Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2000 Mar;44(3):760–762. doi: 10.1128/aac.44.3.760-762.2000

Capnocytophaga ochracea: Characterization of a Plasmid-Encoded Extended-Spectrum TEM-17 β-Lactamase in the Phylum Flavobacter-Bacteroides

Agnes Rosenau 1,*, Blandine Cattier 1, Nathalie Gousset 1, Patrick Harriau 1, Alain Philippon 2, Roland Quentin 1
PMCID: PMC89760  PMID: 10681352

Abstract

A plasmid-encoded extended-spectrum TEM β-lactamase with a pI of 5.5 was detected in a Capnocytophaga ochracea clinical isolate. The bla gene was associated with a strong TEM-2 promoter and was derived from blaTEM-1a with a single-amino-acid substitution: Glu104→Lys, previously assigned to TEM-17, which is thus the first TEM β-lactamase to be reported in the phylum Flavobacter-Bacteroides.


The dissemination of antibiotic resistance is a clear example of gene exchange between distantly related bacteria (13). However, this phenomenon is rare enough that the presence of a TEM β-lactamase in Capnocytophaga ochracea, a Cytophagale belonging to the phylum Flavobacter-Bacteroides (14), is of note, this type of enzyme being previously described only in the very phylogenetically distant Proteobacteria (4, 17, 22). C. ochracea is a capnophilic gram-negative fusiform rod with gliding motility. It is part of the normal gingival flora in humans and causes gingivitis and periodontitis. It may cause systemic infections in immunocompromised and neutropenic patients (11). Antibiotic treatment was originally based on its susceptibility to penicillins, including benzylpenicillin (7). The organism was later shown to be susceptible to extended-spectrum cephalosporins, making it possible to prescribe these drugs (2). Enzymatic resistance to β-lactams, including extended-spectrum cephalosporins, was reported as early as 1986 in clinical isolates of C. ochracea (3, 8, 18, 19). The genetic basis of resistance was not determined for any of the resistant strains. We report for the first time a plasmid-encoded TEM extended-spectrum β-lactamase in a clinical isolate of C. ochracea.

(This work was presented at the 98th General Meeting of the American Society for Microbiology, Atlanta, Ga., 17 to 21 May 1998.)

C. ochracea CIP 105321 was isolated in 1996 at Bretonneau Hospital Tours, France, from a culture of blood from an 11-year-old child with acute myeloid leukemia, fever (39°C), severe neutropenia, and oral mucositis who had received an empiric antibiotic treatment, including ceftazidime. The β-lactamase reaction in the nitrocefin-disk test (Cefinase; bioMérieux, Marcy l'Etoile, France) was positive. The disk-agar diffusion test performed on chocolate agar containing 1% PolyVitex (bioMérieux) showed that strain CIP 105321 was resistant to penams (amoxicillin, ticarcillin, and piperacillin) and cephems (cephalothin, cefoperazone, cefuroxime, cefotaxime, ceftazidime, ceftriaxone, cefpirome, and cefepime), but susceptible to cefoxitin, aztreonam, piperacillin-tazobactam, and imipenem. There was extensive synergy between amoxicillin-clavulanic acid and β-lactam disks, including those for all extended-spectrum cephalosporins tested. The strain was also resistant to gentamicin, polymyxin B, and cotrimoxazole, as commonly reported in the genus Capnocytophaga (7, 19). MICs were determined by agar dilution on Wilkins-Chalgren agar (Difco, Detroit, Mich.) with an inoculum of 104 CFU per spot (3, 18). The MICs of the two β-lactamase inhibitors, clavulanic acid and sulbactam, were found to be 0.6 and 0.8 μg/ml, respectively. To prevent an intrinsic antibacterial effect of clavulanate and sulbactam, a concentration of 0.1 μg/ml (if combined with a β-lactam) was then used for all plates. The strain was resistant to amoxicillin (MIC, 512 μg/ml), had intermediate resistance to piperacillin (MIC, 32 μg/ml), and was more resistant to ceftazidime (MIC, 64 μg/ml) than to cefpirome, cefepime, and cefotaxime (MIC, 16 μg/ml). It was susceptible to imipenem and cefoxitin, as was the β-lactamase-negative control strain, CIP 103448. Clavulanic acid and sulbactam partly restored the activity of amoxicillin, cefotaxime, and ceftazidime (Table 1).

TABLE 1.

In vitro susceptibility of C. ochracea strains to antibiotics

Strain β-Lactamase MIC (μg/ml)a
Amoxicillin
Cefoxitin
Cefotaxime
Ceftazidime
Imipenem alone
Alone +CA +SU Alone +CA +SU Alone +CA +SU Alone +CA +SU
CIP 105321 (wild-type plasmid) + 512 64 128 2 2 2 16 2 8 64 8 16 0.125
CIP 105321 (cured) − 0.125 0.125 0.125 1 1 1 0.015 0.015 0.015 0.03 0.03 0.03 0.125
CIP 103448 − 0.125 0.125 0.125 1 1 1 0.03 0.03 0.03 0.03 0.03 0.03 0.125
a

CA, clavulanic acid (0.1 μg/ml); SU, sulbactam (0.1 μg/ml). 

Three types of crude β-lactamase extract were prepared. Lysis by sonication and by Triton treatment was performed as previously described (8). For lysis by both sonication and detergent, 4% Triton X-100 was added to the sonicated cells. The β-lactamase activity of the supernatants was estimated by the iodine procedure in gels containing benzylpenicillin, by comparing the decolorized zones obtained with that for a sonicated extract containing TEM-1 β-lactamase (6). β-Lactamase activity was not detected in a 24-h broth culture or a Triton extract. Weak activity was detected in a sonicated extract, and strong activity was obtained if Triton was added after sonication. The analytical isoelectric focusing method used was adapted from that described by Foweraker et al. (8), with polyacrylamide gels containing ampholines (Pharmacia, Uppsala, Sweden) with a pH range of 3.5 to 9.5. Focusing of the enzyme could only be achieved for extracts containing Triton and if 4% Triton was included in the gel. This was previously reported to be the case for two other β-lactamases in Capnocytophaga, possibly due to enzyme binding to membrane components (8, 18). The β-lactamase migrated as a single band with an estimated pI of 5.5 in comparisons with known β-lactamases (TEM-1, pI 5.4; TEM-3, pI 6.3; and TEM-4, pI 5.9).

Plasmid DNA isolated by alkaline lysis was about 9 kb in size. Plasmid curing was done by culture with ethidium bromide and replica plating (6). The cured clones were highly susceptible to all β-lactams tested (Table 1) and did not produce β-lactamase detectable by the nitrocefin test on colonies. Resistance to other antimicrobial agents was not affected.

PCR was performed with plasmid DNA as the template and a pair of primers (Eurogentec, Seraing, Belgium), 1079 [5′-d(GGTCTGACAGTTACCAATGC)-3′] and 6 [5′-d(GAAGACGAAAGGGCCTCGTG)-3′], internal to blaTEM-1, with nucleotide positions given according to the numbering of Sutcliffe (21). Both strands of the PCR product were sequenced by automated fluorescent sequencing with an ABI Prism 377 sequencer (Perkin-Elmer), by using Thermo Sequenase dye terminator cycle sequencing premixed version 2.0 (Amersham, Les Ulis, France). Analysis of the nucleotide sequence (Table 2) showed that the gene encoding C. ochracea β-lactamase differed from the blaTEM-1a gene by four silent mutations (positions 469, 682, 863, and 985) and that there was a Glu104→Lys amino acid substitution in the protein according to the numbering scheme of Ambler et al. (1, 9). Lys104 substitution is common in extended-spectrum β-lactamases derived from TEM-1 or TEM-2 enzymes and is always associated with one to three additional amino acid changes at positions 21, 153, 164, 182, 237, 238, 240, and 265 (15; http://www.lahey.org/studies/webt.htm). The presence of single mutation Glu104→Lys has already been suspected on the basis of colony hybridization with specific oligonucleotide probes (oligotyping) in a single strain of Klebsiella pneumoniae. The enzyme was called TEM-17 (12). After sequencing of the corresponding gene, the deduced amino acid sequence was identical to that of TEM-15, and the enzyme was therefore redesignated TEM-15 (10). Because the β-lactamase of C. ochracea CIP 105321 presents the single Glu104→Lys amino acid substitution, we assigned it the number TEM-17 (http://www.lahey.org/studies/webt.htm). As for most of these enzymes, the blaTEM-17 gene was associated with a strong TEM-2 promoter with a C-to-T substitution at nucleotide 32 that increases the amount of enzyme (5).

TABLE 2.

Nucleotide and amino acid differences between blaTEM-1a, blaTEM-2, and blaTEM-17

Nucleotide no.a Amino acid no.b Nucleotide (amino acid)c in:
blaTEM-1a blaTEM-2 blaTEM-17
Promoter region
 32 C T T
Coding region
 317 39  C (Gln) A (Lys) C
 469 89  G (Glu) G A
 512 104 G (Glu) G A (Lys)
 682 160 T (Thr) C C
 863 221 C (Leu) C T
 985 261 C (Ile) C T
a

Numbering according to Sutcliffe (21). 

b

Numbering according to Ambler et al. (1). 

c

The encoded amino acid was indicated when there was a point mutation leading to an amino acid change relative to the TEM-1 sequence. 

It is not clear how Capnocytophaga acquired a blaTEM gene. Given the probable emergence in 1986 of the first isolates of Capnocytophaga producing extended-spectrum β-lactamases and the small size of the plasmids involved, the donating strain probably transferred the extended-spectrum β-lactamase gene via a transposon. However, Capnocytophaga may have acquired the blaTEM-1 gene via a transposon or small plasmid and then modified the blaTEM-1 gene by point mutation to give blaTEM-17, possibly due to selection pressure exerted by the extended-spectrum cephalosporins used to treat neutropenic patients. The ecological niche of Capnocytophaga and the small size of the plasmid involved suggest that the donating strain was of the genus Haemophilus or Neisseria, in which TEM extended-spectrum β-lactamases have never been reported. The TEM-1 β-lactamase should therefore also be present in Capnocytophaga strains.

In conclusion, the emergence of such inactivating enzymes in the Flavobacter-Bacteroides phylum at the same time as in the very distant Proteobacteria phylum (16, 20) requires further molecular investigation to trace the movements of the blaTEM gene.

Nucleotide sequence accession number.

The nucleotide sequence of blaTEM-17 has been assigned accession no. Y14574 in the EMBL Nucleotide Sequence Database.

Acknowledgments

We thank M. Kiredjian, Laboratoire des Identifications Bactériennes, Institut Pasteur Paris, France, for the identification at the species level of the Capnocytophaga strain.

REFERENCES

  • 1.Ambler R P, Coulson A F W, Frère J M, Ghuysen J M, Joris B, Forsman M, Levesque R C, Tiraby G, Waley S G. A standard numbering scheme for the class A β-lactamases. Biochem J. 1991;276:269–272. doi: 10.1042/bj2760269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Arlet G, Sanson-Le Pors M J, Casin I M, Ortenberg M, Perol Y. In vitro susceptibility of 96 Capnocytophaga strains, including a β-lactamase producer, to new β-lactam antibiotics and six quinolones. Antimicrob Agents Chemother. 1987;31:1283–1284. doi: 10.1128/aac.31.8.1283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Arlet G, Sanson-Le Pors M J, Castaigne S, Perol Y. Isolation of a strain of β-lactamase-producing Capnocytophaga ochracea. J Infect Dis. 1987;155:1346. doi: 10.1093/infdis/155.6.1346. [DOI] [PubMed] [Google Scholar]
  • 4.Bush K, Jacoby G A, Medeiros A A. A functional classification scheme for β-lactamases and its correlation with molecular structure. Antimicrob Agents Chemother. 1995;39:1211–1233. doi: 10.1128/aac.39.6.1211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chen S-T, Clowes R C. Variations between the nucleotide sequences of Tn1, Tn2, and Tn3 and expression of β-lactamase in Pseudomonas aeruginosa and Escherichia coli. J Bacteriol. 1987;169:913–916. doi: 10.1128/jb.169.2.913-916.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Courvalin P, Goldstein F, Philippon A, Sirot J, editors. L'antibiogramme. Paris, France: MPC-Vidéom; 1985. [Google Scholar]
  • 7.Forlenza S W, Newman M G, Horikoshi A L, Blachman U. Antimicrobial susceptibility of Capnocytophaga. Antimicrob Agents Chemother. 1981;19:144–146. doi: 10.1128/aac.19.1.144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Foweraker J E, Hawkey P M, Heritage J, Van Landuyt H W. Novel β-lactamase from Capnocytophaga sp. Antimicrob Agents Chemother. 1990;34:1501–1504. doi: 10.1128/aac.34.8.1501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Goussard S, Courvalin P. Sequence of the genes blaT-1B and blaT-2. Gene. 1991;102:71–73. doi: 10.1016/0378-1119(91)90540-r. [DOI] [PubMed] [Google Scholar]
  • 10.Goussard S, Courvalin P. Updated sequence information for TEM β-lactamase genes. Antimicrob Agents Chemother. 1999;43:367–370. doi: 10.1128/aac.43.2.367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kristensen B, Schønheyder H C, Peterslund N A, Rosthøj S, Clausen N, Frederiksen W. Capnocytophaga (Capnocytophaga ochracea group) bacteremia in hematological patients with profound granulocytopenia. Scand J Infect Dis. 1995;27:153–155. doi: 10.3109/00365549509018997. [DOI] [PubMed] [Google Scholar]
  • 12.Mabilat C, Courvalin P. Development of “oligotyping” for characterization and molecular epidemiology of TEM β-lactamases in members of the family Enterobacteriaceae. Antimicrob Agents Chemother. 1990;34:2210–2216. doi: 10.1128/aac.34.11.2210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Maiden M C J. Horizontal genetic exchange, evolution, and spread of antibiotic resistance in bacteria. Clin Infect Dis. 1998;27:S12–S20. doi: 10.1086/514917. [DOI] [PubMed] [Google Scholar]
  • 14.Nakagawa Y, Yamasato K. Emendation of the genus Cytophaga and transfer of Cytophaga agarovorans and Cytophaga salmonicolor to Marinilabilia gen. nov.: phylogenetic analysis of the Flavobacterium-Cytophaga complex. Int J Syst Bacteriol. 1996;46:599–603. [Google Scholar]
  • 15.Palzkill T, Botstein D. Identification of amino acid substitutions that alter the substrate specificity of TEM-1 β-lactamase. J Bacteriol. 1992;174:5237–5243. doi: 10.1128/jb.174.16.5237-5243.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Paul G C, Gerbaud G, Bure A, Philippon A M, Pangon B, Courvalin P. TEM-4, a new plasmid-mediated β-lactamase that hydrolyzes broad-spectrum cephalosporins in a clinical isolate of Escherichia coli. Antimicrob Agents Chemother. 1989;33:1958–1963. doi: 10.1128/aac.33.11.1958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Philippon A, Ben Redjeb S, Fournier G, Ben Hassen A. Epidemiology of extended spectrum β-lactamases. Infection. 1989;17:347–354. doi: 10.1007/BF01650727. [DOI] [PubMed] [Google Scholar]
  • 18.Roscoe D L, Zemcov S J V, Thornber D, Wise R, Clarke A M. Antimicrobial susceptibilities and β-lactamase characterization of Capnocytophaga species. Antimicrob Agents Chemother. 1992;36:2197–2200. doi: 10.1128/aac.36.10.2197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Rummens J L, Gordts B, Van Landuyt H W. In vitro susceptibility of Capnocytophaga species to 29 antimicrobial agents. Antimicrob Agents Chemother. 1986;30:739–742. doi: 10.1128/aac.30.5.739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sirot D, Sirot J, Labia R, Morand A, Courvalin P, Darfeuille-Michaud A, Perroux R, Cluzel R. Transferable resistance to third-generation cephalosporins in clinical isolates of Klebsiella pneumoniae: identification of CTX-1, a novel β-lactamase. J Antimicrob Chemother. 1987;20:323–334. doi: 10.1093/jac/20.3.323. [DOI] [PubMed] [Google Scholar]
  • 21.Sutcliffe J G. Nucleotide sequence of the ampicillin resistance gene of Escherichia coli plasmid pBR322. Proc Natl Acad Sci USA. 1978;75:3737–3741. doi: 10.1073/pnas.75.8.3737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Woese C R. Bacterial evolution. Microbiol Rev. 1987;51:221–271. doi: 10.1128/mr.51.2.221-271.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES