Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
editorial
. 2000 Mar;44(3):806–807. doi: 10.1128/aac.44.3.806-807.2000

A Point Mutation Associated with Bacterial Macrolide Resistance Is Present in Both 23S rRNA Genes of an Erythromycin-Resistant Treponema pallidum Clinical Isolate

L V Stamm 1,*, H L Bergen 1
PMCID: PMC89774  PMID: 10755994

Treponema pallidum subsp. pallidum (T. pallidum) is the noncultivable agent of syphilis, a sexually transmitted disease that is a risk factor for HIV infection (9). Penicillin is the preferred drug for treatment of syphilis (1). Alternative antibiotics for nonpregnant penicillin-allergic patients with primary or secondary syphilis include doxycycline, tetracycline, or erythromycin. Erythromycin treatment failures have been documented in patients with primary or secondary syphilis and infants with congenital syphilis (2, 3, 5). We previously demonstrated high-level erythromycin resistance (Ermr) in a T. pallidum clinical isolate (Street strain 14) obtained from a syphilis patient who failed erythromycin therapy (11). Macrolide resistance usually results from target site alteration due to methylation or mutations in the peptidyltransferase region of 23S rRNA. Mutations of the adenine (A) residue cognate to position A2058 or A2059 in the Escherichia coli 23S rRNA gene are associated with macrolide resistance in bacteria that contain one or two copies of these genes (6–8, 13). This observation prompted us to analyze the corresponding regions of the two 23S rRNA genes of T. pallidum Street strain 14 (Ermr); T. pallidum Nichols strain, an erythromycin-sensitive (Erms) control (11); and the closely related yaws agent, T. pallidum subsp. pertenue (T. pertenue) Gauthier strain (Erms) (11).

T. pallidum strains were grown by testicular cultivation in rabbits, and genomic DNA was extracted as previously described (11, 12). T. pertenue genomic DNA was provided by A. Centurion-Lara and S. Lukehart. Both copies of the 23S rRNA genes were PCR amplified from treponemal genomic DNA (Expand Long Template PCR System; Boehringer-Mannheim, Indianapolis, Ind.). Oligonucleotide primers were designed based on sequence data from the T. pallidum Nichols genome sequencing project (GenBank accession no. AE001204 and AE001208) (4). Gel-purified PCR amplicons were cloned (pGEM-T Easy vector; Promega Corp., Madison, Wis.), and both strands of the inserts were sequenced at the University of North Carolina, Chapel Hill, Automated DNA Sequencing Facility as previously described (12).

A 692-bp region (representing 133 nucleotides 5′ and 558 nucleotides 3′ of the position cognate to A2058 in the E. coli 23S rRNA gene) was analyzed for T. pallidum and T. pertenue. The nucleotide sequences of this region of both T. pallidum Nichols strain 23S rRNA genes were identical to those of the Nichols strain in GenBank (4). Additionally, the sequences of the same 692-bp region of both T. pertenue Gauthier strain 23S rRNA genes were identical to those of the T. pallidum Nichols strain. Interestingly, the sequences of the 692-bp region of both T. pallidum Street strain 14 23S rRNA genes were identical to those of T. pallidum Nichols strain except that the Street strain 14 sequences contained a guanine (G) at the position cognate to A2058 (Table 1). The A-to-G transition mutation was present in all clones sequenced for both Street strain 14 23S rRNA genes. The identical mutation was also present when the Street strain 14 23S rRNA genes were PCR amplified and directly sequenced.

TABLE 1.

Comparison of the 23S rRNA gene sequences of T. pallidum Nichols and Street strain 14 and T. pertenue in the region containing the cognate to E. coli rDNA A2058

Organism 23S rRNAa Susceptibility to erythromycinb Mutationc
T. pallidum Nichols TAGTTAGACGGAAAGACCCC S —
T. pallidum SS14 TAGTTAGACGGGAAGACCCC R A→G
T. pertenue Gauthier TAGTTAGACGGAAAGACCCC S —
a

Only the relevant portion of the 692-bp region is shown. Sequences of the two 23S rRNA genes for each respective treponeme are identical. The transition mutation in the T. pallidum Street strain 14 (SS14) 23S rRNA gene sequence cognate to E. coli 23S rDNA A2058 is underlined. 

b

Erythromycin susceptibility (S) or resistance (R) was determined previously in an in vitro assay (11). 

c

—, wild type. 

Since rRNA methylase genes do not appear to be present in T. pallidum Street strain 14 (L. Stamm, unpublished data), we propose that the A-to-G transition mutations in both 23S rRNA genes of this spirochete are responsible for its high-level resistance to erythromycin and related macrolides (roxithromycin [11] and azithromycin [10]). Similar point mutations in the 23S rRNA genes of other T. pallidum Street strains may account for erythromycin treatment failures observed in syphilis patients who have complied with their therapeutic regimen. Our results also demonstrate the utility of the T. pallidum Nichols strain complete genome sequence for investigating the genetic basis of antimicrobial resistance in T. pallidum.

Nucleotide sequence accession numbers.

The sequences of the 692-bp region of the 23S rRNA genes of T. pallidum Nichols strain and Street strain 14 and T. pertenue Gauthier strain have been deposited in GenBank under accession numbers AF200367, AF200365, and AF200366, respectively.

Acknowledgments

This research was supported by National Institutes of Health grant AI31496.

REFERENCES

  • 1.Centers for Disease Control and Prevention. Guidelines for treatment of sexually transmitted diseases. Morbid Mortal Weekly Rep. 1998;47(RR-1):28–48. [PubMed] [Google Scholar]
  • 2.Duncan W C. Failure of erythromycin to cure secondary syphilis in a patient infected with the human immunodeficiency virus. Arch Dermatol. 1989;125:82–84. [PubMed] [Google Scholar]
  • 3.Fenton L J, Light I J. Congenital syphilis after maternal treatment with erythromycin. Obstet Gynecol. 1976;47:492–494. [PubMed] [Google Scholar]
  • 4.Fraser C M, Norris S J, Weinstock G M, White O, Sutton G G, Dodson R, Gwinn M, Hickey E K, Clayton R, Ketchum K A, Sodergren E, Hardham J M, McLeod M P, Salzberg S, Peterson J, Khalak H, Richardson D, Howell J K, Chidambaram M, Utterback T, McDonald L, Artiach P, Bowman C, Cotton M D, Fujii C, Garland S, Hatch B, Horst K, Roberts K, Sandusky M, Weidman J, Smith H O, Venter J C. Complete genome sequence of Treponema pallidum, the syphilis spirochete. Science. 1998;281:375–388. doi: 10.1126/science.281.5375.375. [DOI] [PubMed] [Google Scholar]
  • 5.Hashisaki P, Wertzberger G G, Conrad G L, Nichols C R. Erythromycin failure in treatment of syphilis in a pregnant woman. Sex Transm Dis. 1983;10:36–38. doi: 10.1097/00007435-198301000-00008. [DOI] [PubMed] [Google Scholar]
  • 6.Karlsson M, Fellstrom C, Heldtander M U K, Johansson K-E, Franklin A. Genetic basis of macrolide and lincosamide resistance in Brachyspira (Serpulina) hyodysenteriae. FEMS Microbiol Lett. 1999;172:255–260. doi: 10.1111/j.1574-6968.1999.tb13476.x. [DOI] [PubMed] [Google Scholar]
  • 7.Lucier T S, Heitzman K, Liu S K, Hu P C. Transition mutations in the 23S rRNA of erythromycin-resistant isolates of Mycoplasma pneumoniae. Antimicrob Agents Chemother. 1995;39:2770–2773. doi: 10.1128/aac.39.12.2770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sander P, Prammananan T, Meier A, Frischkorn K, Bottger E C. The role of ribosomal RNAs in macrolide resistance. Mol Microbiol. 1997;26:469–480. doi: 10.1046/j.1365-2958.1997.5811946.x. [DOI] [PubMed] [Google Scholar]
  • 9.Stamm L V. Biology of Treponema pallidum. In: Holmes K K, Sparling P F, Mardh P-A, Lemon S M, Stamm W E, Piot P, Wasserheit J M, editors. Sexually transmitted diseases. New York, N.Y: McGraw-Hill; 1999. pp. 467–472. [Google Scholar]
  • 10.Stamm L V, Parrish E A. In-vitro activity of azithromycin and CP-63,956 against Treponema pallidum. J Antimicrob Chemother. 1990;25(Suppl. A):11–14. doi: 10.1093/jac/25.suppl_a.11. [DOI] [PubMed] [Google Scholar]
  • 11.Stamm L V, Stapleton J T, Bassford P J., Jr In vitro assay to demonstrate high-level erythromycin resistance of a clinical isolate of Treponema pallidum. Antimicrob Agents Chemother. 1988;32:164–169. doi: 10.1128/aac.32.2.164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Stamm L V, Greene S R, Bergen H L, Hardham J M, Barnes N Y. Identification and sequence analysis of Treponema pallidum tprJ, a member of a polymorphic multigene family. FEMS Microbiol Lett. 1998;169:155–163. doi: 10.1111/j.1574-6968.1998.tb13312.x. [DOI] [PubMed] [Google Scholar]
  • 13.Taylor D E, Ge Z, Purych D, Lo T, Hiratsuka K. Cloning and sequence analysis of two copies of a 23S rRNA gene from Helicobacter pylori and association of clarithromycin resistance with 23S rRNA mutations. Antimicrob Agents Chemother. 1997;41:2621–2628. doi: 10.1128/aac.41.12.2621. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES