1 and Cdh1 were detected by Western blotting assay. Results were representative of three independent experiments, and all data were presented as mean ± SEM. ^##P < 0.01 vs. the group without any treatment; ^**P < 0.01 vs. the group under Th17-polarizing condition; ^$$P < 0.01 vs. the group treated with bergenin (30 μM)

Bergenin inhibits Th17 differentiation and subsequent neutrophilic asthma by controlling the “PPARγ-GLS1-glutaminolysis” axis

Subsequently, the effect of bergenin on neutrophilic asthma and the participation of “PPARγ-GLS1-glutaminolysis” axis was further studied. The animal model was established by using HDM and LPS, DEX and RGZ were selected as the positive drugs, GW9662 and GLS1 plasmid were used in combination with bergenin. Results showed that bergenin (100 mg/kg), RGZ (5 mg/kg), and DEX (5 mg/kg) significantly reduced the number of neutrophils in BALF, and improved the infiltration of inflammatory cells around bronchus in lungs of mice with neutrophilic asthma. In addition, GW9662 (1 mg/kg) and GLS1 plasmid showed slight effects on the pathological characteristics, but dramatically weakened the action of bergenin (100 mg/kg) (Fig. 8a, b).

Fig. 8. The effects of GW9662 and GLS1 plasmid on begenin-regulated signals and -inhibited Th17 differentiation and neutrophilic asthma.

a–h The neutrophilic asthma model in mice was induced by intranasal instillation of house dust mites (HDM) and lipopolysaccharide (LPS). Bergenin (100 mg/kg; i.g.), rosiglitazone (RGZ, 5 mg/kg; i.g.), dexamethasone (Dex, 5 mg/kg; i.g.) and GW9662 (1 mg/kg; i.p.) were administered daily for 15 consecutive days; GLS1 plasmid (10 μg; i.n.) was administered on day 1 and 8. On day 15, mice were sacrificed, broncho-alveolar lavage fluid (BALF), lungs, and pulmonary mediastinal lymph nodes were collected. a The number of total cells, neutrophils, eosinophils, lymphocytes, and monocytes in BALF was detected by using the automatic blood cell analyzer. b The degree of inflammation was examined by hematoxylin and eosin (H&E) (200×). c The percentages of CD4⁺ IL-17A⁺ T cells in pulmonary mediastinal lymph nodes were detected by flow cytometric assay. d The mRNA expressions of RORγt, IL-17A, IL-17F, IL-21, and IL-22 were detected by Q-PCR assay. e The level of glutamate in the lungs was detected by ELISA. f–h The protein levels of GLS1, CDK1, and Cdh1 were detected by Western blotting assay. Data were presented as the means ± SEM of six mice in each group. ^##P < 0.01 vs. the group without any treatment; ^**P < 0.01 vs. HDM + LPS group; ^$$P < 0.01 vs. the group treated with bergenin (100 mg/kg)

Then, the specific mechanisms for bergenin-improved neutrophilic asthma were further verified. As shown in Fig. 8c–e, bergenin (100 mg/kg), RGZ (5 mg/kg), and DEX (5 mg/kg) notably reduced the percentages of Th17 cells in pulmonary mediastinal lymph nodes, the expressions of RORγt, IL-17A, IL-17F, IL-21, IL-22, as well as the level of glutamate in lungs, and GW9662 (1 mg/kg) and GLS1 plasmid showed dramatical prevention of bergenin (100 mg/kg). In addition, GLS1 plasmid significantly upregulated the protein level of GLS1, and protein levels of GLS1, CDK1, and Cdh1 in lungs of asthmatic mice were obviously regulated by bergenin (100 mg/kg). However, when being used in combination with GW9662 (1 mg/kg), bergenin (100 mg/kg) showed slight effect (Fig. 8f–h).

All in all, as shown in Supplementary Fig. S4, bergenin repressed Th17 differentiation and alleviated neutrophilic asthma by inhibiting GLS1-dependent glutaminolysis via regulating the “CDK1-APC/C-Cdh1” signals after activating PPARγ.

Discussion

In 2005, Th17 cells are first discovered when Park studies autoimmune diseases such as immune encephalomyelitis [25]. Subsequently, researches indicate that they are important for the steady state of the body’s immune microenvironment. Therefore, targeting at Th17 cells or their main function-related factor IL-17A is identified as a good direction for the development of drugs used in the treatment for immunity-related diseases [26–28]. In in vitro experiments, scholars often use TGF-β and IL-6 as the inducers to establish the model of Th17 differentiation. However, recent data indicate that not all Th17 cells can mediate the occurrence of inflammatory responses. Only under the co-stimulation of IL-23, TGF-β, and IL-6, Th17 cells will own the pathogenic characteristics [29]. Therefore, in this study, the pathogenic Th17 cells were differentiated from the naive T cells by the combined stimulation of all three. Bergenin was demonstrated to significantly reduce the proportion of Th17 cells, down-regulate the mRNA expressions of the specific transcription factor RORγt and function-related factors IL-17A, IL-17F, IL-21, and IL-22, but slightly affect the cell viability and apoptosis.

The process of Th17 differentiation is complex, and the change of energy metabolism mode plays an important role. Glutaminolysis is confirmed to participate in the differentiation of CD4⁺ T cells toward Th17 cells, not only by providing energy, but also shows direct regulation via the metabolites glutamine, glutamate, or α-ketoglutarate [7, 8]. In the metabolic process, glutamine is taken up into cells by the glutamine transporters SLC1A5 and SLC38A1, changed into glutamate under the catalysis of glutaminase rate-limiting enzyme GLS1, and then converted into α-ketoglutarate under the action of GLUD1, GOT1, and GPT2. Both in vitro and in vivo experiments confirm that glutaminolysis inhibitors can significantly downregulate the proportion of Th17 cells [7, 9]. In addition, the function of Th17 cells differentiated from SLC1A5-deficient naїve T cells is weaker compared to that from the wild type naive T cells [30]. GLS1 inhibitor BPTES concentration-dependently prevents the Th17 differentiation, and mechanisms might be related to the inhibition of mTORC1 activation [7]. Moreover, Th17 and Treg cells can undergo phenotypic conversion, GOT1 inhibitor AOA promotes Foxp3 transcription by reducing the production of metabolite 2-HG and inducing the phenotypic transformation of Th17 cells towards Treg cells [9]. In this study, bergenin obviously downregulated the protein level of GLS1 and then inhibited the glutaminolysis, but slightly affected glutamine uptake. In addition, glutamine deprivation, exogenous addition of glutamate and α-ketoglutarate as well as GLS1 plasmid significantly interfered the inhibitory effect of bergenin on Th17 differentiation. All these findings emphasized the involvement of GLS1-dependent glutaminolysis in bergenin-inhibited Th17 differentiation.

PPARγ is a ligand-dependent nuclear transcription factor, can be translocated into the nucleus and bind to PPRE after binding to the corresponding ligand, and then regulate the transcription and translation of the downstream target genes such as PTEN [31]. It is in a low expression or inactive state in vitro Th17 differentiation or in vivo animal models of Th17 cell-related diseases. Of note, PPARγ agonists can significantly improve the disease symptoms by inhibiting the Th17 differentiation [19, 32, 33]. The pioglitazone exhibits anti-atherosclerotic effects by recovering the Th17/Treg balance in an adenosine 5′-monophosphate-activated protein kinase (AMPK)-dependent manner [12, 34]. The natural PPARγ agonists such as madecassic acid and arctigenin also show well limitation of Th17 differentiation via regulating the activation of AMPK or mTORC1 [19, 35]. Furthermore, troglitazone down-regulates the protein level of SLC1A5 in H460 and HeLa cells and then inhibits glutamine uptake, pioglitazone reduces the conversion rate of glutamine to glutamate in human non-small cell lung cancer NCI-H2347 cells and then prevents glutaminolysis [13, 36]. Our results showed that bergenin concentration-dependently upregulated the mRNA levels of PPARγ target genes CD36 and aP2, weakened the association of PPARγ and SMRT, promoted the nuclear translocation and transcriptional activity of PPARγ as well as the binding capacity of PPARγ to PPRE, which indicated the ability of bergenin on activating PPARγ in T cells. In addition, GW9662 and siPPARγ almost completely reversed the regulation of bergenin on the levels of GLS1 protein, glutamine metabolites, and percentages of Th17 cells.

The ubiquitin-proteasome system is the main path to mediate protein degradation and participates in the degradation processes of more than 80% protein in cells. APC/C is a circular E3 ubiquitin ligase and will be activated after binding to its co-activator Cdh1. After binding with Cdh1, APC/C degrades the target protein with the specific D box and KEN box domains such as GLS1 [21]. In addition, the Cdh1 contains a WD40 domain that can recruit and bind substrates, and is degraded after being phosphorylated by CDK, which in turn leads to the function loss of APC/C on degrading target protein [22]. CDKs can regulate the phosphorylation of Cdh1 mainly include CDK1 and CDK2, and data reports that there is a negative correlation between CDK1 and PPARγ [22–24]. In the above-mentioned results, we found that bergenin significantly reduced the protein but not the mRNA level of GLS1, and speculated whether the ubiquitin-proteasome system and “CDK1-APC/C-Cdh1” signals play important roles in the action of bergenin. Results showed that bergenin really up-regulated the ubiquitin of GLS1, regulated the levels of CDK1 and Cdh1, and promoted the association of APC/C and GLS1. In addition, CDK1 plasmid and siCdh1 reversed the regulation of bergenin on the ubiquitin and protein level of GLS1 and Th17 differentiation, GW9662 and siPPARγ weakened the regulation of bergenin on “CDK1-APC/C-Cdh1” signals.

Asthma is a chronic inflammatory disease and occurs in the airway. Its clinical symptoms mainly include recurrent wheezing, chest tightness, shortness of breath, and cough. In China, the incidence of asthma in people over the age of 20 is as high as 4.2%, and the mortality rate is also very high [37]. The imbalance of Th1/Th2 has been identified as the main cause of asthma in the traditional concept. However, the drugs targeting Th1 and Th2 cell-related factors are not very satisfactory for the clinical treatment of asthmatic patients [38]. Recently, data show that lungs of patients with severe and glucocorticoid hyporeactive asthma is characterized by neutrophil infiltration, and IL-17 own the ability to recruit activated neutrophils to exacerbate the occurrence and development of asthma [5, 6]. In addition, the levels of IL-17A and IL-17F in sputum, BALF, bronchial tissues, peripheral mononuclear cells, and serum of asthmatic patients are significantly higher, and positively correlated with the disease severity [39, 40]. Furthermore, IL-17A neutralizing antibody can down-regulate the proportion of inflammatory cells in the lungs, and improve the disease symptoms of asthmatic mice [5]. All these data suggest that Th17 cells are important in the development of neutrophilic asthma, and inhibition of Th17 responses might be a repressive approach.

Besides, PPARγ agonists are identified as the suppressant of asthma. The RGZ has a good therapeutic effect on neutrophilic asthma, and the specific mechanism is related to downregulated ratio of Th17 cells [41]. Pioglitazone prevents ovalbumin-induced asthma by regulating the activation of RGS4 signals [42]. Furthermore, glutaminolysis in the lesion sites of asthmatic patients is enhanced, the levels of glutamate in the sputum and glutamate, as well as succinate in the serum, are significantly increased. In addition, intraperitoneal injection of AOA can significantly improve the symptoms of mice with asthma caused by PM_2.5/polycyclic aromatic hydrocarbons [43, 44]. In this study, bergenin showed well alleviation of HDM and LPS-induced neutrophilic asthma in mice significantly reduced the number of neutrophils in BALF, improved the degree of inflammatory cells infiltration around bronchus in lungs, and downregulated percentages of Th17 cells in pulmonary mediastinal lymph nodes and levels of RORγt, IL-17A, IL-17F, IL-21, and IL-22 in lungs. When used in combination with GW9662 and GLS1 plasmid, the above-mentioned action of bergenin disappeared. Furthermore, they also prevented bergenin-inhibited Th17 differentiation and regulated “CDK1/APC/C-Cdh1” signals.

In conclusion, bergenin has substantial inhibition of Th17 differentiation and anti-neutrophilic asthma effect. The mechanisms were summarized as follows: activating PPARγ, regulating the signals of “CDK1/APC/C-Cdh1”, promoting the ubiquitination and degradation of GLS1, and then inhibiting glutaminolysis.

Author contributions

ZFW and YD designed the study. LY, YZ, YMM, WXY, and YZG performed all the experiments. In addition, LY and YZ prepared the manuscript, which was reviewed and approved by all authors.

Competing interests

The authors declare no competing interests.

Supplementary information

The online version contains supplementary material available at 10.1038/s41401-021-00717-1.