Skip to main content
NCBI home page
Springer logoLink to Springer
. 2022 Apr 5;47(1):29–38. doi: 10.1007/s11259-022-09923-6

Epidemiology of Group A rotavirus in rodents and shrews in Bangladesh

Ariful Islam 1,2,3,✉, Mohammad Enayet Hossain 4, Ausraful Islam 4, Shariful Islam 1,3, Md Kaisar Rahman 1,3, Rashedul Hasan 4, Mojnu Miah 4, Mohammed Ziaur Rahman 4,✉
PMCID: PMC8980207  PMID: 35380357

Abstract

Rodents and shrews live in close proximity to humans and have been identified as important hosts of zoonotic pathogens. This study aimed to detect Group A rotavirus (RVA) and its potential risk factors in rodents and shrews in Bangladesh. We captured 417 small mammals from 10 districts with a high degree of contact between people and domestic animals and collected rectal swab samples between June 2011 and October 2013. We tested the swab samples for RVA RNA, targeting the NSP3 gene segment using real-time reverse transcription-polymerase chain reaction (rRT-PCR). Overall, RVA prevalence was the same (6.7%) in both rodents and shrews. We detected RVA RNA in 5.3% of Bandicota bengalensis (4/76; 95% CI: 1.4–12.9), 5.1% of B. indica (4/79; 95% CI: 1.4–12.4), 18.2% of Mus musculus (4/22; 95% CI: 5.2–40.3), 6.7% of Rattus rattus (6/90; 95% CI: 2.5–13.9), and 6.7% of Suncus murinus (10/150; 95% CI: 3.2–11.9). We found significantly more RVA in males (10.4%; OR: 3.4; P = 0.007), animals with a poor body condition score (13.9%; OR: 2.7; P = 0.05), during wet season (8.3%; OR: 4.1; P = 0.032), and in urban land gradients (10.04%; OR: 2.9; P = 0.056). These findings form a basis for understanding the prevalence of rotaviruses circulating among rodents and shrews in this region. We recommend additional molecular studies to ascertain the genotype and zoonotic potential of RVA circulating in rodents and shrews in Bangladesh.

Keywords: Prevalence, Bandicota, Mus musculus, Rattus rattus, Suncus murinus, Rotavirus

Introduction

Group A rotavirus (RVA) causes acute dehydrating diarrhea (Wenman et al. 1979; Parashar et al. 2006) in humans, especially children, and animals worldwide. Annual 128,500 deaths and 258,173,300 cases of diarrhea in children <5 years of age are attributable to RVA infection (Troeger et al. 2018). RVA is commonly transmitted via the fecal and oral routes (Anderson and Weber 2004). However, water, food, fomites (de Wit et al. 2003), and flies (Musca domestica) (Tan et al. 1997) can also be a source of infection for humans. Common symptoms of RVA include vomiting and diarrhea in children but nausea, malaise, headache, abdominal cramping, diarrhea, and fever in adults (Anderson and Weber 2004).

Different animal species, including small mammals, are infected with RVA (Dhama et al. 2009). Rodents and shrews belong to a diverse group of small mammals and are found widely throughout the world (Meerburg et al. 2009). They often live in close proximity to humans and domestic animals. Small mammals have the highest capacity for successful adaptation. Twenty-two species of rodents are found in Bangladesh (Khan 2013). Among them, M. musculus (house mouse), R. rattus (black rat/house rat), Bandicota indica (greater bandicoot rat), and B. bengalensis (Indian mole rat) are very common (Islam et al. 2020). M. musculus and R. rattus are listed among the 100 of the world’s most invasive alien species (Lowe et al. 2000). Of the 160 million people in Bangladesh, 13.6 million are exposed to rodents every month, and 8.5% (95%CI: 7.9–9.1) of people have direct contact with rodents (Shanta et al. 2016).

Small mammals’ species richness, density, and diversity are an indicator of a healthy and stable ecosystem (Avenant 2003). Although rodents and shrews play an essential role in ecology, they act as reservoirs of zoonotic pathogens (Meerburg et al. 2009) like Hantavirus (Wang et al. 2000; Radosa et al. 2013), Yersinia pestis, Rickettsia (typhus), Leptospira (Weil’s disease), Toxoplasma, Trichinella, Hepatitis E (Favorov et al. 2000), Bartonella (Ellis et al. 1999), Borrelia, Babesia, Anaplasma and Ehrlichia (Tadin et al. 2016). Rodents can transmit more than 20 diseases to humans through blood-sucking parasites (fleas, ticks, and mites) (Singla et al. 2008). Rodents and shrews are usually found near human and animal habitations at high densities as well as in other habitats like woodland and abandoned warehouses (Veciana et al. 2012). Due to urbanization and deforestation, wild small mammal populations come to human localities. Human-animal contact frequently occurs, which boosts the chance of cross-species transfer of zoonoses, including rotavirus (Sumangali et al. 2007), and poses a health risk to humans (Paramasvaran et al. 2009). Currently, zoonotic rotavirus infection in humans is more frequent than in the past, and various studies have reported the interspecies transmission of rotavirus from animals to humans (Doro et al. 2015; Martella et al. 2010). There is no way to rule out the possibility of rotaviruses becoming more pathogenic and increasing their transmissibility to humans through reassortment with other genotypes of RVA, similar to influenza viruses (Cowley et al. 2013; Li et al. 2016). Small mammals pose a significant risk to human health, especially those that have direct or indirect contact with animals. However, viruses carried by small mammals have not been well investigated in Bangladesh. The evolution and emergence of rotaviruses in the context of human health is an enigma, and it is public health to better understand the diversity, evolution, and origins of rotaviruses in small mammals.

In Bangladesh, one study reported a 64% prevalence of rotavirus among hospitalized children 5 years of age and younger admitted with acute gastroenteritis (Satter et al. 2017). There is an opportunity for cross-species transmission of zoonotic pathogens, including rotaviruses, because of the higher percentage of human cases, the high density of the human population, frequent contact with animals, including small mammals, and lack of awareness regarding hygiene and sanitation.

Data on rotavirus in small mammals are limited in the Indian subcontinent. RVA was isolated from urban wild rats (R. norvegicus) in Germany (Sachsenröder et al. 2014) and Brazil (Tonietti et al. 2013). Common shrews (Sorex araneus) (21.7%) in Germany were found to be infected with RVA (Johne et al. 2019). The prevalence of RVA in different rodents and shrew species in China was found to be 1.06% and 2.67%, respectively, by RT-PCR (Li et al. 2016), whereas rotaviral antigen was detected in 6.7% of samples from wild tree shrews (Tupaia belangeri Chinese) using ELISA (Wang et al. 2011). Due to the segmented nature of the viral genome, animal RVA can easily infect and adapt to humans through reassortment with other RVAs (Ianiro et al. 2017). Similarly, diverse strains of human RVA have been found that share genetic and antigenic features with animal RVA strains (Ianiro et al. 2017). The G3 genotype frequently infects humans, pigs, dogs and cats, horses, bats, and murine rodents (Geletu et al. 2021; Simsek et al. 2021). Murine RVA strains prolifically infect and multiply in mice only. Even though cross-species transmission of RVA from mice to humans has never been documented, animal-associated RVA is prevalent. However, within the last few years, interspecies transmission and genetic assortment between human and animal rotaviruses from cows, pigs, cats, and dogs have been reported (He et al. 2017; Sawant et al. 2020). Hence, it can be speculated that the cross-species transmission of RVA might occur between humans and rodents in Bangladesh. However, there is no published literature on RVA in rodents and shrews in Bangladesh to our knowledge. Therefore, the study aimed to determine the prevalence of RVA in the rodent and shrew population of Bangladesh. This will help conduct further research on their zoonotic potential in the future.

Methods

Study sites and duration

From June 2011 to October 2013, we captured rodents and shrews from 10 different districts (Faridpur, Mymensingh, Rajbari, Rangamati, Khagrachhari, Dinajpur, Maulvibazar, Rangpur, Cox’s Bazar, and Joypurhat) in Bangladesh (Fig. 1). We selected sampling sites that were high-risk interfaces where frequent animal-human contact occurs. We categorized the selected study sites based on different land gradients as i) urban areas having a high population density and built environment infrastructure; and ii) Rural areas having a comparatively low population density with more agricultural land and less infrastructure. We captured the rodents and shrews from human dwellings, agricultural fields, and bushland in both urban and rural areas.

Fig. 1.

Fig. 1

Open in a new tab

A map of Bangladesh displaying the sampling locations and spatial distribution of rodent and shrew species captured in the study areas from June 2011 to October 2013. The map was plotted using the spatial analyst tool of ArcGIS (ArcMap, version 10.2, Environmental Systems Research Institute, CA, USA) (Available at https://www.arcgis.com/index.html). Bangladesh’s administrative and study site shapefiles were retrieved from Humanitarian Data Exchange v1/1.43.6, the United Nations Office for the Coordination of Humanitarian Affairs (Available at https://data.humdata.org). Red triangles depict B. bengalensis, green squares indicate B. indica, blue pentagonsdepict M. musculus, purple circles denote Rattus rattus, and yellow star dot depicts Suncus murinus

Animal capture, sample collection, and data recording

We captured live rodents and shrews using locally made steel wire traps (27 cm × 13 cm × 13 cm) that have proven efficacy in sampling medium- and large-sized small mammals. We baited the traps with ghee-smeared biscuits and dried fish. We set the traps in human dwellings, agricultural fields, or bushland at dusk after obtaining verbal permission from the owners and collected them at dawn the next day. As rodents and shrews are considered pests, there was no objection from the owners of the properties, and we got their full consent and cooperation. We anesthetized the trapped animals using isoflurane following the procedures described elsewhere (Shafiyyah et al. 2012; Rahman et al. 2018). We collected rectal swabs and/or feces from each captured animal. Our research protocol and methods were carried out in accordance with the national institutional ethics committee of the International Centre for Diarrheal Disease Research, Bangladesh (icddr,b) (reference number: 2008–074) and the international ethics committee of the University of California, Davis Institutional Animal Care and Use Committee (IACUC #16048). After sampling, we released all the animals at the sites of capture. We identified the species of small mammals based on their morphological characteristics as described by Aplin et al. (Aplin et al. 2003). We recorded the lengths of the head, body, tail, hindfoot, and ear and the bodyweight; these parameters helped determine the species and age classes of the animals.

We captured a total of 417 small mammals consisting of B. Indica (N = 79), B. bengaleensis (N = 76), M. musculus (N = 22), R. rattus (N = 90), and S. murinus (N = 150). We placed the swab samples into 0.5 mL lysis buffer (NucliSENS Lysis Buffer, BIOMERIEUX, France) in a 1.8 mL cryotube (Corning, USA). We then stored the cryotubes in a liquid nitrogen dewar (Princeton Cryogenics, NJ, USA) immediately after collection in the field until their transfer to a -80 °C freezer at the icddr,b laboratory. We used a data sheet to record information like location, habitat, gradient of sampling sites, season and prominent anthropogenic changes, species, age, sex, morphometric measurements, Body Condition Score (BCS), and health status. We categorized the age groups as i) juvenile: weaned, independent from parental nursing, and without developed secondary sexual characteristics like descended testicles in males and ii) adults: matured in size and weight, with developed secondary sexual characteristics (Rahman et al. 2019). We categorized the land gradient as urban or residential, rural, and agricultural land (crop or pastureland). During data collection, we classified the BCS according to Hickman and Swan (2010), as emaciated (BCS-1), under conditioned (BCS-2), well-conditioned (BCS-3), over-conditioned (BCS-4), and obese (BCS-5). Finally, we regrouped the BCS-1 and BCS-2 as poor, BCS-3 as fair, and BCS-4 and BCS-5 as good.

RNA extraction, and PCR

According to the manufacturer’s instructions, we extracted viral RNA from 200 μL rectal swab samples using the magnetic particle-based InviMag Virus DNA/RNA Mini kit (STRATEC Molecular GmbH, Germany); the final elution volume was 100 μL. We tested rectal swabs for RVA RNA by rRT-PCR using NSP3-specific primers and probes using the AgPath-ID One-Step RT-PCR system (Ambion Inc. Austin, USA) (Table 1) as described by Jothikumar et al. (2009) and Islam et al. (2020a). We performed conventional RT-PCR using the QIAGEN® One-Step RT-PCR kit (QIAGEN, Germany) to amplify the VP7 and VP4 gene fragments using consensus primer pairs Beg9/End9 and Con2/Con3 for identifying the G and P genotype, respectively (Table 1), as described by Rahman et al. (2007) and Islam et al. (2020b). We used MOCK (only lysis) and known RVA positive samples during the extraction process to ensure proper nucleic acid extraction.

Table 1.

Oligonucleotide primers used in the study for PCR amplification

Primer Target segment of RVA genome Position Strand Sequence (5′−3′) References
JVKF NSP3 17–39 Plus CAGTGGTTGATGCTCAAGATGGA Jothikumar et al. (2009)
JVKR NSP3 147–123 Minus TCATTGTAATCATATTGAATACCCA Jothikumar et al. (2009)
JVKP NSP3 96–72 Plus FAM-ACAACTGCAGCTTCAAAAGAAGWGT-BHQ1 Jothikumar et al. (2009)
Beg9 VP7 1–28 Plus GGCTTTAAAAGAGAGAATTTCCGTCTGG Gouvea et al. (1990)
End9 VP7 1062–1036 Minus GGTCACATCATACAATTCTAATCTAAG Gouvea et al. (1990)
Con2 VP4 868–887 Minus ATTTCGGACCATTTATAACC Gentsch et al. (1992)
Con3 VP4 11–32 Plus TGGCTTCGCCATTTTATAGACA Gentsch et al. (1992)
Open in a new tab

Statistical analysis

We entered the data into MS Excel-2013 (Microsoft office excel-2013, USA) and imported it to STATA-13 (StataCorp, 4905, Lakeway Drive, College Station, Texas 77,845, USA) for analysis. We performed descriptive statistics for different variables using Fisher’s exact test. Then, we forwarded the variables (p < 0.2) to multivariable logistic regression and checked for confounding. We tested the model’s goodness of fit using the Hosmer–Lemeshow test. Additionally, the predictive ability of the model was determined using the Receiver Operating Characteristic (ROC) curve (Dohoo et al. 2003). The area under the curve (AUC) was categorized as acceptable (AUC = 0.7 to 0.8), excellent (AUC = 0.8–0.9), and outstanding (AUC = 0.9 to 1.0) (Dw 2000; Sayeed et al. 2017). We considered differences among the variables to be significant if p < 0.05.

Results

We detected a 6.7% (n = 28) prevalence of RVA in the sampled small mammals but could not amplify any G or P type among the RVA-positive samples. We found similar percentages of RVA in both rodents (n = 18; 6.7%; 95%CI: 4.04–10.45) and shrews (n = 10; 6.7%; 95%CI: 3.2–11.9). REgarding animal species, M. musculus (n = 4; 18.2%; 95%CI: 5.2–40.3) had the highest and B. indica (n = 4; 5.1%; 95%CI: 1.3–12.5) the lowest percentage of RVA. We did not find any significant variation in RVA prevalence between juveniles (n = 3; 6.1%; 95% CI: 1.3–16.9) and adult (n = 25; 6.8%; 95%CI: 4.44–9.9). Significantly more male animals (n = 20; 10.4%; 95%CI: 6.5–15.6) were infected with RVA than females (n = 8; 3.6%; 95%CI: 1.6–6.9; p = 0.006). Animals from urban area (n = 23; 10.04%; 95%CI: 6.4–14.7) were more likely to be positive for RVA than animals from rural areas (n = 5; 2.66%; 95%CI: 0.87–6.1) (p = 0.003). We observed that significantly less rodents and shrews from agricultural fields or bushlands were infected than those from human dwellings (p = 0.039) (Table 2).

Table 2.

The association of selected variables and RVA presence in small mammals (N = 417) from Bangladesh

Variables Category N RVA-positive
n (%)		 p value* (Fisher’s exact)
Types of mammals Rodent 267 18 (6.7) 1.00
Shrew 150 10 (6.7)
Species Bandicota bengalensis 76 4 (5.3) 0.325
B. indica 79 4 (5.1)
Mus musculus 22 4 (18.2)
Rattus rattus 90 6 (6.7)
Suncus murinus 150 10 (6.7)
Age Adult 368 25 (6.8) 1.000
Juvenile 49 3 (6.1)
Sex Female 225 8 (3.6) 0.006
Male 192 20 (10.4)
Land gradient Urban 229 23 (10.04) 0.003
Rural 188 5 (2.66)
Habitat type Agricultural field/bushland 150 5 (3.3) 0.042
Human dwelling 267 23 (8.6)
BCS Poor 72 10 (13.9) 0.016
Good 345 18 (5.2)
Health status Apparently healthy 394 24 (6.1) 0.059
Sick 23 4 (17.4)
Season Dry 115 3 (2.6) 0.047
Wet 302 25 (8.3)
Open in a new tab

*The p values are for unconditional significance tests for differences among categories within each variable

Multivariable logistic regression analysis revealed that males had 3.4 times higher risk of having RVA than females (95% CI: 1.39–8.04; p = 0.007), whereas animals with poor BCS were 2.7 times more susceptible to RVA than those with a good BCS (95% CI: 0.99–7.38; p = 0.05). Samples collected during the wet season were 4.1 times more likely to be positive than those obtained during the dry season (p = 0.032). Additionally, small mammals from urban areas had a 2.9 times higher risk of being RVA-positive than animals from rural areas (95% CI: 0.97–9.15; p = 0.056) (Table 3).

Table 3.

Multivariable logistic regression model for identifying key risk factors for RVA in rodents and shrews in Bangladesh

Variables Factors Odds ratio 95% CI* p value
Lower bound Upper bound
Sex Female 1.0
Male 3.4 1.39 8.04 0.007
BCS Good 1.0
Poor 2.7 0.99 7.38 0.05
Health status Apparently healthy 1.0
Sick 0.8 0.19 3.48 0.789
Season Dry 1.0
Wet 4.1 1.13 14.65 0.032
Land gradient Rural 1.0
urban 2.9 0.97 9.15 0.056
Habitat type Agricultural field/bushlands 1.0
Human dwelling 1.8 0.59 5.79 0.284
Open in a new tab

*Confidence interval

We validated the model using the ROC curve (area under curve, AUC 77%) (Fig. 2). The plot of sensitivity versus 1-specificity depicts the predictability of the logistic model across various parameters associated with RVA in small mammals of Bangladesh.

Fig. 2.

Fig. 2

Open in a new tab

The plot of sensitivity versus 1-specificity for a receiver operating characteristic curve (ROC) of various parameters of the logistic model of RVA in small mammals in Bangladesh

Discussion

The study detected RVA in different species of rodents and shrews in several areas in Bangladesh. Previous studies identified RVA in other species of rodents and shrews using RT-PCR in Germany (Sachsenröder et al. 2014), China (Li et al. 2016), Brazil (Tonietti et al. 2013), and New York (Williams et al. 2018). In contrast, studies in Australia (McInnes et al. 2011), West Indies (Boey et al. 2019), and Western Europe (Mähler and Köhl 2009) reported rotavirus antibodies in rodents. However, published literature on RVA in small mammals is scarce worldwide. To the authors’ knowledge, the present study is the first to report RVA in rodents and shrews in different habitat types and land gradients in Bangladesh. Previous studies reported P and G genotypes of RVA infection in humans and animals in Bangladesh, strongly suggesting the possibility of zoonotic transmissions (Dey et al. 2020; Mazid et al. 2020; Sharif et al. 2020). Thus, the current study findings extend the known host range of RVA in Bangladesh and will be helpful for the rest of the world prevent and control the spillover of RVA from rodents and shrews.

We detected RVA in Rattus rattus, but in Brazil and Germany, RVA was seen in R. norvegicus (Tonietti et al. 2013; Sachsenröder et al. 2014). Similarly, we identified RVA in M. musculus, whereas studies in Australia reported it in Mus musculus domesticus, a subspecies of M. musculus (Singleton et al. 1993; Smith et al. 1993). However, our study did not genotype R. rattus and Mus musculus mice. Nevertheless, earlier studies reported the presence of both R. norvegicus and M. musculus doemesticus from Bangladesh (Adhikari et al. 2018; Barman et al. 2020). The prevalence of RVA in our studied rodents was higher than in previous studies (Li et al. 2016; Ianiro et al. 2017), but in the case of shrews, our results are similar to those of a former study from China that found a 6.7% seroprevalence in wild tree shrews (Tupaia belangeri Chinese) using antigen-capture ELISA (Wang et al. 2011). A study in Germany reported a 21.7% prevalence of RVA in common shrews, which is much higher than in our study (Johne et al. 2019). The higher prevalence may be due to the differences in host species (Sorex araneus) and the wide circulation of RVA in shrews from different regions in Germany.

A comparatively high prevalence of RVA was found in rodents and shrews in urban areas. Rodent and shrew density is higher in urban and peri-urban areas compared to rural areas in Bangladesh (Shanta et al. 2016). Moreover, more than 90% of urban and peri-urban household members observed rodents and shrews on their premises, where 8.5% of respondents reported direct contact with them. A previous study from Bangladesh reported a high density of rodents and shrews in urban areas, making them more susceptible to infectious agents either by functional suppression of the immune system caused by a viral infection, malnutrition, or the stress induced by overcrowding (Smith et al. 1993). Besides, urban areas are densely populated with humans where rodents and shrews are considered pests. These small mammals live in human houses (Veciana et al. 2012). They collect food at night and pick up contaminated food from human sources, which may also expose them to RVA. Moreover, RVA is circulating in domestic and wild animals in developing countries like Bangladesh, where humans and animals live in proximity and have frequent interactions (Hossain et al. 2020). This also indicates the possible transmission of RVA from humans to small mammals (Ianiro et al. 2017), which may explain the greater positivity rate of samples near human dwellings.

We found the highest odds ratio for RVA presence in M. musculus but could not find any previous study to compare our results. However, some studies have evaluated the presence of antibodies against RVA in different animals. One study estimated the seroprevalence of RVA in laboratory mice and rats in Western Europe and found the highest seroprevalence in mice (Mähler and Köhl 2009). We found RVA in a higher percentage of small mammals sampled during the wet season. A study conducted on M. musculus domesticus by Singleton et al. (1993) also found similar trends of seroprevalence during the wet season (April to September) in Southern Australia. The authors also reported increased mouse densities over time. Though we did not record any animal density-related information, this may be the case in our study.

Additionally, serology does not confirm the presence of infection, instead indicating recent infection. All the positive samples from sick animals were collected during the wet season. From April to September (wet season), comparatively little food is available for the animals. Moreover, the quality of food available is not adequate, resulting in malnutrition among small mammals. September to October is also the breeding season, creating social stress on male mice (Singleton et al. 1993). All these factors may influence viral prevalence and persistence in the studied animals.

Sex and BCS also influenced the presence of RVA in our study, but the reason behind this is not clear. One explanation may be that male mammals are more active than females, which predisposes them to infection from various sources. Sometimes, BCS provides more precise information to assess the health status of animals (Hickman and Swan 2010). Usually, animals with poor body conditions are immune-compromised and have limited access to food, which makes them susceptible to different infectious diseases (Smith et al. 1993). However, we admit that the observed relationship between health conditions and RVA presence in the animals may be due to a sampling artifact. We captured a disproportionately higher percentage of rodents and shrews in the wet seasons, corresponding to a study in Uganda (Ssuuna et al. 2020). Environmental factors influence the composition and abundance of rodent species, and rapid growth of vegetation occurs during the rainy season, providing shelter and food for rodents and shrews. Besides, human activities differ concerning different months and seasons, influencing the capture of small mammals (Mulungu et al. 2003).

Human infections associated with group A, B, and C rotavirus are common in Bangladesh (Dey et al. 2020), but the rodent-borne RVA is unknown as data regarding the incidence of zoonotic human RVA infections in Bangladesh are not available. We found RVA in rodents and shrews in Bangladesh, with some critical factors related to RVA infection in peri-domestic species. However, it is crucial to establish longitudinal surveillance across multiple regional animal populations to detect and genetically characterize the RVA. This study did not focus on proving human infection from rodents and shrews. However, as rodents and shrews often live in close contact with humans, although the presence of RVA in rodents and shrews in this study was low (6.7%), it would not be rational to overlook the risk of small mammal borne RVA infection in humans. On the other hand, human RVA strains cannot infect mice under laboratory conditions. Therefore, it is also unlikely that human RVA will infect rodents and shrews (Ciarlet et al. 2002).

The study has some limitations. The primers and probes used were not designed for rodents. However, these primers and probes have a wide range and are used for detecting RVA in clinical and environmental samples. We detected RVA in macaques, bats, and domestic animals using the same primers targeting the NSP3 gene in earlier studies (Hossain et al. 2020; Islam et al. 2020a; Islam et al. 2020b). In the current study, we did not have access to rodent-specific internal positive controls (IPC). Using IPCs would have excluded the possibility of getting false-negative results. We also could not successfully amplify and sequence the VP4 and VP7 genes from RVA-positive samples. This may be due to lower nucleic acid content in the swab samples.

Additionally, we cannot ignore the genetic diversity of RVA in rodents, which may impact the performance of the primers used in this study (Čolić et al. 2021). Nevertheless, next-generation sequencing and/or primer-independent approaches are needed to improve the characterization of RVAs in the fecal samples of rodents and shrews in Bangladesh. We recommend establishing longitudinal surveillance to detect and genetically characterize RVA among multiple host populations, conduct DNA barcoding to identify spatial patterns in these species.

Conclusions

Taken together, the findings of this study suggest that RVA is circulating in rodents and shrews in Bangladesh. Similar to other wildlife species, it is difficult to detect and sequence RVA in small mammals. As rodents and shrews often live in close contact with humans as well as with farm and pet animals, they form a distinct and significant nexus between wildlife communities and human populations. We recommend further studies on the molecular characterization of RVA in rodents and shrews, their epizootiology, and possible risks to humans at different land gradients in Bangladesh.

Acknowledgments

We thank the Bangladesh Forest Department and the Ministry of Environment and Forest for permission to conduct this study. We are thankful for icddr, b, and its core donors, the Governments of Australia, Bangladesh, Canada, Sweden, and the UK, for providing core/unrestricted support to icddr,b. We thank Jonathan Epstein, Melinda Rostal, Peter Daszak, Emily. S. Gurley, Najmul Haider, Jinnat Ferdous, Tapan Kumar Dey, Shafiqul Islam, Abdul Hai, Pitu Biswas, and Gafur Sheikh for their contributions to this study.

Authors’ contributions

Ariful Islam and Ausraful Islam conceived and designed the experiments; Ariful Islam and Ausraful Islam performed the sample collection; Mohammad Enayet Hossain, Rashedul Hasan, Mojnu Miah, and Mohammed Ziaur Rahman did the laboratory examination; Ariful Islam, Shariful Islam, and Md. Kaisar Rahman analyzed the data and wrote the paper; Ariful Islam did the project management; Ariful Islam, Mohammad Enayet Hossain, Shariful Islam, and Md. Kaisar Rahman reviewed and corrected the manuscript.

Funding

Open Access funding enabled and organized by CAUL and its Member Institutions The support of the American people funded this research through the United States Agency for International Development (USAID) Emerging Pandemic Threats PREDICT project (cooperative agreement number GHN-A-OO-09-00010-00).

Data availability

All datasets used and/or analyzed during this study are included in this article and are available from the corresponding author on reasonable request.

Declarations

Ethical approval

The study protocol was approved by the Institutional Ethics Committee of the International Centre for Diarrheal Disease Research, Bangladesh (icddr,b) (reference number: 2008–074) and the University of California, Davis Institutional Animal Care and Use Committee (IACUC #16048). Besides, Rodents and shrews are considered a pest in agriculture and households. So, the farm owners had no objection to capturing animals in agriculture fields and settlements. We obtained verbal consent from the owner of the property dwellings, agricultural field, or bushland for setting the traps and sampling rodents and shrews. Rodents and shrews were captured using traps without or minimum injury, and after sampling, all were released at the capture site. All efforts were made to minimize animal suffering throughout the research.

Competing interests

All authors have read and approved the final manuscript. Its contents are solely the responsibility of the authors. All authors declare that they have no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Ariful Islam, Email: arif@ecohealthalliance.org.

Mohammed Ziaur Rahman, Email: mzrahman@icddrb.org.

References

  1. Adhikari P, Han SH, Kim YK, Kim TW, Thapa TB, Subedi N, Adhikari P, Oh HS. First molecular evidence of Mus musculus bactrianus in Nepal inferred from the mitochondrial DNA cytochrome B gene sequences. Mitochondrial DNA Part A. 2018;29(4):561–566. doi: 10.1080/24701394.2017.1320994. [DOI] [PubMed] [Google Scholar]
  2. Anderson EJ, Weber SG. Rotavirus infection in adults. Lancet Infect Dis. 2004;4(2):91–99. doi: 10.1016/S1473-3099(04)00928-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Aplin KP, Brown PR, Jacob J, Krebs CJ, Singleton GR (2003) Field methods for rodent studies in Asia and the indo-Pacific. ACIAR Monograph No
  4. Avenant NL (2003) The use of small mammal community characteristics as an indicator of ecological disturbance in the Korannaberg conservancy. ACIAR Monograph Series 96:95–98. https://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.470.6426&rep=rep1&type=pdf#page=92. Accessed 20 Dec 2020
  5. Barman A, Abdullah SM, Ali Y, Rahman M, Mohanta UK. Prevalence and detail morphological identification of helminths of murine rodents in Dhaka city, Bangladesh. Ann Parasitol. 2020;66(2):175–182. doi: 10.17420/ap6602.252. [DOI] [PubMed] [Google Scholar]
  6. Boey K, Shiokawa K, Avsaroglu H, Rajeev S. Seroprevalence of rodent pathogens in wild rats from the island of St. Kitts, West Indies. Animals. 2019;9(5):228. doi: 10.3390/ani9050228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ciarlet M, Conner ME, Finegold MJ, Estes MK. Group A rotavirus infection and age-dependent diarrheal disease in rats: a new animal model to study the pathophysiology of rotavirus infection. J Virol. 2002;76(1):41–57. doi: 10.1128/JVI.76.1.41-57.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Čolić D, Krešić N, Mihaljević Ž, Andreanszky T, Balić D, Lolić M, Brnić D. A remarkable genetic diversity of rotavirus A circulating in red fox population in Croatia. Pathogens. 2021;10(4):485. doi: 10.3390/pathogens10040485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cowley D, Donato CM, Roczo-Farkas S, Kirkwood CD. Novel G10P [14] rotavirus strain, northern territory, Australia. Emerg Infect Dis. 2013;19(8):1324. doi: 10.3201/eid1908.121653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. de Wit MA, Koopmans MP, van Duynhoven YT. Risk factors for norovirus, Sapporo-like virus, and Group A rotavirus gastroenteritis. Emerg Infect Dis. 2003;9(12):1563. doi: 10.3201/eid0912.020076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dey SK, Sharif N, Sarkar OS, Sarkar MK, Talukder AA, Phan T, Ushijima H. Molecular epidemiology and surveillance of circulating rotavirus among children with gastroenteritis in Bangladesh during 2014–2019. PLoS One. 2020;15(11):e0242813. doi: 10.1371/journal.pone.0242813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dhama K, Chauhan R, Mahendran M, Malik S. Rotavirus diarrhea in bovines and other domestic animals. Vet Res Commun. 2009;33(1):1–23. doi: 10.1007/s11259-008-9070-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dohoo IR, Martin W, Stryhn HE. Veterinary epidemiologic research. Charlottetown: University of Prince Edward Island; 2003. [Google Scholar]
  14. Doro R, Farkas SL, Martella V, Bányai K. Zoonotic transmission of rotavirus: surveillance and control. Expert Rev Anti-Infect Ther. 2015;13(11):1337–1350. doi: 10.1586/14787210.2015.1089171. [DOI] [PubMed] [Google Scholar]
  15. Dw L. Applied logistic regression analysis. New York: Wiley; 2000. [Google Scholar]
  16. Ellis B, Regnery R, Beati L, Bacellar F, Rood M, Glass G, Marston E, Ksiazek T, Jones D, Childs J. Rats of the genus Rattus are reservoir hosts for pathogenic Bartonella species: an Old World origin for a New World disease? J Infect Dis. 1999;180(1):220–224. doi: 10.1086/314824. [DOI] [PubMed] [Google Scholar]
  17. Favorov MO, Kosoy MY, Tsarev SA, Childs JE, Margolis HS. Prevalence of antibody to hepatitis E virus among rodents in the United States. J Infect Dis. 2000;181(2):449–455. doi: 10.1086/315273. [DOI] [PubMed] [Google Scholar]
  18. Geletu US, Usmael MA, Bari FD. Rotavirus in calves and its zoonotic importance. Vet Med Intern. 2021;18:2021. doi: 10.1155/2021/6639701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gentsch JR, Glass RI, Woods P, Gouvea V, Gorziglia M, Flores J, Das BK, Bhan MK. Identifi cation of Group A rotavirus gene 4 types by polymerase chain reaction. J Clin Microbiol. 1992;30:1365–1373. doi: 10.1128/jcm.30.6.1365-1373.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gouvea V, Glass RI, Woods P, Taniguchi K, Clark HF, Forrester B. Polymerase chain reaction amplifi cation and typing of rotavirus nucleic acid from stool specimens. J Clin Microbiol. 1990;28:276–282. doi: 10.1128/jcm.28.2.276-282.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. He B, Huang X, Zhang F, Tan W, Matthijnssens J, Qin S, Xu L, Zhao Z, Yang LE, Wang Q (2017) Group A rotaviruses in Chinese bats: genetic composition, serology, and evidence for bat-to-human transmission and reassortment. J Virol 91(12):e02493-16. 10.1128/jvi.02493-16 [DOI] [PMC free article] [PubMed]
  22. Hickman DL, Swan M. Use of a body condition score technique to assess health status in a rat model of polycystic kidney disease. J Am Assoc Lab Anim Sci. 2010;49(2):155–159. [PMC free article] [PubMed] [Google Scholar]
  23. Hossain MB, Rahman MS, Watson OJ, Islam A, Rahman S, Hasan R, Kafi MAH, Osmani MG, Epstein JH, Daszak P. Epidemiology and genotypes of Group A rotaviruses in cattle and goats of Bangladesh, 2009-2010. Infect Genet Evol. 2020;79:104170. doi: 10.1016/j.meegid.2020.104170. [DOI] [PubMed] [Google Scholar]
  24. Ianiro G, Di Bartolo I, De Sabato L, Pampiglione G, Ruggeri FM, Ostanello F. Detection of uncommon G3P [3] rotavirus A (RVA) strain in rat possessing a human RVA-like VP6 and a novel NSP2 genotype. Infect Genet Evol. 2017;53:206–211. doi: 10.1016/j.meegid.2017.06.008. [DOI] [PubMed] [Google Scholar]
  25. Islam S, Rahman MK, Ferdous J, Rahman M, Akter S, Faraque MO, MNU C, Hossain MA, Hassan MM, Islam A, Islam A. Hemoprotozoa and Anaplasma spp. in rodents and shrews of Bangladesh. Trop Biomed. 2020;37(4):842–851. doi: 10.47665/tb.37.4.842. [DOI] [PubMed] [Google Scholar]
  26. Islam A, Hossain ME, Haider N, Rostal MK, Mukharjee SK, Ferdous J, Miah M, Rahman M, Daszak P, Rahman MZ. Molecular characterization of Group A rotavirus from rhesus macaques (Macaca mulatta) at human–wildlife interfaces in Bangladesh. Transbound Emerg Dis. 2020;67(2):956–966. doi: 10.1111/tbed.13431. [DOI] [PubMed] [Google Scholar]
  27. Islam A, Hossain ME, Rostal MK, Ferdous J, Islam A, Hasan R, Miah M, Rahman M, Rahman MZ, Daszak P. Epidemiology and molecular characterization of rotavirus A in fruit bats in Bangladesh. EcoHealth. 2020;17(3):398–405. doi: 10.1007/s10393-020-01488-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Johne R, Tausch SH, Grützke J, Falkenhagen A, Patzina-Mehling C, Beer M, Höper D, Ulrich RG. Distantly related rotaviruses in common shrews, Germany, 2004–2014. Emerg Infect Dis. 2019;25(12):2310. doi: 10.3201/eid2512.191225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Jothikumar N, Kang G, Hill V. Broadly reactive TaqMan® assay for real-time RT-PCR detection of rotavirus in clinical and environmental samples. J Virol Methods. 2009;155(2):126–131. doi: 10.1016/j.jviromet.2008.09.025. [DOI] [PubMed] [Google Scholar]
  30. Khan R. Wildlife of the Sundarban. In: Khan R, editor. Sundarban rediscovering Sundarban the mangrove beauty of Bangladesh. Dhaka: Nymphea Publication; 2013. pp. 3–73. [Google Scholar]
  31. Li K, Lin XD, Huang KY, Zhang B, Shi M, Guo WP, Wang MR, Wang W, Xing JG, Li MH. Identification of novel and diverse rotaviruses in rodents and insectivores, and evidence of cross-species transmission into humans. Virol. 2016;494:168–177. doi: 10.1016/j.virol.2016.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lowe S, Browne M, Boudjelas S, De Poorter M (2000) 100 of the world's worst invasive alien species: a selection from the global invasive species database, Invasive Species Specialist Group Auckland. https://portals.iucn.org/library/sites/library/files/documents/2000-126.pdf. Accessed 20 Dec 2020
  33. Mähler M, Köhl W. A serological survey to evaluate contemporary prevalence of viral agents and mycoplasma pulmonis in laboratory mice and rats in western Europe. Lab animal. 2009;38(5):161–165. doi: 10.1038/laban0509-161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Martella V, Bányai K, Matthijnssens J, Buonavoglia C, Ciarlet M. Zoonotic aspects of rotaviruses. Vet Microbiol. 2010;140(3–4):246–255. doi: 10.1016/j.vetmic.2009.08.028. [DOI] [PubMed] [Google Scholar]
  35. Mazid R, Aung M, Paul S, Ahmad F, Alam M, Ali M, Nath P, Ahmed S, Haque N, Hossain M. Resurgence and predominance of G3P [8] human rotaviruses in north-Central Bangladesh, 2018–2019. New Microbes New Infect. 2020;33:100621. doi: 10.1016/j.nmni.2019.100621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. McInnes EF, Rasmussen L, Fung P, Auld AM, Alvarez L, Lawrence DA, Quinn ME, Utteridge TD, Del Fierro GM, Vassallo BA. Prevalence of viral, bacterial and parasitological diseases in rats and mice used in research environments in Australasia over a 5-y period. Lab Animal. 2011;40(11):341–350. doi: 10.1038/laban1111-341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Meerburg BG, Singleton GR, Kijlstra A. Rodent-borne diseases and their risks for public health. Crit Rev Microbiol. 2009;35(3):221–270. doi: 10.1080/10408410902989837. [DOI] [PubMed] [Google Scholar]
  38. Mulungu LS, Makundi RH, Leirs H, Massawe AW, Vibe-Petersen S, Stenseth NC. The rodent density-damage function in maize fields at an early growth stage. ACIAR Monograph Series. 2003;96:301–303. [Google Scholar]
  39. Paramasvaran S, Sani RA, Hassan L, Kaur H, Krishnasamy M, Jeffery J, Raj S, Ghazali SM, Hock LK. Endo-parasite fauna of rodents caught in five wet markets in Kuala Lumpur and its potential zoonotic implications. Trop Biomed. 2009;26:67–72. [PubMed] [Google Scholar]
  40. Parashar UD, Gibson CJ, Bresee JS, Glass RI. Rotavirus and severe childhood diarrhea. Emerg Infect Dis. 2006;12(2):304. doi: 10.3201/eid1202.050006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Radosa L, Schlegel M, Gebauer P, Ansorge H, Heroldová M, Jánová E, Stanko M, Mošanský L, Fričová J, Pejčoch M. Detection of shrew-borne hantavirus in Eurasian pygmy shrew (Sorex minutus) in Central Europe. Infect Genet Evol. 2013;19:403–410. doi: 10.1016/j.meegid.2013.04.008. [DOI] [PubMed] [Google Scholar]
  42. Rahman M, Sultana R, Ahmed G, Nahar S, Hassan ZM, Saiada F, Podder G, Faruque ASG, Siddique AK, Sack DA, Matthijnssens J, Ranst MV, Azim T. Prevalence of G2P [4] and G12P [6] rotavirus, Bangladesh. Emerg Infect Dis. 2007;13(1):18. doi: 10.3201/eid1301.060910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Rahman M, Islam S, Masuduzzaman M, Alam M, Chawdhury MNU, Ferdous J, Islam MN, Hassan MM, Hossain MA, Islam A. Prevalence and diversity of gastrointestinal helminths in free-ranging Asian house shrew (Suncus murinus) in Bangladesh. Vet World. 2018;11(4):549. doi: 10.14202/vetworld.2018.549-556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Rahman MK, Islam S, Rahman M, Ferdous J, Akter S, Rahaman MM, Hossain MA, Hassan MM, Islam A. Hematological and biochemical reference values of Asian house shrews (Suncus murinus) in Bangladesh. Vet World. 2019;12(9):1514. doi: 10.14202/vetworld.2019.1514-1518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Sachsenröder J, Braun A, Machnowska P, Ng TFF, Deng X, Guenther S, Bernstein S, Ulrich RG, Delwart E, Johne R. Metagenomic identification of novel enteric viruses in urban wild rats and genome characterization of a Group A rotavirus. J Gen Virol. 2014;95(Pt 12):2734. doi: 10.1099/vir.0.070029-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Satter SM, Gastanaduy PA, Islam K, Rahman M, Rahman M, Luby SP, Heffelfinger JD, Parashar UD, Gurley ES. Hospital-based surveillance for rotavirus gastroenteritis among young children in Bangladesh: defining the potential impact of a rotavirus vaccine program. Pediatr Infect Dis J. 2017;36(2):168. doi: 10.1097/INF.0000000000001381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Sawant PM, Digraskar SS, Gopalkrishna V. Molecular characterization of unusual G10P [33], G6P [14] genomic constellations of Group A rotavirus and evidence of zooanthroponosis in bovines. Infect Genet Evol. 2020;84:104385. doi: 10.1016/j.meegid.2020.104385. [DOI] [PubMed] [Google Scholar]
  48. Sayeed MA, Smallwood C, Imam T, Mahmud R, Hasan RB, Hasan M, Anwer MS, Rashid MH, Hoque MA. Assessment of hygienic conditions of live bird markets on avian influenza in Chittagong metro, Bangladesh. Prev Vet Med. 2017;142:7–15. doi: 10.1016/j.prevetmed.2017.04.009. [DOI] [PubMed] [Google Scholar]
  49. Shafiyyah COS, Jamaiah I, Rohela M, Lau YL, Aminah FS. Prevalence of intestinal and blood parasites among wild rats in Kuala Lumpur, Malaysia. Trop Biomed. 2012;29(4):544–550. [PubMed] [Google Scholar]
  50. Shanta I, Luby S, Hossain K, Ahmed S, Rahman T, Kennedy E, Sharker M, Kilpatrick A, Pulliam J, Gurley ES. Determining hotspots of human exposure to rodents, bats and monkeys in Bangladesh. Int J Infect Dis. 2016;53:22. doi: 10.1016/j.ijid.2016.11.059. [DOI] [Google Scholar]
  51. Sharif N, Nobel NU, Sakib N, Liza SM, Khan ST, Billah B, Parvez AK, Haque A, Talukder AA, Dey SK. Molecular and epidemiologic analysis of diarrheal pathogens in children with acute gastroenteritis in Bangladesh during 2014–2019. Pediatr Infect Dis J. 2020;39(7):580–585. doi: 10.1097/INF.0000000000002637. [DOI] [PubMed] [Google Scholar]
  52. Simsek C, Corman VM, Everling HU, Lukashev AN, Rasche A, Maganga GD, Binger T, Jansen D, Beller L, Deboutte W, Gloza-Rausch F, Seebens-Hoyer A, Yordanov S, Sylverken A, Oppong S, Sarkodie YA, Vallo P, Leroy EM, Bourgare M, Yinda KC, Ranst MV, Drosten C, Drexler JF, Matthijnssens J. At least seven distinct rotavirus genotype constellations in bats with evidence of reassortment and zoonotic transmissions. MBio. 2021;12(1):e02755–e02720. doi: 10.1128/mBio.02755-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Singla LD, Singla N, Parshad VR, Juyal PD, Sood NK. Rodents as reservoirs of parasites in India. Integr Zool. 2008;3(1):21–26. doi: 10.1111/j.1749-4877.2008.00071.x. [DOI] [PubMed] [Google Scholar]
  54. Singleton GR, Smith AL, Shellam G, Fitzgerald N, Müller WJ. Prevalence of viral antibodies and helminths in field populations of house mice (Mus domesticus) in southeastern Australia. Epidemiol Infect. 1993;110(2):399–417. doi: 10.1017/S0950268800068345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Smith AL, Singleton GR, Hansen GM, Shellam G. A serologic survey for viruses and mycoplasma pulmonis among wild house mice (Mus domesticus) in southeastern Australia. J Wildl Dis. 1993;29(2):219–229. doi: 10.7589/0090-3558-29.2.219. [DOI] [PubMed] [Google Scholar]
  56. Ssuuna J, Makundi RH, Isabirye M, Sabuni CA, Babyesiza WS, Mulungu LS. Rodent species composition, relative abundance, and habitat association in the Mabira central Forest reserve, Uganda. J Vertebr Biol. 2020;69(2):20021. doi: 10.25225/jvb.20021. [DOI] [Google Scholar]
  57. Sumangali K, Rajakaruna R, Rajapakse R (2007) Ecto and Endo parasites of rodents from two selected sites in Kandy District. Peradeniya university research sessions purse 2007 Volume 12 Part I-Agricultural, Biological Med Sci Edit Board 44(3&4):86. https://www.researchgate.net/profile/Sarath-Kodithuwakku/publication/242414576_Factors_Influencing_the_Student_Decision_Making_in_Relation_to_University_Admission/links/53ea933e0cf2fb1b9b6a6c03/Factors-Influencing-the-Student-Decision-Making-in-Relation-to-University-Admission.pdf. Accessed 20 Dec 2020
  58. Tadin A, Tokarz R, Markotić A, Margaletić J, Turk N, Habuš J, Svoboda P, Vucelja M, Desai A, Jain K. Molecular survey of zoonotic agents in rodents and other small mammals in Croatia. Am J Trop Med Hyg. 2016;94(2):466–473. doi: 10.4269/ajtmh.15-0517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Tan S, Yap K, Lee HL. Mechanical transport of rotavirus by the legs and wings of Musca domestica (Diptera: Muscidae) J Med Entomol. 1997;34(5):527–531. doi: 10.1093/jmedent/34.5.527. [DOI] [PubMed] [Google Scholar]
  60. Tonietti PDO, da Hora AS, Silva FDF, Ferrari KL, Brandão PE, Richtzenhain LJ, Gregori F (2013) Simultaneous detection of Group A rotavirus in swine and rat on a pig farm in Brazil. Sci World J 2013:648406. 10.1155/2013/648406 [DOI] [PMC free article] [PubMed]
  61. Troeger C, Khalil IA, Rao PC, Cao S, Blacker BF, Ahmed T, Armah G, Bines JE, Brewer TG, Colombara DV. Rotavirus vaccination and the global burden of rotavirus diarrhea among children younger than 5 years. JAMA Pediatr. 2018;172(10):958–965. doi: 10.1001/jamapediatrics.2018.1960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Veciana M, Chaisiri K, Morand S, Ribas A (2012) Helminths of the Asian house shrew Suncus murinus from Cambodia. Camdodian J Nat Hist 2012(2):115–122. https://www.academia.edu/3035160/Helminths_of_the_Asian_house_shrew_Suncus_murinus_from_Cambodia. Accessed 20 Dec 2020
  63. Wang H, Yoshimatsu K, Ebihara H, Ogino M, Araki K, Kariwa H, Wang Z, Luo Z, Li D, Hang C. Genetic diversity of hantaviruses isolated in China and characterization of novel hantaviruses isolated from Niviventer confucianus and Rattus rattus. Virol. 2000;278(2):332–345. doi: 10.1006/viro.2000.0630. [DOI] [PubMed] [Google Scholar]
  64. Wang XX, Li JX, Wang WG, Sun XM, He CY, Dai JJ. Preliminary investigation of viruses to the wild tree shrews (Tupaia belangeri chinese) Zool Res. 2011;32(1):66–69. doi: 10.3724/SP.J.1141.2011.01066. [DOI] [PubMed] [Google Scholar]
  65. Wenman WM, Hinde D, Feltham S, Gurwith M. Rota virus infection in adults. N Engl J Med. 1979;301(6):303–306. doi: 10.1056/NEJM197908093010604. [DOI] [PubMed] [Google Scholar]
  66. Williams SH, Che X, Garcia JA, Klena JD, Lee B, Muller D, Ulrich W, Corrigan RM, Nichol S, Jain K (2018) Viral diversity of house mice in New York City. MBio 9(2):e01354-17. 10.1128/mbio.01354-17 [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All datasets used and/or analyzed during this study are included in this article and are available from the corresponding author on reasonable request.

Articles from Veterinary Research Communications are provided here courtesy of Springer

RESOURCES