miR-195 regulates intestinal epithelial restitution after wounding by altering actin-related protein-2 translation

Abstract

Early gut epithelial restitution reseals superficial wounds after acute injury, but the exact mechanism underlying this rapid mucosal repair remains largely unknown. MicroRNA-195 (miR-195) is highly expressed in the gut epithelium and involved in many aspects of mucosal pathobiology. Actin-related proteins (ARPs) are key components essential for stimulation of actin polymerization and regulate cell motility. Here, we reported that miR-195 modulates early intestinal epithelial restitution by altering ARP-2 expression at the translation level. miR-195 directly interacted with the ARP-2 mRNA, and ectopically expressed miR-195 decreased ARP-2 protein without effect on its mRNA content. In contrast, miR-195 silencing by transfection with anti-miR-195 oligo increased ARP-2 expression. Decreased ARP-2 levels by miR-195 overexpression were associated with an inhibition of early epithelial restitution, as indicated by a decrease in cell migration over the wounded area. Elevation of cellular ARP-2 levels by transfection with its transgene restored cell migration after wounding in cells overexpressing miR-195. Polyamines were found to decrease miR-195 abundance and enhanced ARP-2 translation, thus promoting epithelial restitution after wounding. Moreover, increasing the levels of miR-195 disrupted F-actin cytoskeleton organization, which was prevented by ARP2 overexpression. These results indicate that miR-195 inhibits early epithelial restitution by decreasing ARP-2 translation and that miR-195 expression is negatively regulated by cellular polyamines.

INTRODUCTION

Early epithelial restitution is a primary repair modality in the intestinal mucosa and rapidly reseals superficial wounds by cell migration rather than proliferation (1, 2). Intestinal epithelial cells (IECs) quickly migrate over the wounded area after acute injury and this rapid and dynamic process requires an active movement of cells activated by cytoskeletal components including actin, myosin filaments, and microtubules (3–5). Actin-based plasma membrane protrusions, including lamellipodia, filopodia, and membrane ruffles, are actin-related protein 2/3 (ARP2/3) complex-dependent structures essential for cell migration (6–9). The ARP2/3 complex consists of seven subunits, such as ARP-2, ARP-3, and ARPC1–C5, and are expressed ubiquitously in various mammalian cells (10). ARP2/3 complex generates branched actin networks at different locations to nucleate actin underneath the plasma membrane and influences protrusion of migrating cells (11, 12). The activity of the ARP2/3 complex during integrin-dependent processes has been identified in macrophages, whereas lack of ARP2/3 activity impairs phagocytic processes exerted by integrin-dependent actin assembly (10, 13, 14). ARP2/3 also nucleates branched actin networks at repair sites in the nuclear periphery relocalized along actin networks through myosin activity (15–17). However, little is known about the exact role of ARP2/3 in regulating the intestinal epithelial restitution after wounding.

In mammalian cells, posttranscriptional regulation is a crucial step in the control of gene expression (18–20). MicroRNAs (miRNAs) bind to specific mRNAs and decrease the stability and translation of target transcripts, thus inhibiting gene expression (21, 22). Recently, miRNAs have been emerged as master regulators of gut epithelial homeostasis (22–24). Several miRNAs, including miR-195, miR-222, miR-29b, miR-503, and miR-675, are highly expressed in the intestinal epithelium, and their expression levels change rapidly in response to stressful environments (25–30). miR-195 is evolutionally conserved among different species and involved in different cellular processes (31, 32). miR-195 inhibits proliferation by reducing the levels of cyclin-dependent kinase 4 (CDK4), cyclin D1 (CCND1), CDK6, WEE1, and IGF2-receptor (31, 33, 34), promotes apoptosis by lowering SIRT1 abundance (35), and affects cell migration and cancer invasion by modulating expression of ActRIIA and STIM1 (29, 36). We have recently reported that transgenic expression of miR-195 in the intestinal epithelium disrupts Tuft cell and Paneth cell functions in mice partially by inhibiting DCLK1 translation (26).

An en masse search for miR-195 targets reveals that there are several binding sites for miR-195 on the ARP2 mRNA, suggesting a functional interaction between miR-195 and ARP2 mRNA. In this study, we first determined if miR-195 directly interacts with ARP2 mRNA and modulates ARP-2 expression levels in IECs. Second, we examined the role of miR-195-regulated ARP-2 in rapid intestinal epithelial restitution by using an in vitro proliferation-independent epithelial repair model. Since polyamines function as key biological regulators of gut mucosal repair and homeostasis and can modulate miRNA biogenesis (27, 37–39), the third set of experiments was to test if polyamines influence ARP2 expression via miR-195 in IECs. Our results indicate that miR-195 inhibits ARP-2 translation in IECs and that miR-195-mediated ARP-2 repression plays an important role in the control of IEC migration after acute injury. Moreover, polyamines enhance ARP-2 expression by lowering the cellular levels of miR-195.

MATERIALS AND METHODS

Chemicals and Cell Cultures

Disposable culture ware was purchased from Corning Glass Works (Corning, NY). Tissue culture media, LipofectAMINE 2000, and fetal bovine serum (FBS) were obtained from Invitrogen (Carlsbad, CA), and biochemicals were obtained from Sigma (St. Louis, MO). The affinity-purified rabbit polyclonal antibodies against ARP-2 (Cat. No. PA-5–100393), ARP-3 (Cat. No. PTG-13822-1-AP), and Alexa Fluor 488 Phalloidin (Cat. No. R37110) were purchased from Invitrogen (Gaithersburg, MD), and the antibody against glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Cat. No. sc-47724) was from Santa Cruz Biotechnology (Santa Cruz, CA). The secondary antibodies conjugated to horseradish peroxidase (goat anti-rabbit IgG-HRP, Cat. No. sc-2004; goat anti-mouse IgG HRP, Cat. No. sc-2005) were purchased from Santa Cruz Biotechnology. All antibodies utilized in this study were thoroughly validated for species specificity. Pre-miR miRNA precursor and anti-miR miRNA inhibitor of miR-195 were purchased from Ambion (Austin, TX). Biotin-labeled miRNA-195 was custom made by Dharmacon (Lafayette, CO). The l-α-difluoromethylornithine (DFMO) was from Genzyme (Cambridge, MA). Human ARP2 cDNA was purchased from OriGene Technologies (Rockville, MD; Cat. No. RC203111). The IEC-6 cell line was purchased from the American Type Culture Collection (ATCC) at passage 13. Stock cells were maintained in T-150 flasks in Dulbecco’s modified Eagle medium (DMEM) supplemented with 5% heat-inactivated FBS, 10 µg/mL insulin, and 50 µg/mL gentamicin sulfate. Flasks were incubated at 37°C in a humidified atmosphere of 90% air-10% CO₂, and passages 15–20 were used in the experiments. The stable ornithine decarboxylase (ODC)-transfected IEC-6 cells (IEC-ODC) were developed and characterized as described (39, 40) and cultured in DMEM medium used for growing IEC-6 cells. The Caco-2 cells (a human colon carcinoma cell line) were obtained from American Type Culture Collection (Cat. No. HTB37) at passage 16. They were maintained similarly to the IEC-6 cells except that Caco-2 cells were maintained in an atmosphere of 95% air and 5% CO₂. The medium used was Eagle’s minimum essential medium with 10% heat-inactivated FBS, and passages 18–23 were used for the experiments as described previously (41, 42).

RT and Quantitative Real-Time PCR Analyses

Total RNA was isolated using RNeasy Mini Kit (Qiagen) and used in reverse transcription (RT) and PCR amplification reactions as described (25, 26, 43). The levels of Gapdh PCR product were assessed to monitor the evenness of RNA input in RT-PCR samples. Quantitative real-time PCR (qPCR) analysis was performed using 7500-Fast Real-Time PCR Systems with specific primers, probes, and software (Applied Biosystems). For miRNA studies, the levels of miR-195 were quantified by qPCR using a TaqMan MicroRNA assay (Applied Biosystems); small nuclear RNA (snRNA) U6 was measured as an endogenous control.

Plasmid Construction

The fragments of ARP-2 5′-untranslated region (UTR), coding region (CR), 3′-UTR-F1, and 3′-UTR-F2 (NCBI reference sequence number: NM_005722.3) were subcloned into the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Cat. No. P1330, Promega, Madison, WI) to generate the pmirGLO-Luc-ARP2 5′UTR, CR, 3′UTR-F1, and 3′UTR-F2 reporter constructs as described (26, 43). The primer sequences for generating these constructs were shown in Table 1. Transient transfections in IEC-6 cells were performed using Lipofectamine Reagent as recommended by the manufacturer, and the levels of firefly luciferase activity were normalized to Renilla luciferase activity.

Table 1.

Primers used for ARP-2 luciferase reporters

ARP-2 Luc-5′UTR F	GAGCTCACCGCTGCCAGTCG
ARP-2 Luc-5′UTR R	CGTCCGCCCAGGGAAGAGC
ARP-2 Luc-CR F	ATGGACAGCCAGGGCAGG
ARP-2 Luc-CR R	TTATCGAACAGTCACACC
ARP-2 Luc-3′UTR F1-F	ACTCCAAAGCTTGTTCCCG
ARP-2 Luc-3′UTR F1-R	GCAGAGCACAAGTAGAAGAA
ARP-2 Luc-3′UTR F2-F	CTGGAGCTGTTTCCATATGA
ARP-2 Luc-3′UTR F2-R	TAGCTTTCCACTGATATCTC

Western Immunoblotting Analysis

Whole cell lysates were prepared using 2% SDS, sonicated, and centrifuged (12,000 rpm) at 4°C for 15 min as described previously (44, 45). Briefly, the supernatants were boiled for 5 min and size fractionated by SDS-PAGE (10% acrylamide). After proteins were transferred onto nitrocellulose membranes, the membranes were incubated for 1 h in 5% nonfat dry milk in 1× TBS-T buffer (0.1% Tween-20). Immunologic evaluation was then performed overnight at 4°C in 5% non-fat dry milk/TBS-T buffer containing a specific antibody against ARP-2 or ARP-3. The membranes were subsequently washed with 1× TBS-T and incubated with secondary antibodies conjugated with horseradish peroxidase for 1 h at room temperature. The immunocomplexes on the membranes were reacted for 1 min with Chemiluminiscence Reagent (NEL-100 DuPont NEN). Antibody dilutions were used for ARP-2 (First Ab 1:1,000; second AB 1:2,000); ARP-3 (First Ab 1:1,000; second Ab 1:2,000), and GAPDH (First Ab 1:1,000; second Ab 1:1,000).

Biotin-Labeled miR-195 Pull-Down Assays

Binding of miR-195 to target mRNAs was examined by RNA pull down assay using biotin-labeled miR-195 as described previously (25, 26, 29, 34). Briefly, cells were transfected with biotin-labeled miR-195, and whole cell lysates were collected 24 h after the transfection. The cell lysates were mixed with streptavidin-conjugated Dynabeads and incubated at 4°C with rotation overnight. After the beads were washed thoroughly, the bead-bound RNA was isolated and subjected to RT-PCR followed by qPCR analysis. Input RNA was extracted and served as a control.

Assay of Newly Translated Protein

New synthesis of nascent ARP-2 and ARP-3 proteins was detected by Click-iT protein analysis detection kit (Cat. No. C33372, Life technologies, Grand Island, NY) and performed following the company’s manual. Briefly, IEC-6 cells were incubated in methionine-free medium and then exposed to l-azidohomoalanine (AHA). After cell lysates were mixed with the reaction buffer for 20 min, the biotin-alkyne/azide-modified protein complex was pulled down using paramagnetic streptavidin-conjugated Dynabeads. The pull-down material was resolved by 10% SDS-PAGE and analyzed by Western immunoblotting analysis using antibodies against ARP-2, ARP-3, or GAPDH.

Measurement of Cell Migration

Migration assays were carried out as described previously (40, 44, 45). IECs were plated at 6.25 × 10⁴/cm² in DMEM medium containing FBS on 60-mm dishes thinly coated with Matrigel according to the manufacturer’s instructions (BD Biosciences, Bedford, MA) and were incubated as described for stock cultures. To initiate migration, the cell layer was scratched with a single edge razor blade cut to ∼27 mm in length. The scratch was made over the diameter of the dish and extended over an area 7–10 mm wide. The migrating cells in six contiguous 0.1-mm squares were counted at ×100 magnification beginning at the scratch line and extending as far out as the cells had migrated. All experiments were carried out independently 3–5 times, and the results were reported as number of migrating cells per millimeter of scratch.

F-Actin Staining

The immunofluorescence staining procedure was carried as described previously (46, 47). Following the 6 h migration after wounding, slides were fixed in 3.7% formaldehyde in phosphate-buffered saline and rehydrated. All slides were incubated with an antibody recognizing F-actin stress fibers with Alexa Fluor 488 Phalloidin for 2 h at room temperature. After rinsing three times, the slides were washed, mounted, and viewed through a Zeiss confocal microscope (model LSM710). Slides were examined in a blinded fashion by coding them, and only after examination was complete, they were decoded. Images were processed using Photoshop software (Adobe, San Jose, CA).

Statistical Analysis

All data for migration experiments are expressed as means ± SE from six dishes in each experiment and independently repeated three times (n = 3). qRT-PCR and immunoblotting analyses were repeated three times (n = 3). The significance of the difference between means was determined by one-way ANOVA with Dunnett’s post hoc test (GraphPad Instat Prism 9, San Diego, CA). The level of significance was determined using the Duncan’s multiple-range test (48) and values of P < 0.05 were considered statistically significant.

RESULTS

miR-195 Interacts with and Represses ARP2 mRNA Translation

To determine the role of miR-195 in the regulation of ARP-2 expression, we analyzed the association of miR-195 with the ARP2 mRNA in cultured IEC-6 cells. Using the program RNA22, we found that there were two computationally predicted binding sites of miR-195 within the 3′UTR of the ARP2 mRNA (Fig. 1A). First, we examined the association of miR-195 with the ARP2 mRNA by RNA pull-down assay using biotin-labeled miR-195 as reported previously (26, 29). Twenty-four hours after transfection, miR-195 levels increased significantly (Fig. 1B, left), whereas the levels of the housekeeping noncoding RNA U6 did not (Fig. 1B, right). ARP2 mRNA was enriched in the materials pulled down by transfected biotin-miR-195 but not from cells transfected with a control biotinylated scramble RNA (Fig. 1C, left). The association of miR-195 with the ARP2 mRNA was specific, since increasing the levels of biotin-miR-195 did not increase its interaction with Cav1 mRNA. In addition, transfection with biotin-labeled miR-195 failed to alter the steady-state levels of total ARP2 and Cav1 mRNAs (Fig. 1C, right).

Figure 1.

miR-195 interacts with and inhibits ARP2 mRNA translation. A: schematic representation of ARP2 mRNA depicting predicted target sites for miR-195 in its 3'-UTR. B: levels of miR-195 (left) and U6 RNA (right) 24 h after transfection with biotinylated miR-195. Values are the means ± SE from three independent experiments (n = 3 replicates). *P < 0.05 compared with cells transfected with scramble oligomer. C: binding of biotinylated miR-195 to mRNAs encoding ARP2 and Cav1. Levels of mRNAs in the materials pulled down by biotin-miR-195 (left) and levels of total input mRNAs (right). *P <0.05 compared with scramble oligomer (n = 3). D: levels of miR-195 (left) and U6 RNA (right) 24 and 48 h after transfection with pre-miR-195. *P <0.05 compared with scramble oligomer (n = 3 replicates). E: changes in ARP-2 and ARP-3 proteins in cells treated as described in D. Whole cell lysates were harvested and prepared for Western blotting; equal loading was monitored by assessing GAPDH. F: levels of ARP2 mRNA (left) and newly synthesized ARP-2 and ARP-3 proteins (right) as measured by l-azidohomoalanine (AHA) incorporation assays in cells treated as described in D. Three separate experiments were performed and showed similar results. Statistical significance was analyzed by one-way ANOVA followed by Duncan’s test. ARP, actin-related protein; UTR, untranslated region.

Second, we investigated the functional consequence of miR-195 association with the ARP2 mRNA by increasing the levels of cellular miR-195 through transfection of the miR-195 precursor (pre-miR-195). IEC-6 cells transfected with pre-miR-195 for 24 and 48 h showed dramatic increase in the levels of miR-195 compared with those seen in cells transfected with the scramble oligomer (Fig. 1D). Ectopically expressed miR-195 reduced the levels of ARP-2 protein without effecting ARP-3 levels (Fig. 1E). On the other hand, miR-195 overexpression did not alter ARP2 mRNA abundance (Fig. 1F, left). To examine whether miR-195 altered the translation of ARP2 mRNA, we determined changes in the level of nascent ARP-2 protein synthesis after transfection with pre-miR-195 and found that newly synthesized ARP-2 protein decreased in cells overexpressing miR-195, compared with cells transfected with the scramble oligomer (Fig. 1F, right); this effect was specific, since the levels of nascent ARP-3 and GAPDH proteins were not affected by transfection of pre-miR-195.

Third, we examined the influence of decreasing the levels of miR-195 by transfecting anti-miR-195 oligo on ARP-2 expression. The levels of miR-195 decreased remarkably 24 and 48 h after transfection with anti-miR-195 without effect on U6 RNA levels (Fig. 2A). Decreased levels of miR-195 by anti-miR-195 stimulated expression of ARP-2, as shown by an increase in the levels of ARP-2 protein (Fig. 2B), although it did not affect the ARP-3 protein levels. As expected, miR-195 silencing failed to alter the levels of ARP2 mRNA (Fig. 2C).

Figure 2.

miR-195 silencing enhances the expression of ARP-2. A: levels of miR-195 (left) and U6 RNA (right) 24 and 48 h after transfection with anti-miR-195. Values are the means ± SE from three independent experiments (n = 3 replicates). *P < 0.05 compared with cells transfected with scramble oligomer. B: immunoblots of ARP-2 and ARP-3 proteins in cells described in A. Whole cell lysates were harvested and prepared; equal loading was monitored by assessing GAPDH levels. C: levels of ARP2 mRNA in cells described in A. D: levels of the Luc reporter activity 48 h after transfection with pre-miR-195. Left: schematic representation of different chimeric firefly luciferase (Luc) reporters bearing the ARP2 5′UTR, CR, and 3′UTR fragments (F). *P < 0.05 compared with scramble oligomer (n = 3 replicates). Statistical significance was analyzed by one-way ANOVA followed by Duncan’s test. ARP, actin-related protein; CR, coding region; UTR, untranslated region.

Fourth, we determined whether repression of ARP-2 translation by miR-195 was mediated through specific binding sites in the ARP2 mRNA. To do so, fractions of 5′UTR, CR, and partial transcripts of the 3′UTR with (F1) or without (F2) predicted binding sites were cloned into the pmirGLO dual-luciferase miRNA target expression vector to generate various pmirGLO-Luc reporter constructs (Fig. 2D, schematic, left). Increasing the levels of miR-195 by transfection with pre-miR-195 selectively decreased the activity of Luc-3'UTR-F1 luciferase reporter bearing with miR-195 binding sites but it did not decrease the activities of Luc-5′UTR, CR, or Luc-3′UTR-F2 containing no miR-195 sites (Fig. 2D, right). Taken together, these results indicate that miR-195 directly interacts with the ARP2 mRNA via its 3′UTR and inhibits ARP-2 translation in cultured IECs.

Inhibition of ARP2 by miR-195 Decreases Intestinal Epithelial Restitution after Wounding

To determine the role of miR-195-regulated ARP-2 in intestinal epithelial repair after wounding, an in vitro model that mimics proliferation‐independent and rapid epithelial restitution (40, 44, 45) was used in this study. IEC-6 cells were initially grown for 2 days and then transfected with pre-miR-195 alone or cotransfected with pre-miR-195 and an ARP-2 expression vector. As shown in Fig. 3A, increasing the levels of miR-195 by transfection with pre-miR-195 decreased ARP-2 protein levels, but this repression was prevented by overexpressing ARP-2. In fact, the protein levels of ARP-2 increased slightly when cells were cotransfected with pre-miR-195 and the ARP-2 expression vector. However, protein levels of ARP-3 were not affected by either transfection with pre-miR-195 alone or cotransfection with pre-miR-195 and ARP-2 vector. Consistent with our previous studies (29, 34), ectopically expressed miR-195 by transfection with pre-miR-195 inhibited cell migration after wounding. Interestingly, miR-195-induced inhibition of cell migration was almost completely prevented by overexpressing ARP-2 (Fig. 3B). The numbers of migrating cells over the denuded area in cells cotransfected with pre-miR-195 and ARP-2 expression vector were indistinguishable from those observed in control cells.

Figure 3.

miR-195-regulated ARP-2 modulates rapid epithelial restitution after wounding. A: immunoblots of ARP-2 and ARP-3 proteins 48 h after transfection with pre-miR-195 alone or cotransfected with pre-miR-195 and ARP-2 expression vector. Equal loading was monitored by assessing GAPDH levels. Three separate experiments were performed that showed similar results. B: summarized data showing rates of cell migration 6 h after wounding in cells described in A. Values are the means ± SE of data from 6 dishes and repeated three times independently (n = 3 replicates). *,⁺P < 0.05 compared with control and cells transfected with pre-miR-195 alone, respectively as analyzed by one-way ANOVA followed by Duncan’s test. C: immunoblots of ARP-2 and ARP-3 proteins 48 h after transfection with either C-siRNA or siARP2 (n = 3 replicates). D: summarized data showing rates of cell migration 6 h after wounding in cells described in C. Values are the means ± SE of data from 6 dishes and repeated three times independently (n = 3 replicates). *P < 0.05 compared with C-siRNA as analyzed by one-way ANOVA followed by Duncan’s test. ARP, actin-related protein.

To further examine the effect of ARP-2 silencing on epithelial restitution, specific siRNA targeting ARP2 mRNA (siARP2) was used to cleave the ARP2 mRNA and inhibit ARP-2 expression. Transfection with siARP2 for 24 and 48 h decreased ARP-2 protein levels by ∼50% and ∼75%, respectively (Fig. 3C). This inhibition of ARP-2 was specific because the protein levels of ARP-3 were not affected when cells were transfected with siARP2. Decreased levels of ARP-2 by transfection with siARP2 suppressed cell migration after wounding (Fig. 3D). Neither ARP-2 expression nor cell migration was decreased when cells were transfected with C‐siRNA. In addition, transfection with siARP2 or C‐siRNA did not alter cell viability as measured by Trypan blue staining (data not shown). These results indicate that decreasing the levels of ARP-2 by miR-195 compromises intestinal epithelial restitution after wounding.

Polyamines Regulate ARP-2 Expression by Altering miR-195

Polyamines, including spermidine, spermine, and their precursor putrescine, are organic cations found in all eukaryotic cells and act as biological regulators of gut epithelial homeostasis (27, 37, 38, 44, 49). Polyamine biosynthesis is predominantly dependent on the activity of the key rate-limiting enzyme ornithine decarboxylase (ODC) (37). Since polyamines are essential for stimulation of cell migration over the wounded area and also implicated in the regulation of miRNA biogenesis (27, 37, 38, 47, 49), we examined if polyamines regulate ARP-2 expression via miR-195. To determine the effect of polyamine depletion on miR-195 and ARP-2 expression, IEC-6 cells were exposed to DFMO (5 mM), a specific inhibitor of ODC (37, 38), to decrease cellular polyamines. As reported previously (39, 50), exposure to DFMO for 4 days completely depleted putrescine and spermidine and substantially decreased spermine content. Interestingly, polyamine depletion by DFMO increased miR-195 levels (Fig. 4A) but decreased ARP-2 levels (Fig. 4B) without affecting ARP-3 content. Decreased ARP-2 by polyamine depletion also inhibited cell migration after wounding (Fig. 4C). Exogenous polyamine putrescine (10 µM) given together with DFMO prevented an induction in miR-195 level, abolished an inhibition of ARP-2, and restored cell migration to near normal levels after wounding. Moreover, transfection with anti-miR-195 partially prevented inhibition of cell migration in polyamine-deficient cells (Fig. 4C, right).

Figure 4.

Polyamine depletion increases miR-195 but decreases ARP-2 and cell migration. A: levels of miR-195 (left) and U6 RNA (right). IEC-6 cells were grown in the medium containing DFMO (5 mM) alone or DFMO plus putrescine (Put, 10 μM) for 4 days. Values are the means ± SE from three independent experiments (n = 3 replicates). *P < 0.05 compared with control cells or cells treated with DFMO plus Put. B: immunoblots of ARP-2 and ARP-3 proteins in cells treated as described in A. Three separate experiments were performed that showed similar results. C: summarized data showing cell migration 6 h after wounding in cells exposed to 5 mM DFMO for 2 days and then transfected with anti-miR-195 for additional 48 h in the presence of DFMO. Values are means ± SE of data from 6 dishes and repeated three times independently. *P < 0.05 compared with controls or cells treated with DFMO plus Put. ⁺P < 0.05 versus DFMO alone. Statistical significance was analyzed by one-way ANOVA followed by Duncan’s test. ARP, actin-related protein; DFMO, difluoromethylornithine; IECs, intestinal epithelial cells.

To determine the effect of elevation of cellular polyamines on miR-195 and ARP-2 expression, two clonal populations of IECs stably overexpressing ODC (ODC-IEC) (39, 40) were used in this study. These stable ODC-IECs exhibited very high levels of ODC protein and greater than 50-fold increase in ODC enzyme activity (39). Consistently, the levels of putrescine, spermidine, and spermine in ODC-IEC cells were increased by ∼12-fold, ∼2-fold, and ∼25%, respectively, when compared with cells transfected with the control vector lacking Odc cDNA, similar to the results published previously (39, 50). As shown in Fig. 5A, there were significant decreases in the levels of miR-195 in ODC-IEC cells, although the U6 RNA levels remained unchanged. The levels of ARP-2 proteins increased significantly in ODC-IEC cells relative to control cells (Fig. 5B, top). Observed changes in the levels of miR-195 and ARP-2 in ODC-IEC cells were not simply due to clonal variation, since two stable clones, ODC-IEC-C1 and ODC-IEC-C2, showed similar results. On the other hand, there were no significant differences in the levels of ARP-3 protein between ODC-IEC cells and control cells (Fig. 5B, middle). Increasing the levels of cellular polyamines by ectopic ODC overexpression also increased the epithelial restitution, as indicated by an increase in cell migration after wounding in stable ODC-IECs (Fig. 5C). Moreover, decreased levels of ARP-2 by miR-195 overexpression partially inhibited cell migration after wounding in ODC-IEC cells (Fig. 5C). Taken together, these results indicate that polyamines stimulate ARP-2 expression by decreasing miR-195, thus enhancing epithelial restitution after wounding.

Figure 5.

Elevation of cellular polyamines decreases miR-195 levels but increases ARP-2 and cell migration. A: levels of miR-195 (left) and U6 RNA (right) in clonal (c) populations of stable ODC-IEC cells and control cells (Vector). IEC-6 cells were infected with either the retroviral vector containing the sequence encoding mouse ODC cDNA or control retroviral vector lacking ODC cDNA. Clones resistant to the selection medium containing 0.6 mg/mL G418 were isolated and screened for ODC expression. Values are the means ± SE from three independent experiments (n = 3 replicates). *P < 0.05 compared with Vector. B: representative immunoblots of ARP-2 and ARP3 proteins in cells as described in A. Three separate experiments were performed that showed similar results. C: summarized data showing cell migration 6 h after wounding in ODC-IEC-C1 cells transfected with pre-miR-195 for 48 h. Values are the means ± SE of data from 6 dishes and repeated three times independently (n = 3 replicates). *,#P < 0.05 compared with Vector and ODC-IEC cells, respectively as analyzed by one-way ANOVA followed by Duncan’s test. ARP, actin-related protein; IEC, intestinal epithelial cell; ODC, ornithine decarboxylase.

Changes in F-Actin Subcellular Distribution in Cells Overexpressing miR-195

To investigate the mechanism underlying miR-195/ARP2-regulated cell migration, we examined the effects of elevation of miR-195 levels on subcellular distribution of F-actin after wounding. In the first set of studies, IECs were initially grown for 2 days and then transfected with pre-miR-195 alone or cotransfected with pre-miR-195 and ARP-2 overexpression vector. Cells were wounded 48 h after transfection, and F-actin immunofluorescence staining was carried out 6 h after wounding as described previously (46). As shown in Fig. 6A (left), there were long stress fibers that traversed the cytoplasm in IECs transfected with the scramble oligomer; a thick network of F-actin fibers was observed just inside the plasma membrane in migrating cells after wounding. Ectopically expressed miR-195 inhibited the formation of F-actin stress fibers, since F-actin stress fibers were sparse and devoid of long stress fiber formation across the cytoplasm (Fig. 6A, middle). When the cells were cotransfected with both pre-miR-195 and ARP-2 expression vector, however, the formation of F-actin stress fibers restored to near normal distribution (Fig. 6A, right).

Figure 6.

Changes in subcellular distribution of F-actin cytoskeleton after wounding in the presence or absence of ARP-2 or miR-195. A: images of F-actin reorganization in cells transfected with pre-miR-195 alone or cotransfected with pre-miR-195 and ARP-2 expression vector. Forty-eight hours after transfection, cells were fixed, permeabilized, and incubated with Alexa Fluor 488 phalloidin conjugated with FITC. Migrating edge of cells was shown at 6 h after removal of part of the monolayer. Scale bar: 100 µM. Three separate experiments were performed that showed similar results. B: effect of miR-195 silencing on F-actin distribution in polyamine-deficient cells after wounding. Cells were grown were grown in the medium containing DFMO for 2 days and then transfected with anti-miR-195. Forty-eight hours after transfection in the presence of DFMO, cells were fixed 6 h after wounding for F-actin immunostaining. Scale bar: 100 µM. ARP, actin-related protein; DFMO, difluoromethylornithine.

Compared with control cells (Fig. 6B, left), polyamine-deficient cells also exhibited reduced formation of F-actin stress fibers after wounding (Fig. 6B, middle). In DFMO-treated cells, long stress fibers disappeared, and no distinct F-actin stress fibers were observed, similarly to the observations in cells overexpressing miR-195 (Fig. 6A, middle). Importantly, silencing miR-195 by transfection with anti-miR-195 in DFMO-treated cells restored the distribution of F-actin and formation of stress fibers to near normal (Fig. 6B, middle vs. right). The distribution of F-actin in migrating cells grown in the presence of DFMO plus anti-miR-195 was identical to those observed in control cells. These results strongly suggest that miR-195-regulated ARP-2 is crucial for the formation of F-actin stress fibers and their subcellular organization, thus promoting cell migration over the wounded area after injury. Taken together, our findings suggest a model whereby miR-195 regulates intestinal epithelial restitution by altering ARP2 translation via direct interaction with the ARP2 mRNA (Fig. 7). Disruption of ARP2/3 complex by increasing miR-195 reduces the formation of F-actin stress fibers and impairs cell migration over the wounded area. On the other hand, cellular polyamines enhance ARP2 expression by decreasing miR-195 levels, thus stimulating intestinal epithelial restitution after wounding.

Figure 7.

Model proposed to explain the role of miR-195 in the regulation of ARP-2 translation and intestinal epithelial restitution in the absence or presence of cellular polyamines after wounding. miR-195 directly interacts with the ARP-2 mRNA via its 3′UTR and inhibits ARP-2 translation. Decreased ARP-2 by increasing miR-195 reduces formation of the F-actin stress fibers and delays epithelial restitution after wounding. Increased polyamines enhance ARP-2 expression by decreasing miR-195 levels, thus promoting F-actin stress fiber formation and stimulating epithelial restitution. ARP, actin-related protein; UTR, untranslated region.

DISCUSSION

Early epithelial restitution in intestinal mucosa occurs by sloughing the damaged epithelial cells and migration of remaining viable cells from areas adjacent to or just beneath the injured surface to cover the wounded area rapidly (1, 2, 51). Although this primary repair modality is crucial for the maintenance of gut mucosal integrity, the exact mechanism underlying the control of epithelial restitution remains largely unknown. Our previous studies show that miR-195 acts as a negative regulator of intestinal epithelium homeostasis by downregulating the function of Tuft and Paneth cells and disrupting mucosal renewal, whereas transgenic expression of miR-195 in mice increases the vulnerability of the gut barrier to pathological stress (26, 29, 34). The present study advances our knowledge and provides new evidence that miR-195 inhibits intestinal epithelial restitution by repressing ARP-2 translation via direct interaction with its mRNA. Our findings also indicate that polyamines are essential for ARP-2 expression by lowering miR-195 levels, thus enhancing intestinal epithelial restitution after wounding.

The ARP2/3 complex promotes the assembly of new actin filaments by linking to older filaments to elongate and is responsible for the formation of several actin structures such as lamellipodia (5, 10, 12, 52). It has been reported that The ARP2/3 complex is required for lamellipodia extension and directional cell migration of fibroblasts (53) and that activities of both ARP2 and ARP3 are involved in the generation of perinuclear actin network to induce cell motility in complex environments (54). In addition, inhibition of the ARP2/3 complex represses human lung myofibroblast differentiation and attenuates bleomycin-induced pulmonary fibrosis (55). However, ARP2 and ARP3 levels are differentially regulated in gut mucosa and other tissues (56). For examples, several miRNAs, including miR-124, miR-129, miR-24, and miR-198, modulate ARP-2 expression at the posttranscriptional level (57–59), but their functions in regulating the ARP3 expression remain unknown. In this study, we identified miR-195 as a novel repressor of ARP-2 translation by directly interacting with its mRNA in cultured IECs. As shown, miR-195 associated with ARP2 mRNA as measured by RNA pulldown assays using biotin-labeled miR-195, whereas ectopically expressed miR-195 decreased ARP-2 protein levels without effect on the ARP3 content. In support of these findings, there are two computationally predicted binding sites of miR-195 in the 3′-UTR of the ARP2 mRNA, whereas deletion of these two binding sites prevented miR-195-induced repression of ARP-2 translation as measured by luciferase reporter assays. Consistent with the present study, miR-195 regularly binds to its target mRNAs such as Igf2R, Dclk1, Stim1 through 3′-UTRs (26, 29, 34), although it can also interact occasionally with CR of target transcripts (22).

miR-195-modulated expression of ARP2 is of biological significance and plays a critical role in the regulation of intestinal epithelial restitution after wounding. The epithelium of the intestinal mucosa is a rapidly self-renewing tissue, and its homeostasis is preserved through strict regulation of cell proliferation, migration, differentiation, and apoptosis (28, 37, 41). Decreasing the levels of ARP-2 by increasing miR-195 inhibited cell migration, but this inhibition of cell migration in pre-miR-195 transfected cells was almost totally prevented by overexpressing ARP-2. Similarly, silencing ARP-2 levels by siARP2 were also associated with an inhibition in IEC migration over the wounding area. Intestinal epithelial restitution is tightly controlled by many factors including STIM1 (29), TRPC1 (60), Caveolin-1 (45), Rac1 (61), α4 (41), β-PIX/GIT1 association (40), Wnt signaling (42), and Cdc42 (46). On the other hand, the activity of these signaling pathways is also highly regulated by numerous intracellular and extracellular factors including RNA-binding proteins (RBPs) (22, 62), miRNAs (25, 27, 29, 30), circular RNAs (28), and cellular polyamines (37, 38, 44, 50). The current studies advance our knowledge and provide additional evidence showing that ARP-2 functions as an enhancer of epithelial restitution after wounding and its expression levels are negatively regulated by cellular miR-195 at the posttranscriptional level.

Our results also show that cellular polyamines regulate ARP-2 translation by altering the level of miR-195. Polyamines have been recognized for many years as key molecules that control multiple signaling pathways and have distinct cellular functions (37, 38, 49). The levels of cellular polyamines in IECs are highly regulated and depend on the dynamic balance among polyamine biosynthesis, degradation, and transport. Our current studies clearly demonstrate that decreasing the levels of cellular polyamines by DFMO increased miR-195, whereas miR-195 expression level decreased in cells containing high levels of polyamines in ODC-IEC cells. Although the exact mechanism by which polyamines regulate miR-195 expression remains unknown, increased levels of ARP-2 by lowering miR-195 in ODC-IEC cells were associated with an increase in cell migration after wounding. On the other hand, increased cell migration in ODC-IEC cells was prevented by decreasing ARP-2 through miR-195 overexpression. Consistent with our observations, polyamines influence multiple cellular processes including gene transcription (42, 50), posttranscriptional events (34, 39), protein phosphorylation (45, 63), and protein subcellular trafficking (62), thus playing a critical role in gut epithelium homeostasis.

miR-195-regulated ARP-2 modulates cell migration after wounding at least partially by altering the formation of F-actin stress fibers. The number of long F-actin stress fibers decreased significantly in cells overexpressing miR-195, but this disruption of subcellular organization of actin cytoskeleton was abolished by ARP-2 overexpression. Similarly, decreased ARP-2 by increasing endogenous miR-195 in polyamine-deficient cells also exhibited reduced levels of long F-actin stress fibers, which was prevented by increasing ARP-2 through miR-195 silencing. In summary, our results indicate that miR-195 downregulates ARP-2 expression at the translation level through a direct interaction with ARP2 mRNA and that miR-195-regulated ARP-2 plays an important role in the control of intestinal epithelial restitution after wounding. Polyamines are essential for normal ARP-2 expression by reducing miR-195 levels, whereas polyamine depletion decreases cellular ARP-2 abundance by increasing endogenous miR-195. Since ARP-2 is required for stimulation of cell migration after wounding and its cellular level is tightly regulated by numerous factors at different levels, the control of ARP-2 expression by miR-195 is critical for maintaining the intestinal epithelial integrity under biological and pathological conditions.

GRANTS

This work was supported by Merit Review Awards from US Department of Veterans Affairs Grants BX-000713, BX-000113, and BX000332 (to J.N.R., D.J.T., and J-Y.W.) and National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-57819, DK-61972, and DK-68491 (to J-Y.W.).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

N.R. and J.N.R. conceived and designed research; S.R.W., N.R., M.S.K., L.X., and H.K.C. performed experiments; S.R.W., N.R., M.S.K., L.X., D.J.T., and J.N.R. analyzed data; H.K.C., D.J.T., J-Y.W., and J.N.R. interpreted results of experiments; S.R.W. and J.N.R. prepared figures; J.N.R. drafted manuscript; J-Y.W. and J.N.R. edited and revised manuscript; S.R.W., N.R., M.S.K., L.X., H.K.C., J-Y.W., and J.N.R. approved final version of manuscript.