Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Dec 1.
Published in final edited form as: Cancer Chemother Pharmacol. 2021 Sep 15;88(6):985–996. doi: 10.1007/s00280-021-04352-9

Megestrol acetate is a specific inducer of CYP3A4 mediated by human pregnane X receptor

Yakun Chen 1, Yong Tang 1, Jeffrey Z Nie 1, Yuanqin Zhang 1, Daotai Nie 1
PMCID: PMC8978339  NIHMSID: NIHMS1748691  PMID: 34524495

Abstract

Purpose:

Megestrol acetate is a synthetic progestogen used to treat some cancers and cancer-associated cachexia, but its potential interactions with other drugs are not well known. This study aims to determine the regulation of drug metabolizing enzymes by megestrol acetate.

Methods:

Primary human hepatocytes were treated and analyzed by PCR array to identify genes involved in drug metabolism that are impacted by megestrol acetate. P450 3A4 (CYP3A4) reporter gene assay and HPLC analyses of nifedipine metabolites were used to determine CYP3A4 gene expression and activities. Competitive ligand binding assay was used to determine the affinity of megestrol acetate toward human pregnane x receptor (hPXR). Electrophoretic mobility shift assay and mammalian two hybrid assay were used to determine the mechanism of megestrol to activate hPXR.

Results:

The levels and activities of CYP3A4 were significantly induced (> 4-folds) by megestrol acetate in human hepatocytes and HepG2 cells. Megestrol treatment induced CYP3A4 through the activation of hPXR, a ligand-activated transcription factor that plays a role in drug metabolism and transport. Other tested nuclear receptors showed no response. The mechanism studies showed that megestrol activated hPXR by binding to the ligand binding domain (LBD) of hPXR and increasing the recruitment of the cofactors such as steroid receptor cofactor (SRC-1).

Conclusion:

The results suggest that megestrol acetate is a specific inducer of CYP3A4 mediated by hPXR and therefore has the potential to cause drug interactions, especially in the co-administration with drugs that are substrates of CYP3A4.

Introduction

The treatment of cancer often needs a combination of multiple drugs supplemented with many symptomatic therapies, which increases the risk of adverse drug-drug interactions [1]. A significant element of these drug-drug interactions is the pharmacokinetic interactions caused by inhibitions or inductions of drug-metabolizing enzymes (DMEs) or drug transporters [2, 3]. For example, cytochrome P450 (CYP) 3A4, a major CYP expressed in the human gut and liver, is responsible for the metabolism of numerous drugs as well as endogenous compounds [4] and drug-drug interactions [5].

CYP3A4 is highly inducible. Concomitant administration of CYP3A4 inducers limits the oral bioavailability of CYP3A4-metabolized drugs, possibly resulting in sub-therapeutic dosing or even therapeutic failure. For example, in a study of volunteers using irinotecan, the plasma levels of the active metabolite SN-38 decreased by 42% following co-treatment with St. John’s wort, which is a popular herbal preparation for treating depression among cancer patients [6]. Further, CYP3A4 modification of a drug can alter its toxicity profile. For example, elevated blood levels of cytotoxic metabolites of ifosfamide, due to CYP3A4 induced, might increase the morbidity and mortality of patients [7]. On the other hand, it might be possible to enhance drug efficacy through the modulation of CYP3A4 expression [8]. For example, transferring the CYP3A4 gene to tumor sites, and this locally modifying drugs with the site, could enhance their efficacy [7]. Since approximately half of clinical drugs currently in use are metabolized by CYP3A4 [9, 10], it is important to determine which stimuli, including exogenous compounds, regulate in vivo CYP3A4 level or activity and to predict individual responses to drugs that are a substrate of this enzyme.

The expression of CYP3A4 can be modulated by many drugs in a patient through the activation of NR1I nuclear receptors includinghuman pregnane X receptor (hPXR; NR1I2) [3, 11, 12], the human vitamin D3 receptor (hVDR; NR1I1) [13] and the human constitutive androstane receptor (hCAR; NR1I3) [14, 15], with hPXR playing a dominant role in the regulation of CYP3A4. Numerous structurally diverse chemicals have been shown to activate hPXR, ranging from rifampicin, phenobarbital and hyperforin [16] to anticancer drugs like paclitaxel [17] and tamoxifen [18].

Megestrol acetate is a synthetic progestogen with the same physiological effects as natural progesterone. The drug was initially developed as a contraceptive in 1963, and for over 40 years it has been used clinically for the treatment of malignancies including endometrial carcinoma, ovarian cancer, breast cancer, prostate cancer, renal cell carcinoma, hepatocellular carcinoma and malignant melanoma [19–21]. It has been used for the improvement of appetite in patients receiving chemotherapy [22, 23], and to relieve anorexia/cachexia syndrome in patients by using doses larger than those conventionally used to treat breast cancer [24–26]. High blood sugar levels were noticed in patients taking this medication. Little is known about this drug’s chemical interactions except that some data supports the possibility for megestrol acetate to modulate multidrug resistance (MDR) [27, 28].

In the study described here, we determined the effect of megestrol on the expression of various drug metabolism genes in human hepatocytes and extended these findings by investigating the effect of megestrol on hPXR, hVDR and hCAR activities. Our results showed that megestrol specifically increased CYP3A4 mRNA and protein activity levels by the activation of the nuclear receptor hPXR. We found that megestrol activates hPXR via binding to the ligand binding domain (LBD) of hPXR and hence increasing cofactor recruitment, as indicated by the following evidence: 1) megestrol increased interactions between hPXR and steroid receptor coactivator-1 (SRC-1), as demonstrated by the mammalian two-hybrid system; 2) megestrol produced a ligand-induced interaction between hPXR and SRC-1, as demonstrated by the pull-down experiments; and 3) megestrol competed with hPXR agonists for binding to the ligand binding pocket of hPXR. Since no induction/inhibition effects of megestrol on other tested DMEs or transporters were found, megestrol could therefore be a specific modulator of CYP3A4 that can alter the pharmacokinetic profile of chemotherapeutic agents that are substrates of CYP3A4.

Materials and Methods:

Chemicals, Reagents and Cell lines:

HepG2 cells and pGEM3-hVDR vector were obtained from ATCC (Manassas, VA). Fresh primary human hepatocytes were obtained from BD biosciences (Woburn, MA) and maintained in Hepato-STIM™ media supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin, 2mM L-glutamine and 10 ng/ml epidermal growth factor in a humidified 37°C incubator with 95% air / 5% CO2 atmosphere. RNeasy mini kit was from Qiagen (Valencia, CA). RT2 first strand kit, SABiosciences RT2 qPCR master mix and RT2 Profiler™ 96-well PCR Array (PAHS-004) were obtained from SABiosciences (Frederick, MD). The qScript cDNA SuperMix was purchased from Quanta Biosciences (Gaithersburg, MD). Taqman quantitative PCR reagents and primers were purchased from Applied Biosystems (Foster City, CA). Rifampicin was from Biomol International L.P. (Plymouth Meeting, PA). Megestrol; 1α, 25-Dihydroxyvitamin D3; 6-(4-Chlorophenyl) imidazo[2,1-b] [1,3]thiazole-5-carbaldehyde O-3,4-dichlorobenzyl) oxime (CITCO); pregnenolone-16α-carbonitrile (PCN); nifedipine, oxidized nifedipine and nitrendipine were purchased from Sigma-Aldrich (St. Louis, MO). Rabbit anti-CYP3A4 antibody ab22704 was from Abcam (Cambridge, MA). Mouse anti-hPXR antibody (H-11) and rabbit anti- retinoid X receptor, alpha (RXRα) (sc 774X) antibody were purchased from Santa Cruz (Santa Cruz, CA). Dual-luciferase assay kit, MTS reagent, β-galactosidase assay kit, pGL vectors and TNT® T7 quick coupled transcription/translation system were purchased from Promega (Madison, WI). All HPLC grade reagents were from ACROS Organics (Morris Plains, NJ). Rosetta (DE3), PetDuet-1, pet28a and his·bind quick 300 cartridges were acquired from EMD Chemicals Inc. (Gibbstown, NJ). EZ-Link® Sulfo-NHS-LC-biotin, Zeba™ desalt spin column and proFound™ Pull-Down biotinylated protein:protein interaction kit were obtained from Thermo Fisher Scientific (Rockford, IL). Electrophoretic mobility shift assay (EMSA) buffer kit for the Odyssey and Odyssey IRDye secondary antibodies were from Li-COR Biosciences (Lincoln, NE). Other plasmids were gifts from other labs (see acknowledgements).

Cell Viability:

Cytotoxicities of drugs on human hepatocytes were determined by a Vi-Cell™ XR cell viability analyzer (Beckman Coulter, Fullerton, CA). HepG2 cells were plated and treated with drugs at different concentrations or vehicle controls in a 96-well plate for 24 hours. Cell viabilities were then evaluated by MTS assay.

Quantitative RT-PCR:

Tissue total RNA was isolated with an RNeasy mini kit coupled with an on-column DNase treatment. For Taqman-based amplifications, 100 ng of each RNA sample was amplified by a TaqMan one-step RT-PCR assay kit. Each assay contained 0.9 μM forward/reverse primers and 0.25 μM TaqMan probe primer. Assays were performed on an ABI Prism 7500 Fast Real-Time PCR System with the following program: 48°C for 15 min, 95°C for 10 min, and 40 cycles at 95°C for 15 s then at 60°C for 1 min. For SYBR Green-based reactions, RNA was first reverse transcribed into cDNA. Real-time PCR was then carried out with SYBR Green PCR master mix according to the instructions. The sets of primers and probes were designed to span exon junctions to detect any possible contamination of genomic DNA (Table 1). Standard curves were constructed by serial 10-fold dilutions. Gene expression levels were determined by interpolation of threshold cycle (Ct) values to a standard curve. Gene mRNA levels were normalized to the vehicle control and expressed as fold-induction.

Table 1.

Primers used in quantitative RT-PCR.

Genes Forward primers Reverse primers Taqman primers

28S ggtatgggcccgacgct ccgatgccgacgctcat
CYP3A4 tcagcctggtgctcctctatctat aagcccttatggtaggacaaaatattt Fam-ccagggcccacacctctgcct-Tamra
hPXR gcaggagcaattcgccatt tcggtgagcatagccatgatc Fam-ccagcctgctcataggttcttgttcctgaa-Tamra

Western-Blot:

The cell lysates were separated by 10% SDS-polyacrylamide gel electrophoresis. Proteins were then electroblotted onto a polyvinylidene fluoride membrane. After blocking, the membrane was incubated with a primary antibody for 1 hour and a secondary antibody for another hour. The proteins were visualized and quantitated by an Odyssey Infrared Imaging System (Li-COR biosciences).

Metabolism and HPLC Analysis of Nifedipine:

The hepatocytes were incubated in 400 μl of 50 μM nifedipine for 30 min. The metabolism was stopped with 400 μl of acetonitrile and 1 μl of 40 μM nitrendipine. A 20 μl aliquot of supernatants was used for HPLC analysis. Nifedipine (substrate), oxidized nifedipine (a CYP3A4 metabolite) and nitrendipine (the internal control) were analyzed on a Shimadzu LC-20AT HPLC system equipped with a Shimadzu SPD 20AV UV detector. A Thermo scientific hypersil gold column (4.6 × 150 mm, 3 μm), preceded by a C18 precolumn cartridge, was used in all analyses. The mobile phase at a flow rate of 0.5 ml/min comprised of 58% 0.1M sodium phosphate at pH 3.0 and 42% acetonitrile. All compounds were detected at 230 nm and compared with authentic compounds. A standard curve of oxidized nifedipine was constructed, ranging from 500 pg to 200 ng. The limit of quantification (LOQ) was defined as a signal to noise ratio of 10:1, with an acceptable level of variation (<10%).

PCR Array:

PCR array analyses were performed using the standard protocol provided by manufacturer SABiosciences (Frederick, MD). In brief, total RNA was isolated with an efficient on-column digestion of genomic DNA. RNA concentration and integrity were evaluated. Approximately 0.5 μg of total RNA of each sample was reverse transcribed into cDNA. The resulting cDNA was mixed with SYBR green/ROX qPCR master mix. 25 μl aliquots were transferred into a 96-well PCR array, which profiled 40 genes involved in human drug metabolism system, 3 positive PCR controls, 3 reverse transcription controls (RTC), 1 genomic DNA control (GDC) and 5 housekeeping genes. A two-step real-time PCR reaction was performed starting with 1 cycle at 95 °C for10 min followed by 40 cycles of 95 °C for 15 s then 60 °C for1 min. The quality controls were performed by examining the Ct values of GDC and RTC. Genes with Ct values greater than 35 cycles were considered as nondetectable and assigned a value of 35. The data were analyzed by the ΔΔCt method. The average of five housekeeping genes was used to obtain the ΔCt value for each gene of interest. The ΔΔCt value for each gene was calculated by the difference between the ΔCt of the treated group and the ΔCt of the solvent control group. The statistical analysis to determine differences between treatments was performed using the RT2 Profiler PCR array data analysis web-based software (http://www.sabiosciences.com/pcrarraydataanalysis.php, now part of Qiagen).

CYP3A4 Reporter Gene Assay:

HepG2 cells at passage 4 were cotransfected with 0.15 μg of pcDNA3.1-hPXR, pTracer-CMV2-CAR3, pSG5-mPXR/pcDNA3.1-hVDR or their vector controls, 0.15 μg of pGL-CYP3A4-XREM-luc and 10 ng of pGL-CMV-Renilla in each well. The pGL-CYP3A4-XREM-luc plasmid was constructed by inserting two CYP3A4 regulatory elements, a distal enhancer (−7849 to −7219) and a proximate promoter (−369 to +37), into a pGL basic vector [29]. The pcDNA3.1-hVDR plasmid was constructed by subcloning full-length human VDR cDNA from a pGEM3-hVDR plasmid to a pcDNA3.1 vector. Twenty-four hours after transfection, the cells were treated with drugs for 24 hours. Luciferase activities were then measured. The renilla luciferase activity was used as the transfection control.

Competitive Ligand Binding Assay:

This assay was performed by Invitrogen biochemical nuclear receptor profiling service (Madison, WI). Each well in a 96-well plate contained (n = 4): tested compounds or the positive control (SR12813), 40 nM Fluormone™ PXR Green (a green fluorescent PXR ligand), 50 μM DTT, 10 nM purified glutathione transferase (GST)-tagged PXR ligand-binding domain (LBD), 10 nM terbium-labeled anti-GST tag antibody and 1% DMSO. Plates were incubated at room temperature without light and evaporation for 2 hours. The 520nm/490nm ratio was then measured. Negative control without competitor (1% DMSO) and positive control with SR12813 were performed in parallel. The data were analyzed by an IDBS XLfit5.1.0.0 software.

Mammalian Two-Hybrid System:

HepG2 cells at passage 4 were seeded into a 12-well plate. After attachment, cells were cotransfected with 500 ng of Gal4DB-SRC-1-RID, 100 ng of pVP-hPXR, 500 ng of TK-MH100×4-LUC and 200 ng of pCMV-LacZ in each well. Twenty-four hours after transfection, the cells were treated with drugs for 24 hours. Luciferase activities were then measured and normalized with β-gal activities.

In Vitro Interaction Between hPXRLBD and Coactivator:

An his-tagged PXRLBD (residues 130–434) and a human SRC-1 fragment (residues 623–710) were inserted into a petDuet-1 vector and coexpressed in Rosetta (DE3). The soluble PXRLBD fragment was purified and dissolved in TBS buffers. A C-terminal his-tagged human SRC-1 fragment (SRC186, residues 595–780) in pet28a plasmids was expressed in Rosetta (DE3). The fragment was purified, labeled with biotin reagent and immobilized on streptavidin-agarose beads. A pull-down study was then performed using a proFound™ Pull-Down biotinylated protein:protein interaction kit. Elutes were analyzed by SDS-PAGE.

EMSA:

The hRXRα protein and hPXR protein were synthesized in vitro using a TNT® T7 quick coupled transcription/translation system. Two DNA oligonucleotides were synthesized and labeled with IRDye™ 800 CM phosphoramidite at 5’ends (consensus sequences in bold): CYP3A4 pER6, tagaatatgaactcaaaggaggtcagtgagt; CYP3A4 dER6, cccttgaaatcatgtcggttcaagca. In the assays, unlabeled oligonucleotides at a 100-fold molar excess were co-incubated for competition. Proteins were incubated for 20 min at room temperature in darkness with 2.5 nM IRDye -labeled oligonucleotides in 10 mM Tris (pH 7.5), 50 mM KCl, 0.25% Tween20, 5% glycerol, 3.5 mM dithiothreitol, 50 ng/μl poly (dI-dC) and 1×proteinase inhibitor cocktail. Then the mixture was subjected to electrophoresis on a 5% native Tris-glycine-EDTA polyacrylamide gel. Images were scanned and analyzed with an Odyssey infrared scanner at the channel of 800 CM.

Statistics:

Student’s t-test (two-tails) was used to analyze the difference between two groups. A P value between groups, if smaller than 0.05, is considered statistically significant. If the P value is smaller than 0.01, it is considered statistically very significant. All statistical analyses were performed in Microsoft Excel.

Results:

Megestrol is a Specific Inducer of CYP3A4:

To investigate the ability of megestrol to regulate the genes involved in drug metabolism and disposition, a PCR array was performed on human hepatocytes. PCR array showed that megestrol significantly stimulated CYP3A4 approximately 26-fold in donor 2 while not significantly affecting the expression of other tested P450s and transporters with more than fourfold changes (The cut-off boundary was set as fourfold) (Table 2, Fig. 1). After the treatment of megestrol, no significant changes were observed in the mRNA levels of androgen receptor (AR), estrogen receptor 1 (ESR1), estrogen receptor 2 (ESR2), peroxisome proliferator-activated receptor alpha (PPARα), PPARδ, PPARγ, retinoic acid receptor alpha (RARα), retinoic acid receptor, gamma (RARγ), RXRα, RXRβ, or aryl hydrocarbon receptor nuclear translocator (ARNT).

Table 2:

Layout of PCR array

Layout 1 2 3 4 5 6

A ABCB1 ABCC1 ABCC2 ABCC3 ABCC5 ABCC6
1.58* 1.24 1.61 1.17 1.13 1.12
B ABCG2 AR ARNT BLMH CLPTM1L CYP1A1
2.00 −1.36 1.89 1.77 1.29 1.51
C CYP1A2 CYP2B6 CYP2C19 CYP2C8 CYP2C9 CYP2D6
−1.68 2.06 1.35 1.34 1.16 1.09
D CYP2E1 CYP3A4 CYP3A5 DHFR EPHX1 ESR1
−2.09 26.17 3.51 −1.02 1.93 −2.73
E ESR2 GSK3A GSTP1 NAT2 PPARA PPARD
−1.28 1.47 1.25 1.15 1.31 1.05
F PPARG RARA RARG RB1 RELB RXRA
2.46 −2.07 −1.22 1 −1.06 1.17
G RXRB SOD1 SULT1E1 TPMT
1.09 1.25 −1.5 −1.4
*

Folds change of genes

“-“ means down-regulation.

Fig. 1.

Fig. 1

PCR array analyses of genes involved in drug metabolism system. Total RNA was isolated after 2 × 24 h treatment of the cells with 25 μM megestrol or vehicle only (0.2% ETOH). Approximately 0.5 μg of total RNA of each sample was reverse transcribed into cDNA, and mixed with SYBR green/ROX qPCR master mix. 25 μl of aliquots were transferred into a 96-well PCR array, which profiles 40 genes involved in human drug metabolism system, 3 positive PCR controls, 3 reverse transcription controls (RTC), 1 genomic DNA control (GDC) and 5 housekeeping genes. A two-step real-time PCR reaction was performed. The data were analyzed by the ΔΔCt method as detailed in methods section.

a. Heat map of the PCR array data obtained from hepatocytes 2. Red: upregulation; Green: downregulation.

b. Scatter plot of the PCR array data obtained from hepatocytes 2. Boundary: 4 folds.

Levels and Activities of CYP3A4 Are Increased by Megestrol:

To further investigate the effect of megestrol on CYP3A4, we evaluated CYP3A4 mRNA levels in primary human hepatocytes and hepG2 cells after megestrol treatment by using quantitative RT-qPCR analysis. As shown in Fig. 2a, rifampicin (10 μM), the positive control, strongly induced CYP3A4 mRNA expression in all three hepatocytes donors and hepG2 cells, while megestrol (25 μM) caused a moderate induction of CYP3A4 in hepG2 and two the hepatocytes donors 1 and 3 and a strong induction in the hepatocyte donor 2. The tested concentrations were not cytotoxic as determined by a cell viability assay (results not shown). In addition, we found mRNA levels of hPXR in rifampicin or megestrol treated groups did not change significantly when compared to that in vehicle control groups.

Fig. 2.

Fig. 2

The induction of CYP3A4 by megestrol.

a. Megestrol-induced CYP3A4 and hPXR mRNA expression levels. The CYP3A4 or hPXR mRNA levels were determined after 2 × 24 h treatment of the cells with drugs (Rif: rifampicin 10 μM; Meg: megestrol 25 μM). Samples from each drug were assessed at least in triplicate using quantitative Taqman real-time PCR with 28S as the housekeeping gene. The CYP3A4 or hPXR mRNA expression levels are represented as fold induction over the vehicle control (0.2% ETOH). Column, average induction folds. Bar, SD. *, P<0.05; **, P<0.01.

b. CYP3A4 and hPXR protein expression levels. Protein expressions were determined with western blotting after 3 × 24 h treatment with drugs (Rif: rifampicin 10 μM; Meg: megestrol 25 μM). The results are derived from representative experiments.

c. Cell-based CYP3A4 activity assay. CYP3A4 activity was assessed by using nifedipine as substrate after 3 × 24 h treatment with drugs (Rif: rifampicin 10 μM; Meg: megestrol 25 μM). Nitrendipine was used as internal control. 1: oxidized nifedipine (metabolite); 2: nifedipine (substrate); 3: nitrendpine (internal control). The results are derived from representative HPLC analyses.

We then investigated the inductive effects of megestrol on CYP3A4 at the protein level (Fig.2b). The inductions of CYP3A4 were modest in the hepatocyte donors 1 and 3 and hepG2 cells when compared to that in the hepatocyte donor 2. This is in agreement with data obtained at the mRNA level. No increase in protein level of hPXR, P-glycoprotein (P-GP) or multidrug resistance protein 1 (MRP1) was observed when hepatocytes were exposed to megestrol.

The metabolic activity of CYP3A4 was assessed by measuring the formation of oxidized nifedipine after a 0.5 h incubation of the cells with the CYP3A4 probe-substrate nifedipine. As expected, megestrol significantly enhanced the biotransformation of nifedipine to oxidized nifedipine in hepatocyte donor 2 (Fig. 2c). There was an approximately twofold increase in oxidized nifedipine formation in hepatocyte donor 3. However, in hepatocyte donor 1, megestrol did not significantly affect the formation of oxidized nifedipine when compared to the vehicle control.

Megestrol Activates the CYP3A4 Gene Promoter through hPXR:

During the past decade, the expression of the CYP3A4 gene was found to be stimulated by an array of structurally diverse compounds [30]. The interaction of some of these compounds with classic steroid hormone receptors suggests nuclear receptor activation is a major mechanism behind the induction of CYP3A4. Three nuclear receptors, hPXR, hCAR and hVDR have been shown to mediate CYP3A4 gene induction in humans [11, 31, 32]. The potential of megestrol to activate nuclear receptor-mediated CYP3A4 induction was determined in HepG2 cells that were cotransfected with the human nuclear receptors expression plasmids and a CYP3A4 reporter construct. As shown in Fig. 3, megestrol caused a dose-dependent activation of hPXR-mediated CYP3A4 reporter gene activity (Fig.3b) while having no activation on hVDR- or hCAR-mediated CYP3A4 reporter gene activity (Fig.3c). In addition, no significant increase in reporter gene activity was observed in the absence of the nuclear receptor expression plasmids, indicating that the increase in CYP3A4 reporter activity is mediated by hPXR.

Fig. 3.

Fig. 3

Nuclear receptor-mediated transactivation of CYP3A4 promoter.

a. Cell viability of HepG2 cells after 24 hours of megestrol treatments. HepG2 cells were plated and treated with megestrol at different concentrations or vehicle controls in a 96-well plate for 24 hours. Cell viabilities were then evaluated by a MTS assay. Every treatment was repeated in six wells. The viability percentage was obtained by comparing with vehicle control (0.2% ETOH). Column: average viability percentage; Bar: SD.

b. hPXR-mediated transactivation of CYP3A4. HepG2 cells were cotransfected with the pGL3- CYP3A4-XREM reporter construct, nuclear receptor expression vectors, and the pGL-CMV-Renilla control vector. After 24 h of transfection, cells were exposed to megestrol at different concentrations. Rifampicin (10 μM) was used as a prototypical hPXR agonist. After 24 h, luciferase activity was measured. Data are the mean ± SD from three separate determinations and is expressed as fold induction when compared to vehicle control (0.2% ETOH).

c. hCAR3/hVDR/mPXR-mediated transactivation of CYP3A4. CITCO (10 μM) was used as hCAR agonist; 1,25(OH)2VD3 (0.1μM) was used as hVDR positive control; and PCN (20μM) was used as mPXR agonist.

*, P<0.05; **, P<0.01 when compared with their respective ETOH controls in the treatment groups.

Species differences were found among the several animal models that have been proposed to assess xenobiotic effects on P450 regulation. The sequence differences in the LBDs of PXRs account for most of the variations in CYP3A induction across species. In the study described here, the ability of megestrol to activate mouse PXR (mPXR) was also investigated. Our results indicated that megestrol also exhibited a transcriptional activity on mPXR (Fig.3c), and the effects on hPXR or mPXR were comparable, suggesting that the differences in the LBD between human and mouse PXR do not affect the megestrol capacity to induce the expression of CYP3A P450s.

MTS assay was performed to determine the viability of cultured HepG2 cells treated with megestrol at concentrations that were effective in modulating hPXR target gene expression. The results indicated that treatment of cultured HepG2 cells for 24 h with megestrol (less than 50 μM) did not decrease cell viability significantly (Fig.3a).

The Mechanism that Megestrol Activates hPXR:

Results from the above studies supported the notion that megestrol caused the up-regulation of P450 enzymes through the functional activation of hPXR. It has been reported that upon agonist binding, hPXR heterodimerizes to hRXR, recruits coactivators, and transactivates several response elements located in either the proximal or distal promoter area of CYP3A4. This results in increased gene transcription [33, 34]. CYP3A4 induction can be controlled by hPXR through two specific responsive elements present in the regulatory region of this gene. The first element is the proximal hPXR-responsive region. It consists of an everted repeat of the nuclear receptor half-site (A/G)G(G/T)TCA separated by 6 nucleotides (pER6). Full hPXR-mediated transactivation of the CYP3A4 promoter requires the presence of a second, distal, xenobiotic-responsive element consisting of two direct repeats separated by 3 nucleotides (DR3) [33], encompassing an ER6 motif (dER6). To evaluate the underlying mechanism that megestrol uses to activate hPXR, we first checked the heterodimerization between hPXR and hRXR and the bindings of hPXR:hRXR to either 3A4-dER6 or 3A4-pER6 by EMSA (Fig. 4a). As expected, no band was observed when the probes were incubated with hPXR alone, indicating the necessity of hRXR in the transactivation of the CYP3A4 promoter. A retarded band was observed when 3A4-dER6 or 3A4-pER6 were incubated in the presence of the hPXR:hRXR complex. The specificity of the interaction was confirmed by competition experiments using 100-fold molar excesses of unlabeled oligonucleotides. After the treatment with megestrol, the efficiency of hPXR-hRXR heterodimer binding to either 3A4-dER6 or 3A4-pER6 did not change significantly when compared with vehicle control. In sum, these observations show that megestrol has effects on neither the formation of hPXR:hRXR heterodimer nor the binding of hPXR:hRXR heterodimer to the major hPXR-responsive elements of CYP3A4.

Fig. 4.

Fig. 4

The mechanism by which megestrol activates hPXR.

a. Analyses of the formation of hPXR:hRXRα:hPXRE complex by EMSA. Images were generated by scanning the plates directly in an Odyssey infrared scanner at the channel of 800 CM. The quantification was performed by Odyssey 2.0 software.

b. The competition of binding to PXR-LBD in a LanthaScreen® TR-FRET competitive binding assay. The assay was performed in a 96-well, non-coated polystyrene assay plate. The 520/490 TR-FRET ratio was measured using a PerkinElmer EnVision fluorescent plate reader with laser excitation and emission filters. Negative control without competitor (1% DMSO) and positive control with SR12813 were performed in parallel.

c. Analyses of the recruitment of SRC-1 to hPXR by a mammalian two-hybrid system. Rifampicin treatment was used as the control. The luciferase activity was measured and normalized for transfection efficiency with β-gal activity. The interaction potentials were indicated as luciferase induction folds when compared with the vehicle control group (ETOH, 0.2%). Column: the mean induction folds determined in triplicate independent experiments; Bar: SD. *, P<0.05; **, P<0.01 when compared with the ETOH control.

d. Analysis of hPXR and SRC-1 binding in vitro by a pull-down assay. SRC186 was overexpressed in E.Coli Rosetta (DE3). The expected protein size is 28 kd. The residues 130–434 of PXRLBD were obtained from E.Coli Rosetta (DE3), with a coexpression with residues 623–710 of the human SRC-1. The expected size of PXRLBD is 34 kd. Preyed PXRLBD was normalized by inputted SRC186. Rifampicin treatment was used as the control. The interaction potential was indicated as induction fold when compared with the vehicle control group (ETOH, 0.2%).

We thus hypothesized that additional factors, such as the binding of an agonist and the recruitment of a cofactor, might underlie the transactivation of CYP3A4 by megestrol. Our results indicated that megestrol at the concentrations we tested to activate hPXR could bind hPXR and, therefore, may compete with other hPXR agonists for binding to the LBD of hPXR (Fig. 4b). In addition, regions of hPXRLBD are mobile and can change position when bound by distinctly shaped ligands [35]. These ligand-dependent conformational changes may modify corepressor or coactivator binding. The results from the mammalian two-hybrid system showed megestrol had a dose-dependent recruitment of the coactivator, SRC-1, to hPXR. Megestrol at concentrations of more than 10 μM had stronger effects than 10 μM rifampicin (Fig. 4c). In the in vitro coactivator and hPXRLBD binding assay, SRC186 (186 amino acid residues of the human SRC-1 protein, which contains all 3 motifs interacting with hPXR and has an expected size of 28 kd) and hPXRLBD (residues 130–434 of hPXR that has an expected size of 34 kd) were overexpressed, purified and labeled (Fig. 4d). In agreement with cellular experiments, both 10 μM rifampicin (positive control) and 25 μM megestrol significantly increased the interaction of hPXR with SRC-1 in in vitro experiments (Fig. 4d). Based on this data, we conclude that megestrol is an inducer of CYP3A4 by activating hPXR through binding to the LBD of hPXR and promoting SRC-1 coactivator recruitments.

Discussion

Induction of cytochromes P450 by xenobiotic chemicals usually leads to increased detoxification of xenobiotics but, paradoxically, sometimes leads to the formation of metabolites that are more toxic and carcinogenic [36]. The likelihood for significant metabolic interactions is increased when a major metabolic step is catalyzed by a single P450 enzyme. CYP3A4 is an enzyme that regulates the metabolism of a broad array of drugs that are of fundamental importance in all kinds of disease. The expression of CYP3A4 is highly inducible [37–39] and thus oxidative metabolism of drugs by this enzyme display marked inter-individual variations. The study presented here revealed that megestrol, a drug used in cancer treatment, was a specific inducer of CYP3A4.. It induced CYP3A4 through the activation of hPXR, resulting in an increase in CYP3A4 levels and activities. Therefore, it is probable that other drugs or endobiotics metabolized by CYP3A4 can be modified by megestrol through increasing CYP3A4. Given the importance of CYP3A4 in the metabolism of a variety of drugs, an understanding of this phenomenon is crucial to minimize the potential for undesirable drug-drug interactions.

An inductive effect of the P450 system by megestrol could be clinically significant, since megestrol has been used in patients especially in cancer patients. Although many studies have investigated the role of individual chemicals, particularly synthetic drugs, as inducer of CYP3A4, considerably less is known as to which compound is specific to activate this enzyme. Using megestrol as the specific modulator in CYP3A4-related studies could reduce many reduce unexpected effects on other enzymes. This would be especially helpful in experiments performed in liver microsomes or hepatocytes, which contain a complex metabolism network. Moreover this induction of CYP3A4 by megestrol appears to occur at concentrations comparable to those used clinically. The standard daily dose of megestrol is 40– 320 mg and has an excellent safety profile. Doses up to 800 mg/day show no serious side effects [40]. Pharmacokinetic studies in patients taking megestrol acetate have demonstrated that a daily dose of 800 mg can produce total plasma megestrol acetate concentrations of approximately 2 μM [41]. Although relatively high concentrations of megestrol compared with daily plasma level are required to induce CYP3A4 in human hepatocytes, it should be noted that megestrol may be administered at higher daily doses for the improvement of appetite and to relieve ACS in patients receiving chemotherapy [22, 23]. It is also interesting to note that the EC50 values from the in vitro experiments were in many cases higher than the published plasma concentrations for a given drug, yet in several cases, the drug still produced clinically measurable induction [42].

There is little information reported on megestrol’s interaction with other drugs. It has been previously reported that megestrol may inhibit the efflux activity of p-glycoprotein and play an important role in anticancer drug resistance [43]. Our current study provides more information on the potential impacts of megestrol on pharmacokinetics of other drugs. However, there is not yet clinical proof for our observations suggesting that megestrol has the potential to cause pharmacokinetic drug-drug interaction, and so should be further investigated.

Our study has some limitations. First of all, the hepatocyte model has high inter-donor variability. Although the CYP3A4 induction effect was consistent across all samples tested, the inter-donor variance and in vitro cell culture conditions may contribute to the considerable variability of induction and hamper the detection of mild inducing effects on other DMEs [44]. Second, our findings indicated that megestrol exposure had no effect on the formation of the hPXR: hRXR: CYP3A4-hPXR responsive element complex. However, the CYP3A4 xenobiotics-responsive element (XREM) region is a complex array of transcription factor-binding sites that include response elements highly homologous to the recognition sequence for other transcription factors [33]. Therefore, CYP3A4 promoter activation by megestrol through these transcription factors cannot be completely ruled out.

Taken together, our results indicate that megestrol, under the described study’s experimental conditions, is a specific inducer of CYP3A4. Megestrol has the potential to cause drug-drug interaction through the modulation of CYP3A4 by hPXR, which was corroborated by the observation that megestrol increased the metabolism of CYP3A4 substrate, nifedipine. Given that CYP3A4 regulates the metabolism of a broad array of drugs that are of fundamental importance in cancer treatment, results from the study described here will provide an impetus to conduct further studies to delineate physiological, pharmacological, and toxicological actions of megestrol.

Significance Statement.

Megestrol acetate specifically induces the expression of cytochrome P450 3A4 (CYP3A4) in human hepatocytes through binding to human PXR and recruitment of cofactors. But it has minimal effects on the expression of other drug metabolizing enzymes and efflux transporters. The study suggests a potential interaction of megestrol acetate with other drugs that are substrates of CYP3A4, as well as the utility of this compound to induce CYP3A4 specifically for pharmacological studies.

Acknowledgement:

We acknowledge and thank the following people for providing plasmids:

Gal4DB-SRC-1-RID and TK-MH100×4-LUC from Dr. Sridhar Mani at Albert Einstein College of Medicine pTracer-CMV2-CAR3 and pTracer-CMV2 from Dr. Curtis J. Omiecinski at Center for Molecular Toxicology and Carcinogenesis, the Pennsylvania State University pSG5-mPXR and pVP-hPXR from Dr. Jeff L. Staudinger at Department of Pharmacology and Toxicology, University of Kansas pCMX-RXRa from Dr. David John Mangelsdorf at Howard Hughes Medical Institute, UT Southwestern Medical Center.

We also acknowledge and thank Lydia Howes at Southern Illinois University School of Medicine Library for professional editing of the manuscript.

Footnotes

Conflict of Interest Statement:

On behalf of all authors, the corresponding author states that there is no conflict of interest.

Data Availability Statement:

Data will be available upon reasonable request

References

  • 1.Blower P, et al. , Drug-drug interactions in oncology: why are they important and can they be minimized? Crit Rev Oncol Hematol, 2005. 55(2): p. 117–42. [DOI] [PubMed] [Google Scholar]
  • 2.Beijnen JH and Schellens JH, Drug interactions in oncology. Lancet Oncol, 2004. 5(8): p. 489–96. [DOI] [PubMed] [Google Scholar]
  • 3.Harmsen S, et al. , The role of nuclear receptors in pharmacokinetic drug-drug interactions in oncology. Cancer Treat Rev, 2007. 33(4): p. 369–80. [DOI] [PubMed] [Google Scholar]
  • 4.Anzenbacher P and Anzenbacherova E, Cytochromes P450 and metabolism of xenobiotics. Cell Mol Life Sci, 2001. 58(5–6): p. 737–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Tian D and Hu Z, CYP3A4-mediated pharmacokinetic interactions in cancer therapy. Curr Drug Metab, 2014. 15(8): p. 808–17. [DOI] [PubMed] [Google Scholar]
  • 6.Mathijssen RH, et al. , Effects of St. John’s wort on irinotecan metabolism. J Natl Cancer Inst, 2002. 94(16): p. 1247–9. [DOI] [PubMed] [Google Scholar]
  • 7.Chen L and Waxman DJ, Intratumoral activation and enhanced chemotherapeutic effect of oxazaphosphorines following cytochrome P-450 gene transfer: development of a combined chemotherapy/cancer gene therapy strategy. Cancer Res, 1995. 55(3): p. 581–9. [PubMed] [Google Scholar]
  • 8.Wei MX, et al. , Experimental tumor therapy in mice using the cyclophosphamide-activating cytochrome P450 2B1 gene. Hum Gene Ther, 1994. 5(8): p. 969–78. [DOI] [PubMed] [Google Scholar]
  • 9.Guengerich FP, Cytochrome P-450 3A4: regulation and role in drug metabolism. Annu Rev Pharmacol Toxicol, 1999. 39: p. 1–17. [DOI] [PubMed] [Google Scholar]
  • 10.Wojnowski L and Kamdem LK, Clinical implications of CYP3A polymorphisms. Expert Opin Drug Metab Toxicol, 2006. 2(2): p. 171–82. [DOI] [PubMed] [Google Scholar]
  • 11.Lehmann JM, et al. , The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J Clin Invest, 1998. 102(5): p. 1016–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Bertilsson G, et al. , Identification of a human nuclear receptor defines a new signaling pathway for CYP3A induction. Proc Natl Acad Sci U S A, 1998. 95(21): p. 12208–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Schmiedlin-Ren P, et al. , Induction of CYP3A4 by 1 alpha,25-dihydroxyvitamin D3 is human cell line-specific and is unlikely to involve pregnane X receptor. Drug Metab Dispos, 2001. 29(11): p. 1446–53. [PubMed] [Google Scholar]
  • 14.Goodwin B, et al. , Transcriptional regulation of the human CYP3A4 gene by the constitutive androstane receptor. Mol Pharmacol, 2002. 62(2): p. 359–65. [DOI] [PubMed] [Google Scholar]
  • 15.Kawamoto T, et al. , Phenobarbital-responsive nuclear translocation of the receptor CAR in induction of the CYP2B gene. Mol Cell Biol, 1999. 19(9): p. 6318–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Chang TK and Waxman DJ, Synthetic drugs and natural products as modulators of constitutive androstane receptor (CAR) and pregnane X receptor (PXR). Drug Metab Rev, 2006. 38(1–2): p. 51–73. [DOI] [PubMed] [Google Scholar]
  • 17.Synold TW, Dussault I, and Forman BM, The orphan nuclear receptor SXR coordinately regulates drug metabolism and efflux. Nat Med, 2001. 7(5): p. 584–90. [DOI] [PubMed] [Google Scholar]
  • 18.Desai PB, et al. , Induction of cytochrome P450 3A4 in primary human hepatocytes and activation of the human pregnane X receptor by tamoxifen and 4-hydroxytamoxifen. Drug Metab Dispos, 2002. 30(5): p. 608–12. [DOI] [PubMed] [Google Scholar]
  • 19.Schacter L, et al. , Megestrol acetate: clinical experience. Cancer Treat Rev, 1989. 16(1): p. 49–63. [DOI] [PubMed] [Google Scholar]
  • 20.Westman G, et al. , Megestrol acetate in advanced, progressive, hormone-insensitive cancer. Effects on the quality of life: a placebo-controlled, randomised, multicentre trial. Eur J Cancer, 1999. 35(4): p. 586–95. [DOI] [PubMed] [Google Scholar]
  • 21.Markovic S, et al. , Randomized, placebo-controlled, phase III surgical adjuvant clinical trial of megestrol acetate (Megace) in selected patients with malignant melanoma. Am J Clin Oncol, 2002. 25(6): p. 552–6. [DOI] [PubMed] [Google Scholar]
  • 22.Pu YS, et al. , Megestrol acetate antagonizes cisplatin cytotoxicity. Anticancer Drugs, 1998. 9(8): p. 733–8. [DOI] [PubMed] [Google Scholar]
  • 23.Carrero JJ, et al. , Appetite disorders in uremia. J Ren Nutr, 2008. 18(1): p. 107–13. [DOI] [PubMed] [Google Scholar]
  • 24.Tchekmedyian NS, Tait N, and Aisner J, High-dose megestrol acetate in the treatment of postmenopausal women with advanced breast cancer. Semin Oncol, 1986. 13(4 Suppl 4): p. 20–5. [PubMed] [Google Scholar]
  • 25.Tchekmedyian NS, et al. , High-dose megestrol acetate in the treatment of advanced breast cancer. Semin Oncol, 1988. 15(2 Suppl 1): p. 44–9. [PubMed] [Google Scholar]
  • 26.Dev R, et al. , The Evolving Approach to Management of Cancer Cachexia. Oncology (Williston Park), 2017. 31(1): p. 23–32. [PubMed] [Google Scholar]
  • 27.Wang L, et al. , Reversal of the human and murine multidrug-resistance phenotype with megestrol acetate. Cancer Chemother Pharmacol, 1994. 34(2): p. 96–102. [DOI] [PubMed] [Google Scholar]
  • 28.Fleming GF, et al. , Megestrol acetate reverses multidrug resistance and interacts with P-glycoprotein. Cancer Chemother Pharmacol, 1992. 29(6): p. 445–9. [DOI] [PubMed] [Google Scholar]
  • 29.Chen Y, et al. , Human pregnane X receptor and resistance to chemotherapy in prostate cancer. Cancer Res, 2007. 67(21): p. 10361–7. [DOI] [PubMed] [Google Scholar]
  • 30.Luo G, et al. , CYP3A4 induction by xenobiotics: biochemistry, experimental methods and impact on drug discovery and development. Curr Drug Metab, 2004. 5(6): p. 483–505. [DOI] [PubMed] [Google Scholar]
  • 31.Tirona RG, et al. , The orphan nuclear receptor HNF4alpha determines PXR- and CAR-mediated xenobiotic induction of CYP3A4. Nat Med, 2003. 9(2): p. 220–4. [DOI] [PubMed] [Google Scholar]
  • 32.Thompson PD, et al. , Liganded VDR induces CYP3A4 in small intestinal and colon cancer cells via DR3 and ER6 vitamin D responsive elements. Biochem Biophys Res Commun, 2002. 299(5): p. 730–8. [DOI] [PubMed] [Google Scholar]
  • 33.Goodwin B, Hodgson E, and Liddle C, The orphan human pregnane X receptor mediates the transcriptional activation of CYP3A4 by rifampicin through a distal enhancer module. Mol Pharmacol, 1999. 56(6): p. 1329–39. [DOI] [PubMed] [Google Scholar]
  • 34.Squires EJ, Sueyoshi T, and Negishi M, Cytoplasmic localization of pregnane X receptor and ligand-dependent nuclear translocation in mouse liver. J Biol Chem, 2004. 279(47): p. 49307–14. [DOI] [PubMed] [Google Scholar]
  • 35.Orans J, Teotico DG, and Redinbo MR, The nuclear xenobiotic receptor pregnane X receptor: recent insights and new challenges. Mol Endocrinol, 2005. 19(12): p. 2891–900. [DOI] [PubMed] [Google Scholar]
  • 36.Conney AH, Induction of microsomal enzymes by foreign chemicals and carcinogenesis by polycyclic aromatic hydrocarbons: G. H. A. Clowes Memorial Lecture. Cancer Res, 1982. 42(12): p. 4875–917. [PubMed] [Google Scholar]
  • 37.Paine MF, et al. , The human intestinal cytochrome P450 “pie”. Drug Metab Dispos, 2006. 34(5): p. 880–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Shimada T, et al. , Interindividual variations in human liver cytochrome P-450 enzymes involved in the oxidation of drugs, carcinogens and toxic chemicals: studies with liver microsomes of 30 Japanese and 30 Caucasians. J Pharmacol Exp Ther, 1994. 270(1): p. 414–23. [PubMed] [Google Scholar]
  • 39.Thummel KE and Wilkinson GR, In vitro and in vivo drug interactions involving human CYP3A. Annu Rev Pharmacol Toxicol, 1998. 38: p. 389–430. [DOI] [PubMed] [Google Scholar]
  • 40.Gaver RC, et al. , Bioequivalence evaluation of new megestrol acetate formulations in humans. Semin Oncol, 1985. 12(1 Suppl 1): p. 17–9. [PubMed] [Google Scholar]
  • 41.Matin K, et al. , Phase I and pharmacokinetic study of vinblastine and high-dose megestrol acetate. Cancer Chemother Pharmacol, 2002. 50(3): p. 179–85. [DOI] [PubMed] [Google Scholar]
  • 42.Ripp SL, et al. , Use of immortalized human hepatocytes to predict the magnitude of clinical drug-drug interactions caused by CYP3A4 induction. Drug Metab Dispos, 2006. 34(10): p. 1742–8. [DOI] [PubMed] [Google Scholar]
  • 43.Hellum BH and Nilsen OG, In vitro inhibition of CYP3A4 metabolism and P-glycoprotein-mediated transport by trade herbal products. Basic Clin Pharmacol Toxicol, 2008. 102(5): p. 466–75. [DOI] [PubMed] [Google Scholar]
  • 44.LeCluyse EL, Human hepatocyte culture systems for the in vitro evaluation of cytochrome P450 expression and regulation. Eur J Pharm Sci, 2001. 13(4): p. 343–68. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be available upon reasonable request

RESOURCES