Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Apr 4.
Published in final edited form as: Microb Ecol. 2014 Jan 17;68(1):111–120. doi: 10.1007/s00248-013-0361-6

Investigating the Link Between Imipenem Resistance and Biofilm Formation by Pseudomonas aeruginosa

Hadeel K Musafer 1,2, Sherry L Kuchma 3, Amanda A Naimie 4, Joseph D Schwartzman 5, Harith J Fahad AL-Mathkhury 6, George A O’Toole 7,8
PMCID: PMC8978818  NIHMSID: NIHMS1790895  PMID: 24435545

Abstract

Pseudomonas aeruginosa, a ubiquitous environmental organism, is a difficult-to-treat opportunistic pathogen due to its broad-spectrum antibiotic resistance and its ability to form biofilms. In this study, we investigate the link between resistance to a clinically important antibiotic, imipenem, and biofilm formation. First, we observed that the laboratory strain P. aeruginosa PAO1 carrying a mutation in the oprD gene, which confers resistance to imipenem, showed a modest reduction in biofilm formation. We also observed an inverse relationship between imipenem resistance and biofilm formation for imipenem-resistant strains selected in vitro, as well as for clinical isolates. We identified two clinical isolates of P. aeruginosa from the sputum of cystic fibrosis patients that formed robust biofilms, but were sensitive to imipenem (MIC≤2 μg/ml). To test the hypothesis that there is a general link between imipenem resistance and biofilm formation, we performed transposon mutagenesis of these two clinical strains to identify mutants defective in biofilm formation, and then tested these mutants for imipenem resistance. Analysis of the transposon mutants revealed a role for previously described biofilm factors in these clinical isolates of P. aeruginosa, including mutations in the pilY1, pilX, pilW, algC, and pslI genes, but none of the biofilm-deficient mutants became imipenem resistant (MIC≥8 μg/ml), arguing against a general link between biofilm formation and resistance to imipenem. Thus, assessing biofilm formation capabilities of environmental isolates is unlikely to serve as a good predictor of imipenem resistance. We also discuss our findings in light of the limited literature addressing planktonic antibiotic resistance factors that impact biofilm formation.

Introduction

Pseudomonas aeruginosa is an important opportunistic human pathogen that can cause life-threatening infections, especially in patients with cystic fibrosis (CF) and individuals with a compromised immune system. This environmental bacterium is able to survive both in free-swimming planktonic form and in surface-associated communities known as biofilms. P. aeruginosa biofilms can form on both biotic and abiotic surfaces in a wide range of environments, thus likely contributing to this microbe’s ability to cause disease in clinical settings [1, 2].

Although there are several antimicrobial agents that continue to be effective against P. aeruginosa (i.e., carbapenems, cefepime, ceftazidime, tobramycin, and amikacin), in the last few years this bacterium’s increasing resistance to antibiotics has been reported [3, 4]. For example, carbapenems, particularly imipenem, are a suitable alternative for treating multidrug-resistant P. aeruginosa, yet the emergence and spread of carbapenem-resistant strains have compromised the effectiveness of therapeutic and control efforts using this antibiotic [5].

The OprD porin of P. aeruginosa facilitates the uptake across the outer membrane of basic amino acids, small peptides that contain these amino acids, and their structural analogue, the antibiotic imipenem. Indeed, prolonged treatment of patients with P. aeruginosa infections with this antibiotic leads to imipenem-resistant mutants that lack OprD due to an oprD gene mutation [6], including disruption of the oprD structural gene by insertion of large IS elements [7–10], missense mutations or insertions [11], deletions creating frame shifts [12], or premature stop codons [12, 13]. Inactivating mutations in the oprD gene have been documented to confer resistance to imipenem, and to a lesser extent to meropenem and doripenem [14, 15]. Alternatively, the pathway to OprD-mediated resistance can involve mechanisms that decrease the transcriptional expression of the oprD gene. For example, reduced OprD levels can be caused by a mutation in the gene encoding mexT, which encodes a LysR-family transcriptional regulator. Loss of MexT function results in reduced oprD expression and upregulation of the operon encoding the MexEF-OprN multidrug efflux pump [16, 17], thus contributing to imipenem resistance.

By analyzing laboratory strains and clinical isolates of P. aeruginosa, we noticed a link between increased OprD-mediated imipenem resistance and reduced biofilm formation. Based on this observation, we hypothesized that loss of biofilm formation might be generally linked to increased imipenem resistance, and to test this idea, we identified and characterized biofilm-deficient variants of two different clinical isolates. Our studies, while identifying well-conserved biofilm-promoting factors, do not support the hypothesis that loss of biofilm formation in general spurs increased resistance to imipenem. We discuss our findings in light of the limited literature addressing planktonic antibiotic resistance factors that impact biofilm formation.

Materials and Methods

Strains and Media

The strains, plasmids, and primers used in this study are listed in Table 1. All strains were routinely cultured on lysogeny broth (LB) medium, which was solidified with 1.5 % agar when necessary, and supplemented with antibiotics as indicated. Gentamicin (Gm) was used from 25 to 50 μg/ml for P. aeruginosa and at 10 μg/ml for Escherichia coli. Carbenicillin (Cb) was used at 50 μg/ml for P. aeruginosa and 10 μg/ml for E. coli. Nalidixic acid (NA) was used at 20 μg/ml for E. coli. For all phenotypic assays, M63 minimal salts medium was supplemented with MgSO4 (1 mM), glucose (0.2 %), and casamino acids (CAA; 0.5 %). Arabinose was added to cultures at a final concentration of 0.05 % for strains carrying expression plasmids harboring the pBAD promoter. Saccharomyces cerevisiae strain InvSc1 (Invitrogen), used for plasmid construction via in vivo homologous recombination, was grown with yeast extract-peptone-dextrose (1 % Bacto yeast extract, 2 % Bacto peptone, and 2 % dextrose) [18]. Selections with InvSc1 were performed using synthetic defined agar-uracil (catalog no. 4813–065; Qbiogene).

Table 1.

Strains, plasmids, and primers used in this study

Strain name Relevant genotype, description or sequence Source
S. cerevisiae InvSc1 MATa/MATα leu2/leu2 trp1-289/trp1-289 ura3-52/ura3-52 his3-Δ1/his3-Δ1 Invitrogen
E. coli S17-1(λpir) thi pro hsdR-hsdM+ΔrecA RP4–2∷TcMu-Km∷Tn7 [55]
E. coli DH5α lˉ f80dlacZDM15D(lacZYA-argF)U169 recA1 endA hsdR17(rKˉ mKˉ) supE44 thi-1 gyrA relA1 Life Technologies
P aeruginosa PAO1 Wild type [54]
oprD∷IsphoA/hah PAO1 with isphoA/hah insertion in opr∷Tcʳ [54]
SMC214 Imipenem intermediate P. aeruginosa clinical isolate; robust biofilm former This study
SMC576 Imipenem-sensitive P. aeruginosa clinical isolate; robust biofilm former This study
SMC631 Imipenem-sensitive clinical isolate; robust biofilm former This study
SMC4972 P. aeruginosa clinical isolate This study
SMC4973 P. aeruginosa clinical isolate This study
SMC4974 P. aeruginosa clinical isolate This study
SMC4979 P. aeruginosa clinical isolate This study
SMC5806 631-F/oprD; imipenem-resistant derivative of SMC631; premature stop mutation in oprD gene This study
SMC5810 P. aeruginosa clinical isolate This study
SMC5811 P. aeruginosa clinical isolate This study
SMC5812 SMC576 pilW∷Mar19, Mariner insertion in pilW(769)a This study
SMC5813 SMC576 pilY1∷Mar8, Mariner insertion in pilY1 (3214) This study
SMC5814 SMC576 pilY1∷Mar13, Mariner insertion in pilY1 (1933) This study
SMC5815 SMC576 pilY1∷Mar18, Mariner insertion in pilY1 (3242) This study
SMC5816 SMC576 pilY1∷Mar20, Mariner insertion in pilY1(2156) This study
SMC5817 SMC576 pilY1∷Mar25, Mariner insertion in pilY1(1228) This study
SMC5818 SMC576 pslI∷Mar15, Mariner insertion in pslI This study
SMC5819 SMC576 algC∷Mar10, Mariner insertion in algC This study
SMC5824 SMC214 pilX∷Mar, Mariner insertion in pilX (84) This study
SMC5825 SMC214 pilW∷Mar, Mariner insertion in pilW(627) This study
SMC5832 P. aeruginosa ATCC 27853 This study
SMC5833 Escherichia coli ATCC 25922 This study
Plasmid Plasmid description Reference
 pMQ70 Shuttle vector for cloning in yeast and for arabinose-inducible gene expression; Apr [18]
 pMQ72 Shuttle vector for cloning in yeast and for arabinose-inducible gene expression; Gmr [18]
 pBT20 Vector carrying mariner transposon; Apr; Gmr [56]
 poprD oprD gene cloned in pMQ72; Gmr This study
 ppilY1 His-tagged pilY1 gene cloned in pMQ70; Apr This study
Primersb Primer sequence (5′–3′)
 oprD comp 5′ ttctccatacccgtttttttggggaaggagatatacatATGAAAGTGATGAAGTGGAG
 oprD comp 3′ taatctgtatcaggctgaaaatcttctctcatccgccTCACAGGATCGACAGCGGATAG
 oprD seq a-f ATGAAAGTGATGAAGTGGAGC
 oprD seq a-r AGGGAGGCGCTGAGGTT
 oprD seq b-f AACCTCAGCGCCTCCCT
 pilY1 comp 5′ tctccatacccgtttttttgggctagcgaattcgaaggagatatacatATGAAATCGGTACTCCACCAG
 pilY1 comp 3′ tcttctctcatccgccaaaacagccaagcttgcatgcctTCAgtggtgatggtggtggtgGTTCTTTCCGATGGGGC
 pilY1 seq Rev 2 TGAACGGACAGGTACAGATCC
 pilY1 seq 3 GGATCTGTACCTGTCCGTTC
 pilY1 seq 4 GGCGAGTTTCTCAAGAAGACC
 pilY1 seq 5 CTTCCAGGACATCCTCAACCG
 pilY1 seq 6 AGCCCAGCGGTAACTACTCC
 pilY1 seq 7 CAAGGTCAACCAGGACGATC
 P730 GCAACTCTCTACTGTTTCTCC
Open in a new tab
a

The number in parentheses indicates the nucleotide after which the transposon has inserted in the open reading frame

b

For primer sequences, lowercase letters indicate sequence identity to the cloning vector, uppercase letters indicate a Pseudomonas gene-specific sequence, boldface and lower case letters indicates a His tag sequence

Determination of Imipenem Minimal Inhibitory Concentration

The Etest method was used for minimal inhibitory concentration (MIC) determination according to the manufactures instructions. In brief, bacterial suspensions were prepared from fresh colonies, the concentration adjusted to 0.5 McFarland turbidity, each isolate was uniformly spread on the surface of a Mueller Hinton agar (MHA) plate, and an imipenem Etest strip (from 0.002 to 32 μg/mL; bioMérieux, France) placed on the surface of agar plate. After overnight incubation at 37 °C, MIC was determined and categorized as sensitive (≤2 μg/ml), intermediate (4 μg/ml) or resistant (≥8 μg/ml) according to Clinical and Laboratory Standards Institute (CLSI) guidelines [19]. In select cases, we also determined the MIC by a microdilution assay in microtiter plates to confirm the Etest findings [20, 21]. Escherichia coli ATCC 25922 and P. aeruginosa ATCC 27853 were used as quality control strains for Etest and microdilution assay, respectively.

Mariner Transposon Mutagenesis of Clinical Strains

The strain E. coli S17–1λpir carrying the pBT20 plasmid served as the donor and the P. aeruginosa clinical isolates (SMC576 and SMC 214) as recipient strains for conjugations. From overnight LB-grown cultures (with the appropriate antibiotic), 1 ml of donor and 1 ml of recipient was centrifuged to pellet the cells. Cell pellets were washed twice with LB and resuspended in 100 μl of fresh LB. The cell suspensions of each strain were then mixed, 60 μl of the mixture was plated to two LB plates and the conjugation was allowed to proceed for 1 h at 30 °C. Each conjugation mix was harvested, resuspended in 100 μl of LB, and then plated on LB agar plates containing Gm to select for the transposon-carrying P. aeruginosa strains, as well as NA to select against growth of the E. coli donor. Libraries of mutants were generated by inoculating individual colonies into 96-well plates containing 100 μl LB medium supplemented with Gm, and the plates incubated overnight at 37 °C to allow outgrowth of the candidate mutants.

Mutant strains were screened for biofilm formation defects by inoculating fresh 96-well microtiter plates containing M63 minimal medium supplemented with MgSO4, glucose, and casamino acids, as reported [22]. The inoculum (2–3 μl) was transferred from the library plate containing LB-grown candidate mutants to the screening plates using a 48-pin multiprong device. The clinical isolates (SMC576 or SMC214) were used as controls in each microtiter plate, respectively. After inoculation, the screening plates were incubated at 37 °C for 16 h, and biofilm formation assessed by the crystal violet assay, as reported [22]. We screened ~1,500 Mariner transposon mutants for each clinical isolate background. The mutations were mapped by determining the DNA sequences flanking the transposon insertions using an arbitrary-primed PCR, as described previously [23, 24], and the PCR products were sequenced at the Molecular Biology and Proteomics Core at Dartmouth College. The resulting DNA sequences were aligned to the P. aeruginosa PAO1 genomic sequence using the NCBI BLAST program.

Construction of Mutant Strains and Plasmids

Table 1 lists all plasmids constructed in this study and primers used in plasmid construction. Plasmids for complementation and overexpression were generated via homologous recombination in yeast [18]. The pMQ72 vector [18] was used as the backbone for the oprD complementation construct, and plasmid pMQ70 [18] served as the backbone for the pilY1 complementation construct. The poprD complementation constructs and ppilY1 complementation constructs were generated by PCR amplification of the respective genes using the high-fidelity Phusion polymerase (Finnzyme, Espoo, Finland).

Motility Assays

Twitch motility plates consisted of M63 medium supplemented with glucose, MgSO4, and CAA solidified with 1.5 % agar. Twitch assays were performed as previously reported [25, 26]. Swarming motility plates were comprised of M8 medium supplemented with MgSO4, glucose, and CAA and solidified with 0.5 % agar. For each strain tested, 2 μl of LB grown overnight cultures was inoculated onto the surface of the swarm plates and incubated for 16 h at 37 °C.

Biofilm Formation Assay

Biofilm formation in 96-well microtiter plates was assayed and quantified as previously described [26, 27]. All biofilm assays were performed using M63 minimal medium supplemented with MgSO4, glucose, and CAA.

Quantification of Polysaccharide Production

We quantified Psl production via ELISA with some modifications from an existing protocol [28], using the anti-PSL antibody WapR-001: Class II anti-Psl mAb. MedImmune LLC previously reported this identification and characterization of this antibody [29], and generously provided this reagent for our studies. Flat-bottom 96-well MaxiSorp plates (Nunc) were coated, in triplicate, overnight at 4 °C with 100 μL/well of the indicated strains grown overnight in LB medium. The plate was washed thrice with PBS/0.1 % Tween-20 for 3 min each and tapped to mix, then blocked with 300 μL/well PBS+1 % BSA for 60 min at 4 °C. Primary anti-PSL antibody (WapR-001: Class II anti-Psl mAb) diluted in PBS+0.1 % BSA to a concentration of 1 μg/mL was added for 1–2 h at room temp, then washed three times as above. Next, a 1:5,000 dilution of HRP-conjugate secondary antibody diluted in PBS+0.1 % BSA was added to each well and incubated for 1 h, the plate washed three times with PBS, and 100 μL/well TMB SureBlue development reagents added for color development. Finally, 100 μL/well 0.2 N H2SO4 was added to terminate color development and the wells measured at 450 nm.

Results

OprD Participates in Biofilm Formation

Given the critical role of OprD in imipenem resistance [30, 31], the well-established role of biofilms in antimicrobial tolerance [32], and the limited literature linking planktonic resistance mechanisms to biofilm formation, we assessed whether strains with a defect in the oprD gene might display an altered biofilm phenotype. To test this hypothesis, we assessed the ability of an oprD transposon mutant to form a biofilm compared to the parental P. aeruginosa PAO1 strain. The oprD mutant showed a significant, but modest reduction in biofilm formation using the 96-well microtiter assay compared to P. aeruginosa PAO1 (Fig. 1a). We observed no difference in the growth rate of the WT versus the oprD mutant (not shown), thus a growth defect could not explain the reduction in biofilm formation. The biofilm formation defect of the oprD mutant was complemented by introducing a wild-type copy of the oprD gene on a plasmid but the vector control (pMQ72) was not able to rescue this defect (Fig. 1a).

Fig. 1.

Fig. 1

Open in a new tab

OprD participates in biofilm formation as well as imipenem resistance. a Quantification of biofilm formation for the indicated strains, including P. aeruginosa PAO1 (PAO1), the oprD∷IsphoA/hah transposon mutant [54], and the oprD mutant complemented with the vector control (pMQ72) or a plasmid carrying a wild-type copy of oprD (poprD+). The biofilm was detected by crystal violet (CV) staining. To quantify the biofilm, CV was solubilized with 30 % glacial acetic acid and the absorbance was measured at 550 nm. Strains were grown in M63 medium with MgSO4, glucose, and CAA for 24 h at 37 °C prior to crystal violet staining. In this and all figures, each strain was tested in four wells per experiment. Error bars represent standard deviations of means from three separate experiments. Statistical analysis was performed using ANOVA with Tukey’s post-test comparison. ns not significantly different; **, P<0.01, compared to P. aeruginosa PAO1. b imipenem susceptibility was investigated by Etest strips for the same strains described in panel A. Strains were grown on Mueller Hinton agar for 24 h at 37 °C as described in the “Materials and Methods”. Error bars represent standard deviations of averages from three independent experiments. Statistical analysis was performed using ANOVA with Tukey’s post-test comparison. ns not significantly different; ***, P<0.001, compared to P. aeruginosa PAO1. c Quantification of biofilm formation for the indicated strains, as described in panel A. The strains tested are the P. aeruginosa imipenem-sensitive clinical isolate SMC631, its imipenem-resistant derivative SMC631F-ImR (oprD), which carries a premature stop codon mutation in the oprD gene, SMC631F-ImR carrying the vector control (pMQ72) and SMC631F-ImR carrying a wild-type copy of oprD (poprD+). Error bars represent standard deviations of the averages of three experiments with four replicates per experiment. Data were analyzed by ANOVA with Tukey’s post-test comparison. ns not significantly different; **, P<0.01, compared to SMC631. d Imipenem susceptibility was investigated by Etest strips for the same strains described in panel C, as outlined for the studies performed in panel B. Error bars represent standard deviations of averages from three independent experiments with four wells per experiment. Data were analyzed by ANOVA with Tukey’s post-test comparison. ***P<0.001, compared to SMC631

To confirm that the oprD mutant did indeed confer imipenem resistance, we performed an Etest assay on the strains described in Fig. 1a. The oprD transposon mutant and the mutant carrying the vector control (pMQ72) showed significantly higher resistance to imipenem compared to the parental P. aeruginosa PAO1 and the oprD mutant complemented with a plasmid carrying the wild-type copy of this gene (Fig. 1b).

To assess whether these phenotypes might be observed in a clinical strain as well as the PAO1 laboratory strain, we assessed the biofilm formation and imipenem resistance phenotypes of a clinical strain of P. aeruginosa isolated from the sputum of a cystic fibrosis patient. This non-mucoid strain, designated SMC631, could form a biofilm in the 96 well microtiter dish and was sensitive to imipenem (Table 2). We isolated several imipenem-resistant (ImR) variants of the SMC631 strain that grew as colonies in the zone of inhibition at 32 μg/mL while performing an MIC assay with an imipenem ETest strip. Upon retesting in a microdilution assay, these mutants were confirmed to be resistant to imipenem (MIC≥16 μg/L). Sequencing of the oprD gene in one of these resistant isolates (631F-ImR) identified a single nucleotide change resulting in mutation of a Trp residue at position 417 to a premature stop codon.

Table 2.

Biofilm and Imipenem resistance phenotypes of clinical isolates

Imipenem resistancea Strain Imipenem MIC Biofilm (A550±SD))
Sensitive PA01 2 0.88±0.01
Sensitive SMC631 1.5 0.19±0.02
Resistant SMC631C 16 0.12±0.02
Resistant SMC631F 16 0.06±0.02
Resistant SMC631H 16 0.10±0.02
Resistant SMC631J 16 0.11±0.02
Resistant SMC631K 24 0.12±0.03
Resistant SMC4974 32 0.04±0.01
Resistant SMC5810 23 0.02±0.01
Resistant SMC5811 24 0.01±0.03
Sensitive SMC576 1 0.84±0.23
Intermediate SMC214 4 0.70±0.16
Sensitive SMC4972 1 0.77±0.03
Sensitive SMC4973 0.5 0.96±0.05
Intermediate SMC4979 4 0.53±0.06
Open in a new tab
a

Sensitive (≤2 μg/ml), intermediate (4 μg/ml) or resistant (≥8 μg/ml)

As was shown for the laboratory strain P. aeruginosa PAO1, a mutation in the oprD gene of the clinical isolate SMC631 reduced biofilm formation, and this phenotype could be complemented by introducing a plasmid carrying the wild-type oprD gene of strain P. aeruginosa PAO1, but not the corresponding vector control (Fig. 1c). Interestingly, the imipenem-resistant variant of SMC631 could not be complemented for its antibiotic resistance phenotype by introduction of a plasmid carrying the wild-type oprD gene (Fig. 1d), indicating either the possibility of a second mutation in this strain, that the mutation towards the C-terminal domain of the protein caused altered function, rather than loss of function, of the protein, or alternatively, that providing the oprD gene in multicopy in this strain cannot rescue imipenem sensitivity in this clinical strain.

Taken together, these data indicate that loss of OprD function in a lab isolate and a clinical isolate, which confers increased imipenem resistance, also results in a reduction in biofilm formation compared to the parental strain.

Assessing Biofilm Formation and Imipenem Resistance in Clinical Isolates

To further explore the relationship between biofilm formation and imipenem resistance, we assessed these phenotypes for the clinical strain SMC631, a number of imipenem-resistant variants of SMC631, and several additional P. aeruginosa clinical isolates. As shown in Table 2, SMC631, an imipenem-sensitive strain, makes a biofilm in the 96-well microtiter dish. We isolated five imipenem-resistant variants of this strain (SMC631C, F, H, J, K), and for all of these resistant strains, their ability to form a biofilm was compromised compared to the parent SMC631. Similarly, the imipenem-resistant isolates SMC4974, SMC5810, and SMC5811 showed relatively low biofilm formation compared to the imipenem-sensitive or intermediate P. aeruginosa clinical isolates SMC576, SMC214, SMC4972, SMC4973, and SMC4979, which all formed relatively robust biofilms (Table 2). Sequence analysis showed that all of the imipenem-resistant strains, with the exception of SMC631K, carried a mutation in the oprD gene (not shown). These data suggested the possibility of an inverse relationship between biofilm formation and OprD-mediated imipenem resistance, likely due to the participation of OprD in both of these processes in P. aeruginosa.

Biofilm Defective Mutants of Imipenem-Sensitive Clinical Isolates SMC576 and SMC214 Remain Sensitive to This Antibiotic

Given the observation that low levels of biofilm formation are correlated with imipenem resistance in P. aeruginosa PAO1 and various clinical isolates, and to better understand whether there might be a general link between biofilm formation and resistance phenotypes beyond the role described for OprD above, we decided to identify factors required for biofilm formation in two clinical isolates then test these biofilm mutants for their imipenem resistance phenotype.

Clinical strains of P. aeruginosa (SMC576 and SMC214) were isolated from the sputum of CF patients, displayed robust biofilm formation, are imipenem sensitive (MIC≤2 μg/ml) or intermediate (MIC=4 μg/ml), respectively, and could be effectively mutagenized via Mariner transposon mutagenesis. A number of the other clinical isolates were also tested, but they either did not form reproducible biofilms in the 96-well dish assay in our large-scale screening conditions (four strains) or the strains showed high level gentamicin resistance, which is the selectable marker on the Mariner transposon (three strains). Thus, we focused our efforts on strains SMC576 and SMC214.

We screened approximately 1,500 Mariner transposon mutants in the SMC576 strain for a reduction in biofilm formation using the microtiter plate assay. We isolated several biofilm formation-defective strains and we mapped these mutations to seven different genes, with several of these genes mutated more than once in independent strains. A complete list of mutations isolated is as follows: pilY1, pilW, algC, pslI, cupA2, pilA, and pilO genes, all of which have documented roles in biofilm formation [33–37], but we did not identify any mutations in the oprD gene. We further characterized the pilY1, pilW, algC, and pslI mutants in the studies below (Fig. 2a, b) to confirm that we had correctly mapped the mutations to these genes.

Fig. 2.

Fig. 2

Open in a new tab

Identification of biofilm-deficient mutants in the clinical isolate SMC576. a Schematic diagram of the pilY1, pilX, and pilW genomic loci of P. aeruginosa PAO1 (www.pseudomonas.com/). The transposon insertions are indicated by inverted triangles above the genes. The dark gray triangles indicate insertions in strain SMC576 and the light gray triangles indicate insertions in strain SMC214. The allele numbers above each inverted triangle correspond to the mutations analyzed in panel B. b Representative swarming (top), twitching (middle), and biofilm (bottom) phenotypes of SMC576 and selected transposon mutants. All assays are performed as described in the “Materials and Methods”. The strain corresponding to the phenotypes is indicated in panel C. c Quantification of crystal violet-stained biofilms for the indicated strains, as described in detail in Figure 1 and the “Materials and Methods”. Error bars represent standard deviations of the averages of four experiments with four replicates per experiment. Data were analyzed by ANOVA with Tukey’s post-test comparison. ns, not significantly different; ***, P<0. 001 compared to the WT. d Representative swarming (top), twitching (middle), and biofilm (bottom) assays for SMC576, the pilY1∷Mar8 mutant of SMC576 and the pilY1∷Mar8 mutant carrying either the vector alone (pMQ70) or the vector encoding a wild-type, His-tagged variant of PilY1 (ppilY1), as indicated at the bottom of panel E. e Quantification of crystal violet-stained biofilms for the indicated strains, as described in detail in Figure 1 and the “Materials and Methods”. Error bars represent standard deviations of the averages of four experiments with four replicates per experiment. Data were analyzed by ANOVA with Tukey’s post-test comparison. ns not significantly different; ***P<0.001 compared to the SMC576

As expected based on our previous studies [34, 37], the single pilW∷Mar19 and five independent pilY1∷Mar mutants isolated (Fig. 2a) showed a significant reduction in biofilm formation compared with the parental strain, SMC576 (Fig. 2b,c), as well as increased swarming motility and loss of twitching motility (Fig. 2b,c). Additionally, we identified as biofilm-defective a strain with a mutation in algC, whose gene product contributes to the biosynthesis of LPS, rhamnolipids [38, 39], and alginate, as well as a mutation in the pslI gene. Both the algC and pslI genes are required for the synthesis of the Psl polysaccharide [35, 40–44].

To confirm a role for the pilY1 gene in biofilm formation by strain SMC576, we performed complementation studies. Mutating the pilY1 gene in the SMC576 background resulted in an increased swarming phenotype, which could be complemented by the introduction of a plasmid carrying a wild-type copy of the pilY1 gene, but not by the vector control (pMQ70, Fig. 2d). Similarly, the twitching (Fig. 2d) and biofilm formation (Fig. 2d, e) defect of the pilY1 mutant could be complemented by the introduction of a plasmid carrying a wild-type copy of the pilY1 gene, but not by the vector control (pMQ70).

The algC mutant shows loss of swarming and twitching motility, as well as loss of biofilm formation (Fig. 2b, c). Furthermore, as expected based on a recent report [35], the algC mutant shows a reduced production of Psl polysaccharide as judged by ELISA using an antibody specific for the Psl polysaccharide (Fig. 3). The strain carrying a mutation in pslI shows no obvious swarming or twitching defect (Fig. 2b, c), but it does show reduced Congo Red binding (not shown) and Psl production (Fig. 3). Finally, as expected, the strain carrying a mutation in the pilY1 gene showed no difference in Psl production compared to the parent strain SMC576. Taken together, these phenotypic assays confirmed that we had mapped the mutations to the correct genes, and thus these mutants were useful tools for also studying imipenem resistance.

Fig. 3.

Fig. 3

Open in a new tab

Quantifying Psl production. Quantification of Psl production by ELISA for the indicated strains. The A450 value, a relative measure of Psl production as described in the “Materials and Methods”, is plotted on the Y-axis, and the strains tested are indicated on the X-axis. Clinical strain SMC576 and three transposon mutants are shown. P. aeruginosa PAO1 (PAO1) serves as a Psl-producing positive control, and P. aeruginosa PA14 (PA14) serves as a control for a strain lacking Psl. Data were analyzed by ANOVA with Tukey’s post-test comparison. ns not significantly different; ***P<0.001 compared to the SMC576

Based on the finding that loss of OprD resulted in loss of biofilm formation and increased resistance to imipenem, as outlined above, we hypothesized that there might be a general link between loss of biofilm formation and increased resistance to this antibiotic. Therefore, we used the Etest method to determine imipenem resistance profiles for the biofilm-defective mutants isolated in SMC576. In all cases, the biofilm-deficient mutants isolated showed imipenem resistance at levels equivalent to the parent strain (Table 3), suggesting that there is no general link between loss of biofilm formation and increased resistance to imipenem.

Table 3.

Imipenem resistance of biofilm mutants

Parent strain Mutation Imipenem MIC (μg/ml)
SMC576 none 1
SMC576 pilY1∷Mar8 1
SMC576 pilY1∷Mar13 1
SMC576 pilY1∷Mar18 1
SMC576 pilY1∷Mar20 1
SMC576 pilY1∷Mar25 1
SMC576 pilW∷Mar19 1
SMC576 algC∷Mar 1
SMC576 pslI∷Mar 1
SMC214 none 4
SMC214 pilX∷Mar 4
SMC214 pilW∷Mar 6
Open in a new tab

To extend our findings to a second clinical isolate, we screened ~1,500 Mariner transposon mutants of SMC214, a mucoid CF isolate of P. aeruginosa. Similar to SMC576, we identified biofilm-defective mutants that mapped to the pilX and pilW genes (Fig. 4). These mutations, as expected, also rendered the strains unable to twitch (Fig. 4), thus the phenotypic assay confirmed the mapping of the mutations.

Fig. 4.

Fig. 4

Open in a new tab

Identification of biofilm-deficient mutants in the clinical isolate SMC214. a Representative twitching (top) and biofilm (bottom) assay phenotypes of clinical isolate SMC214 and selected transposon mutants. All assays are performed as described in the “Materials and Methods”. The location of the insertion site is indicated in panel B. b Quantification of crystal violet-stained biofilms for the indicated strains, as described in detail in Fig. 1 and the “Materials and Methods”. Error bars represent standard deviations of the averages of four experiments with four replicates per experiment. Statistical analysis was performed using ANOVA with Tukey’s post-test comparison. *P<0.05; **P<0.01, compared to SMC214

As described above, all of the biofilm defective mutants of SMC214 showed imipenem resistance profiles similar to the parent strain (Table 3), confirming that there is no general link between loss of biofilm formation and increased resistance to imipenem.

Discussion

P. aeruginosa is an opportunistic pathogen that produces sessile communities known as biofilms that are highly tolerant to antibiotic treatment [45, 46]. However, the link between classical planktonic resistance mechanisms and biofilm formation is less clearly established. Here we show that OprD, which plays a major role in acquired resistance to imipenem also participates in biofilm formation. Loss of OprD function, which blocks entry of imipenem into the cell, results in resistance to this drug [7]. It appears that one trade-off for acquiring resistance to this antibiotic via loss of OprD may be a compromised ability to form a biofilm, at least on one model abiotic substratum.

In the experiments here, we utilized an oprD transposon mutant of P. aeruginosa PAO1 and a clinical isolate (SMC631) with a premature stop mutation in oprD, to establish this link between increased imipenem resistance and loss of biofilm formation. This finding prompted us to look more broadly at the relationship between imipenem resistance/sensitivity and biofilm formation. Thus, we examined both in vitro-selected imipenem-resistant variants of the sensitive clinical isolate SMC631, as well as additional clinical isolates of P. aeruginosa isolated from CF patients. As shown in Table 2, the trend of low biofilm formation correlating with high imipenem resistance appeared to be maintained (and vice versa), raising the question of whether loss of biofilm formation in general might confer imipenem resistance.

To test this idea, we selected two imipenem-sensitive clinical isolates which formed robust biofilms (SMC576 and SMC214). Using Mariner mutagenesis, we identified multiple biofilm-deficient strains, and we used a combination of complementation studies, phenotypic tests and biochemical studies to confirm the apparent defects in these strains and that we mapped the mutations to the correct genes (Figs. 2, 3, and 4). We isolated biofilm-deficient strains with mutations in genes known to be involved in biofilm formation based on studies of the P. aeruginosa PAO1 and PA14 lab strains, including mutations in factors required for pili biogenesis and function (pilA, pilO, pilY1, pilW, pilX) [34, 37, 47–50] and exopolysaccharide production (pslI, algC) [35, 40–44]. While a role for these genes in biofilm formation may not be surprising, they are useful in that they extend findings from laboratory strains to clinically relevant isolates. Importantly, none of the biofilm-deficient mutants showed imipenem resistance (MIC≥8 μg/ml), thus arguing against a general link between these two phenotypes.

There is little literature available that correlates mechanisms of planktonic antimicrobial resistance and biofilm production. Dheepa et al. indicated that the resistance to antibiotics such as ceftazidime, cefepime, and pipercillin in Acinetobacter baumannii was comparatively higher among biofilm producers than non-biofilm producers [51]. Similarly, Rao et al. and Ibrahim et al. investigated clinical isolates of A. baumannii, and these workers also found a significant association of biofilm formation with multiple drug resistance [52, 53]. These data indicate the possibility that there may be an under-appreciated link between planktonic resistance mechanisms and biofilm formation.

Acknowledgements

We thank MedImmune for generously providing the Psl antibody used in the ELISA. We also thank D.A. Hogan for providing some of the P. aeruginosa clinical strains. This work was supported by a fellowship to H.K.M. from the Iraqi government and NIH grant R01AI083256 to G.A.O.

Contributor Information

Hadeel K. Musafer, Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq Department of Microbiology and Immunology, Geisel School of Medicine at Dartmouth, Hanover, NH 03755, USA.

Sherry L. Kuchma, Department of Microbiology and Immunology, Geisel School of Medicine at Dartmouth, Hanover, NH 03755, USA

Amanda A. Naimie, Department of Microbiology and Immunology, Geisel School of Medicine at Dartmouth, Hanover, NH 03755, USA

Joseph D. Schwartzman, Department of Pathology, Dartmouth-Hitchcock Medical Center, Lebanon, NH 03756, USA

Harith J. Fahad AL-Mathkhury, Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq.

George A. O’Toole, Department of Microbiology and Immunology, Geisel School of Medicine at Dartmouth, Hanover, NH 03755, USA Department of Microbiology and Immunology, Geisel School of Medicine at Dartmouth, Rm 202 Remsen Building, Hanover, NH 03755, USA.

References

  • 1.O’Toole G, Kaplan HB, Kolter R (2000) Biofilm formation as microbial development. Annu Rev Microbiol 54:49–79 [DOI] [PubMed] [Google Scholar]
  • 2.Davies DG, Parsek MR, Pearson JP, Iglewski BH, Costerton JW, Greenberg EP (1998) The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science 280:295–298 [DOI] [PubMed] [Google Scholar]
  • 3.Sanchez-Romero I, Cercenado E, Cuevas O, Garcia-Escribano N, Garcia-Martinez J, Bouza E (2007) Evolution of the antimicrobial resistance of Pseudomonas aeruginosa in Spain: second national study (2003). Rev Esp Quimioterapia Publ Oficial Soc Esp Quimioterapia 20:222–229 [PubMed] [Google Scholar]
  • 4.Ruiz-Martinez L, Lopez-Jimenez L, Fuste E, Vinuesa T, Martinez JP, Vinas M (2011) Class 1 integrons in environmental and clinical isolates of Pseudomonas aeruginosa. Int J Antimicrob Agents 38: 398–402 [DOI] [PubMed] [Google Scholar]
  • 5.Riera E, Cabot G, Mulet X, Garcia-Castillo M, del Campo R, Juan C, Canton R, Oliver A (2011) Pseudomonas aeruginosa carbapenem resistance mechanisms in Spain: impact on the activity of Imipenem, meropenem and doripenem. J Antimicrob Chemother 66(9):2022–2027 [DOI] [PubMed] [Google Scholar]
  • 6.Lynch MJ, Drusano GL, Mobley HL (1987) Emergence of resistance to imipenem in Pseudomonas aeruginosa. Antimicrob Agents Chemother 31:1892–1896 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wolter DJ, Hanson ND, Lister PD (2004) Insertional inactivation of oprD in clinical isolates of Pseudomonas aeruginosa leading to carbapenem resistance. FEMS Microbiol Lett 236:137–143 [DOI] [PubMed] [Google Scholar]
  • 8.Wolter DJ, Khalaf N, Robledo IE, Vazquez GJ, Sante MI, Aquino EE, Goering RV, Hanson ND (2009) Surveillance of carbapenem-resistant Pseudomonas aeruginosa isolates from Puerto Rican Medical Center Hospitals: dissemination of KPC and IMP-18 beta-lactamases. Antimicrob Agents Chemother 53:1660–1664. doi: 10.1128/AAC.01172-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wolter DJ, Acquazzino D, Goering RV, Sammut P, Khalaf N, Hanson ND (2008) Emergence of carbapenem resistance in Pseudomonas aeruginosa isolates from a patient with cystic fibrosis in the absence of carbapenem therapy. Clin Infect Dis 46:e137–e141 [DOI] [PubMed] [Google Scholar]
  • 10.Evans JC, Segal H (2007) A novel insertion sequence, ISPA26, in oprD of Pseudomonas aeruginosa is associated with carbapenem resistance. Antimicrob Agents Chemother 51:3776–3777 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Yoneyama H, Nakae T (1993) Mechanism of efficient elimination of protein D2 in outer membrane of imipenem-resistant Pseudomonas aeruginosa. Antimicrob Agents Chemother 37:2385–2390 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Pirnay JP, De Vos D, Mossialos D, Vanderkelen A, Cornelis P, Zizi M (2002) Analysis of the Pseudomonas aeruginosa oprD gene from clinical and environmental isolates. Environ Microbiol 4:872–882 [DOI] [PubMed] [Google Scholar]
  • 13.El Amin N, Giske CG, Jalal S, Keijser B, Kronvall G, Wretlind B (2005) Carbapenem resistance mechanisms in Pseudomonas aeruginosa: alterations of porin OprD and efflux proteins do not fully explain resistance patterns observed in clinical isolates. APMIS 113: 187–196 [DOI] [PubMed] [Google Scholar]
  • 14.Zanetti G, Bally F, Greub G, Garbino J, Kinge T, Lew D, Romand JA, Bille J, Aymon D, Stratchounski L, Krawczyk L, Rubinstein E, Schaller MD, Chiolero R, Glauser MP, Cometta A (2003) Cefepime versus Imipenem-cilastatin for treatment of nosocomial pneumonia in intensive care unit patients: a multicenter, evaluator-blind, prospective, randomized study. Antimicrob Agents Chemother 47:3442–3447 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sanbongi Y, Shimizu A, Suzuki T, Nagaso H, Ida T, Maebashi K, Gotoh N (2009) Classification of OprD sequence and correlation with antimicrobial activity of carbapenem agents in Pseudomonas aeruginosa clinical isolates collected in Japan. Microbiol Immunol 53:361–367 [DOI] [PubMed] [Google Scholar]
  • 16.Fukuda H, Hosaka M, Iyobe S, Gotoh N, Nishino T, Hirai K (1995) nfxC-type quinolone resistance in a clinical isolate of Pseudomonas aeruginosa. Antimicrob Agents Chemother 39:790–792 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kohler T, Michea-Hamzehpour M, Henze U, Gotoh N, Curty LK, Pechere JC (1997) Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa. Mol Microbiol 23:345–354 [DOI] [PubMed] [Google Scholar]
  • 18.Shanks RM, Caiazza NC, Hinsa SM, Toutain CM, O’Toole GA (2006) Saccharomyces cerevisiae-based molecular tool kit for manipulation of genes from gram-negative bacteria. Appl Environ Microbiol 72:5027–5036 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.CLSI (2013) Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Third Informational Supplement. Clinical and Laboratory Standards Institute, Wayne, CLSI document M100–S23 [Google Scholar]
  • 20.Andrews JM (2001) Determination of minimum inhibitory concentrations. J Antimicrob Chemother 48(Suppl 1):5–16 [DOI] [PubMed] [Google Scholar]
  • 21.Wiegand I, Hilpert K, Hancock RE (2008) Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc 3:163–175 [DOI] [PubMed] [Google Scholar]
  • 22.O’Toole GA, Pratt LA, Watnick PI, Newman DK, Weaver VB, Kolter R (1999) Genetic approaches to the study of biofilms. In: Doyle RJ (ed) Methods in Enzymology. Academic Press, San Diego, pp 91–109 [DOI] [PubMed] [Google Scholar]
  • 23.Caetano-Annoles G (1993) Amplifying DNA with arbitrary oligonucleotide primers. PCR Methods Appl 3:85–92 [DOI] [PubMed] [Google Scholar]
  • 24.O’Toole GA, Kolter R (1998) Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol Microbiol 28:449–461 [DOI] [PubMed] [Google Scholar]
  • 25.Whitchurch CB, Hobbs M, Livingston SP, Krishnapillai V, Mattick JS (1990) Characterization of a Pseudomonas aeruginosa twitching motility gene and evidence for a specialized protein export system widespread in eubacteria. Gene 101:33–44 [DOI] [PubMed] [Google Scholar]
  • 26.O’Toole GA, Kolter R (1998) Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 30:295–304 [DOI] [PubMed] [Google Scholar]
  • 27.Caiazza NC, O’Toole GA (2004) SadB is required for the transition from reversible to irreversible attachment during biofilm formation by Pseudomonas aeruginosa PA14. J Bacteriol 186:4476–4485 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Honko AN, Sriranganathan N, Lees CJ, Mizel SB (2006) Flagellin is an effective adjuvant for immunization against lethal respiratory challenge with Yersinia pestis. Infect Immun 74:1113–1120 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Digiandomenico A, Warrener P, Hamilton M, Guillard S, Ravn P, Minter R, Camara MM, Venkatraman V, Macgill RS, Lin J, Wang Q, Keller AE, Bonnell JC, Tomich M, Jermutus L, McCarthy MP, Melnick DA, Suzich JA, Stover CK (2012) Identification of broadly protective human antibodies to Pseudomonas aeruginosa exopolysaccharide Psl by phenotypic screening. J Expl Med 209: 1273–1287 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Trias J, Nikaido H (1990) Protein D2 channel of the Pseudomonas aeruginosa outer membrane has a binding site for basic amino acids and peptides. J Biol Chem 265:15680–15684 [PubMed] [Google Scholar]
  • 31.Trias J, Nikaido H (1990) Outer membrane protein D2 catalyzes facilitated diffusion of carbapenems and penems through the outer membrane of Pseudomonas aeruginosa. Antimicrob Agents Chemother 34:52–57 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Mah TF, O’Toole GA (2001) Mechanisms of biofilm resistance to antimicrobial agents. Trends Microbiol 9:34–39 [DOI] [PubMed] [Google Scholar]
  • 33.Friedman L, Kolter R (2004) Genes involved in matrix formation in Pseudomonas aeruginosa PA14 biofilms. Mol Microbiol 51: 675–690 [DOI] [PubMed] [Google Scholar]
  • 34.Kuchma SL, Griffin EF, O’Toole GA (2012) Minor pilins of the type IV pilus system participate in the negative regulation of swarming motility. J Bacteriol 194:5388–5403 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zegans ME, Wozniak D, Griffin E, Toutain-Kidd CM, Hammond JH, Garfoot A, Lam JS (2012) Pseudomonas aeruginosa exopolysaccharide Psl promotes resistance to the biofilm inhibitor polysorbate 80. Antimicrob Agents Chemother 56:4112–4122 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Li Y, Hao G, Galvani CD, Meng Y, De La Fuente L, Hoch HC, Burr TJ (2007) Type I and type IV pili of Xylella fastidiosa affect twitching motility, biofilm formation and cell-cell aggregation. Microbiology 153:719–726 [DOI] [PubMed] [Google Scholar]
  • 37.Kuchma SL, Ballok AE, Merritt JH, Hammond JH, Lu W, Rabinowitz JD, O’Toole GA (2010) Cyclic-di-GMP-mediated repression of swarming motility by Pseudomonas aeruginosa: the pilY1 gene and its impact on surface-associated behaviors. J Bacteriol 192:2950–2964 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Goldberg JB, Hatano K, Pier GB (1993) Synthesis of lipopolysaccharide O side chains by Pseudomonas aeruginosa PAO1 requires the enzyme phosphomannomutase. J Bacteriol 175:1605–1611 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Olvera C, Goldberg JB, Sanchez R, Soberon-Chavez G (1999) The Pseudomonas aeruginosa algC gene product participates in rhamnolipid biosynthesis. FEMS Microbiol Lett 179:85–90 [DOI] [PubMed] [Google Scholar]
  • 40.Friedman L, Kolter R (2004) Two genetic loci produce distinct carbohydrate-rich structural components of the Pseudomonas aeruginosa biofilm matrix. J Bacteriol 186:4457–4465 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Davies DG, Geesey GG (1995) Regulation of the alginate biosynthesis gene algC in Pseudomonas aeruginosa during biofilm development in continuous culture. Appl Environ Microbiol 61:860–867 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Davies DG, Chakabarty AM, Geesey GG (1993) Exopolysaccharide production in biofilms: substratum activation of alginate gene expression by Pseudomonas aeruginosa. Appl Environ Microbiol 59:1181–1186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Jackson KD, Starkey M, Kremer S, Parsek MR, Wozniak DJ (2004) Identification of psl, a locus encoding a potential exopolysaccharide that Is essential for Pseudomonas aeruginosa PAO1 biofilm formation. J Bacteriol 186:4466–4475 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Matsukawa M, Greenberg EP (2004) Putative exopolysaccharide synthesis genes influence Pseudomonas aeruginosa biofilm development. J Bacteriol 186:4449–4456 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Costerton JW, Stewart PS, Greenberg EP (1999) Bacterial biofilms: a common cause of persistent infections. Science 284:1318–1322 [DOI] [PubMed] [Google Scholar]
  • 46.Hoiby N, Bjarnsholt T, Givskov M, Molin S, Ciofu O (2010) Antibiotic resistance of bacterial biofilms. Int J Antimicrob Agents 35:322–332 [DOI] [PubMed] [Google Scholar]
  • 47.Alm RA, Bodero AJ, Free PD, Mattick JS (1996) Identification of a novel gene, pilZ, essential for type 4 fimbrial biogenesis in Pseudomonas aeruginosa. J Bacteriol 178:46–53 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Alm RA, Hallinan JP, Watson AA, Mattick JS (1996) Fimbrial biogenesis genes of Pseudomonas aeruginosa: pilW and pilX increase the similarity of type 4 fimbriae to the GSP protein-secretion systems and pilY1 encodes a gonococcal PilC homologue. Mol Microbiol 22: 161–173 [DOI] [PubMed] [Google Scholar]
  • 49.Bohn YS, Brandes G, Rakhimova E, Horatzek S, Salunkhe P, Munder A, van Barneveld A, Jordan D, Bredenbruch F, Haussler S, Riedel K, Eberl L, Jensen PO, Bjarnsholt T, Moser C, Hoiby N, Tummler B, Wiehlmann L (2009) Multiple roles of Pseudomonas aeruginosa TBCF10839 PilY1 in motility, transport and infection. Mol Microbiol 71:730–747 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Giltner CL, Habash M, Burrows LL (2010) Pseudomonas aeruginosa minor pilins are incorporated into type IV pili. J Mol Biol 398:444–461 [DOI] [PubMed] [Google Scholar]
  • 51.Dheepa M, Rashme VL, Appalaraju B (2011) Comparision of biofilm production and multiple drug resistance in clinical isolates of Acinetobacter baumanii from a tertiary care hospital in South India. Int J Pharm Biomed Sci 2:103–107 [Google Scholar]
  • 52.Rao RS, Karthika RU, Singh SP, Shashikala P, Kanungo R, Jayachandran S, Prashanth K (2008) Correlation between biofilm production and multiple drug resistance in imipenem resistant clinical isolates of Acinetobacter baumannii. Indian Journal Med Microbiol 26:333–337 [DOI] [PubMed] [Google Scholar]
  • 53.Ibrahim NH, Somily AM, Bassyouni RH, El-Aabedien AZ (2012) Comparative study assessing the effect of tigecycline and moxifloxacin in prevention of Acinetobacter baumannii biofilm. Life Sci 9:1016–1024 [Google Scholar]
  • 54.Jacobs MA, Alwood A, Thaipisuttikul I, Spencer D, Haugen E, Ernst S, Will O, Kaul R, Raymond C, Levy R, Chun-Rong L, Guenthner D, Bovee D, Olson MV, Manoil C (2003) Comprehensive transposon mutant library of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 100:14339–14344 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Simon R, Priefer U, Pühler A (1983) A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Nat Biotechnol 1:784–791 [Google Scholar]
  • 56.Kulasekara HD, Ventre I, Kulasekara BR, Lazdunski A, Filloux A, Lory S (2005) A novel two-component system controls the expression of Pseudomonas aeruginosa fimbrial cup genes. Mol Microbiol 55:368–380 [DOI] [PubMed] [Google Scholar]

RESOURCES