Skip to main content
NCBI home page
American Journal of Cancer Research logoLink to American Journal of Cancer Research
. 2022 Mar 15;12(3):1409–1422.

HDAC6/FOXP3/HNF4α axis promotes bile acids induced gastric intestinal metaplasia

Luyao Zhang 1,*, Na Wang 1,*, Min Chen 1,*, Siran Wu 1, Jiaoxia Zeng 1, Fenli Zhou 1, Qiong Wu 1, Junye Liu 2, Yongquan Shi 1
PMCID: PMC8984877  PMID: 35411233

Abstract

Bile reflux is one of the main causes of gastric intestinal metaplasia (IM) which is an important precancerous lesion. Our previous study has shown that ectopic expression of Histone deacetylase 6 (HDAC6) promotes the activation of intestinal markers in bile acids (BA) induced gastric IM cells; however, the mechanism underlying how HDAC6-mediated epigenetic modifications regulate intestinal markers is not clear. In this study, we aimed to investigate the downstream targets of HDAC6 and the underlying mechanism in the process of BA induced gastric IM. We demonstrated that deoxycholic acid (DCA) upregulated HDAC6 in gastric cells, which further inhibited the transcription of Forkhead box protein 3 (FOXP3). Then, FOXP3 transcriptionally inhibited Hepatocyte nuclear factor 4α (HNF4α), which further inhibits the expression of downstream intestinal markers. These molecules have been shown to be clinically relevant, as FOXP3 levels were negatively correlated with HDAC6 and HNF4α in IM tissues. Transgenic mice experiments confirmed that HNF4α overexpression combined with DCA treatment induced gastric mucosa to secrete intestinal mucus and caused an abnormal mucosal structure. Our findings suggest that HDAC6 reduces FOXP3 through epigenetic modification, thus forming a closed loop HDAC6/FOXP3/HNF4α to promote gastric IM. Inhibition of HDAC6 may be a potential approach to prevent gastric IM in patients with bile reflux.

Keywords: Gastric intestinal metaplasia, HDAC6, FOXP3, HNF4α, gastric cancer

Introduction

Gastric cancer (GC) is the third most common cause of cancer-related death in the worldwide [1]. According to the Lauren classification, GC mainly includes the intestinal type and the diffused type. Intestinal-type GC follows the Correa development model, namely, chronic superficial gastritis, atrophic gastritis, intestinal metaplasia (IM), dysplasia, and finally to GC [2].

Gastric IM refers to the replacement of gastric mucosa cells by intestinal-type cells. This process is thought to be caused by chronic environmental stimulation, among which Helicobacter pylori (Hp) is considered to be the main cause of IM [3-5]; however, it is worth noting that some studies have shown that eradication of Hp cannot completely stop the progression of IM to GC [6,7]. This fact suggests that in addition to Hp, other factors, such as bile reflux, may play an important role in promoting the occurrence and malignant progression of IM [8-10]. In recent years, many in vivo and in vitro studies on Barrett’s esophagus (BE) have confirmed that BA promotes esophageal mucosa IM [11-13].

In a previous study, we successfully constructed a BA-induced IM cell model, in which Caudal-related homeobox transcription factor 2 (CDX2) and other intestinal markers were significantly increased [14]. In addition, we found that Hepatocyte nuclear factor 4α (HNF4α), an important transcription factor (TF) involved in the differentiation and development of the liver and intestine [15-17], forms a closed loop by interacting with Histone deacetylase 6 (HDAC6), and promotes the continuous progression of IM under the regulation of miR-1 [18]. In this loop, HNF4α can activate HDAC6 promoter, but how HDAC6 regulates HNF4α remains unclear. Epigenetic modification is considered to be an important mechanism driving the development of GC [19-21]. In particularly, histone acetyltransferase (HATs) and histone deacetylase (HDACs) can modify the lysine residues of histone or nonhistone after translation, and their balance promotes the maintenance of cell homeostasis [22-24]. The abnormal expression of HDAC6 is reportedly involved in the occurrence and development of various human cancers [25-27]; however, the role of epigenetic modification mediated by HDACs in the progression of GC or IM remains unclear. To identify the downstream target of HDAC6, we conducted RNA-sequencing (RNA-seq) and bioinformatics analyses. The results showed that Forkhead box protein 3 (FOXP3), which has potential binding sites for the HNF4α promoter, might be the modified target of HDAC6. Therefore, we hypothesize that HDAC6 may regulate HNF4α transcription through histone deacetylation of FOXP3, and eventually form a complete HDAC6/FOXP3/HNF4α loop.

FOXP3 is an essential TF that maintain the immunosuppressive function of regulatory T cells (Tregs) and plays an important role in maintaining immune homeostasis [28-30]. FOXP3 can also be expressed in tissue cells [31,32]. For example, in breast cancer cells, FOXP3 promotes the expression of SKP2 and stimulates the cell proliferation [33]; in non-small cell lung cancer (NSCLC), FOXP3 enhances tumor growth by activating the WNT/β-Catenin pathway via Gli1 activation [34]; FOXP3-c-MYC signaling regulates tumor progression in prostate cancer [35]. However, no consensus has been reaching regarding the role of FOXP3 in GC. Some studies have shown that FOXP3 can promote tumor occurrence in gastric cells, while other studies have revealed that it may inhibit the progression of GC [36,37]. Furthermore, the role of FOXP3 in IM has not yet been reported.

In this study, we found that HDAC6 triggered the deacetylation of the FOXP3 locus to inhibit its transcription during BA-induced gastric IM. Decrease of FOXP3 stimulated the transcription of HNF4α. Finally, HDAC6, FOXP3 and HNF4α formed a closed loop to promote the progression of gastric IM under BA stimulation. Blocking of this circuit may prevent BA-induced IM and even GC.

Materials and methods

Cell lines

The cell model of BA-induced gastric IM was constructed as previously reported [14]. To imitate the situation of bile reflux in gastric mucosa as much as possible, we used the immortalized gastric mucosa cell line GES-1 cells and primary mouse gastric mucosa cells to carry out the BA stimulation experiment. GES-1 and AGS cells (originally purchased from ATCC) were cultured in 1640 medium (Gibco, USA) with 10% fetal bovine serum (Biological Industries, Israel). Deoxycholic acid (DCA), a kind of bile acid with strong cytotoxicity, was purchased from BiocytoSci (USA).

Animals

We previously constructed transgenic mice with Lgr5+ gastric mucosal stem cells specifically expressing Hnf4α [18]. In this study, sixteen WT mice and sixteen tamoxifen activated transgenic mice Rosa26Hnf4α aged 3 months were randomly divided into two groups: one group was treated with (DCA) while the control group was treated with PBS. The mice in the DCA group were given BA (0.3% DCA, pH 7.0) in the drinking water for 12 months, and PBS was added to the control group. The dose was determined according to the article of Quante et al [11]. Tamoxifen was given 6 weeks before BA treatment. All animal experiments were approved by Animal Research Committee of Xijing Hospital.

Tissue

Ten pairs of matched IM and para metaplasia tissues were taken from the Endoscopy Center of Xijing Hospital of Digestive Diseases and diagnosed as gastric IM by the Department of Pathology. The collected tissues were immediately frozen into liquid nitrogen for preservation. To exclude the influence of Hp, the selected tissues were all negative for Hp. Before the specimens were obtained, all patients signed the informed consent. This study was approved by the Human Subjects Committee of Xijing Hospital.

RNA-sequencing

GES-1 cells were infected with HDAC6 overexpression virus vector or negative control virus vector, and then treated with puromycin to establish stable cell line. Total RNA was extracted using RNeasy Micro Kit (Cat# 74004, Qiagen, Germany) following the manufacturer’s instructions and checked for a RIN number to inspect RNA integrity by an Agilent Bioanalyzer 2100 (Agilent technologies, Santa Clara, USA). Qualified total RNA was further purified by RNAClean XP Kit (Cat A63987, Beckman Coulter, Inc. Kraemer Boulevard Brea, USA) and RNase-Free DNase Set (Cat#79254, Qiagen, Germany). Edger was used to analyze the differentially expressed genes among samples. After obtaining the P-value, multiple hypothesis tests were conducted. The threshold value of P-value was determined by controlling FDR (false discovery rate). The corrected P-value is q-value. At the same time, we calculated the differential expression multiple (fold change) according to the FPKM value.

Transfection and infection

HDAC6, FOXP3, HNF4α and EP300 overexpression lentiviral vectors were purchased from Genechem Co. Ltd. (China). The small interference RNAs (siRNAs) to HDAC6, FOXP3 and HNF4α were purchased from Genepharma (China). Three pairs of primer sequences were designed for each gene, and the one with the highest knockdown efficiency was used in this study. The sequences are shown in Table 1. The transfection regent was used following the manufacturer’s protocol (Thermo Fisher Scientific, USA).

Table 1.

Sequence of primers used in the study

siRNA name Forward sequence Reverse sequence
HDAC6 AGTCCATCGCAGATACTGGC TTAGTCTGGCCTGGAGTGGA
HNF4α ACATGGACATGGCCGACTACA AGCTCGCAGAAAGCTGGGAT
FOXP3 GUCUGCACAAGUGCUUUGUTT ACAAAGCACUUGUGCAGACTT
Open in a new tab

Quantitative real-time PCR

Cellular RNA was extracted using TRIzol® reagent (Invitrogen, USA) according to the standard protocol. Then RNA reverse transcribed into cDNA using the Evo M-MLV RT Kit, and qPCR was performed using the SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biotechnology (Hunan) Co., Ltd, China) on a CFX96™ Real-Time PCR Detection system (Bio-Rad Laboratories, USA). The 2-∆∆Cq method was used to calculate the relative mRNA expression of each gene with β-actin as the internal control. The primer sequences of each gene are provided in Table 2.

Table 2.

Sequence of primers used in the study

Primer name Forward sequence Reverse sequence
HDAC6 AGTCCATCGCAGATACTGGC TTAGTCTGGCCTGGAGTGGA
HNF4α ACATGGACATGGCCGACTACA AGCTCGCAGAAAGCTGGGAT
FOXP3 CCTACCCACTGCTGGCAAAT CCTGGCAGTGCTTGAGGAA
HNF4α (ChIP NC) GAGCCAAGATCGCACCATTGC GTCATGAGCCACTGTGCCCAAC
(ChIP 1) AGCTAATTTTTGTATTTTTAG GCCAAGATCGTGCCACTGCAC
(ChIP 2) CATATCACTCACCAGTTTGT CAGGAAGTAGTGGGAAAACCG
(ChIP 3) ATGGAGACAGCAACAGTCCC GCCCACCCAGCCGGAGAGCTG
FOXP3 (ChIP NC) GGCTGACATTACCTGCGCCT TTTCTGGGCCAACAACCACG
(promoter) AGCACTGTATCTGACCCATGG CCTGACCCAGCCACTGTCCCAC
(CNS) CCCGTGATTATCAGCGCACA GAGCAGGGACACTCACCTTG
Open in a new tab

Immunoblot analysis

Immunoblot analysis was conducted using standard procedures. The following antibodies were used in this study: anti-HDAC6 (1:1000, Cell Signaling Technology, #7558), anti-FOXP3 (1:2000, abcam, #ab10901), anti-HNF4α (1:2000, abcam, #ab72378), anti-CDX2 (1:1000, Cell Signaling Technology, #12306), anti-KLF4 (1:1000, Cell Signaling Technology, #12173), anti-MUC2 (1:4000, abcam, ab134119) and anti-β-actin (1:5000, Bioworld, #AP0060). Target molecule expression was detected by the chemiluminescence method.

Immunohistochemistry and AB-PAS staining

Paraffin-embedded sections were deparaffinized and antigens were repaired. Slides were preblocked and then incubated with primary antibodies at 4°C overnight. The slides were incubated with anti-rabbit antibodies for 40 minutes and stained with DAB substrate. Nuclei were stained using hematoxylin. The following primary antibodies were used: anti-FOXP3 (1:1000, abcam, #ab10901), anti-HDAC6 (1:400, Cell Signaling Technology, #7558) and anti-HNF4α (1:300, abcam, #ab72378). CDX2 staining in IM tissues was used as positive control and PBS as negative control. The assay was performed following the manufacturer’s instructions. Alcian blue staining-periodic acid-schiff (AB-PAS) staining was performed according to the manufacturer’s protocol (Solarbio, China).

Immunofluorescence

Immunofluorescence (IF) staining for FOXP3 was conducted in GES-1 cells. The cells were plated in 4-well chamber slides (Millipore, USA), washed with PBS and fixed with 4% paraformaldehyde for 30 minutes. Next, the cells were permeabilized with Triton X-100 for 10 minutes and blocked with sheep serum for 30 minutes. The cells were then incubated with FOXP3 primary antibody (1:200, abcam, #ab10901) overnight at 4°C in a humidified chamber followed by incubation with a FITC secondary antibody (1:200, EMD Millipore, #3051741) for 2 hours at room temperature in the dark. The nuclei were stained with DAPI (1:800, Solarbio, #c0060). The slides were examined using a Fluoview FV1200 Laser Scanning Confocal Microscope (Olympus Corp.).

Luciferase reporter assays

The luciferase reporter assay was conducted as previously described [18]. The promoter sequence of HNF4α was as follow: 5’-cgacgcgtAAAATATTAATACTTTTTTTTTTTCTGAGATG-3’. PGL3 basic was used as the negative control.

Chromatin immunoprecipitation assay

Chromatin immunoprecipitation (ChIP) assay was also conducted as previously described [18]. HDAC6 (ActiveMotif, #40971), H3Ac (ActiveMotif, #39040), H4Ac (ActiveMotif, #39026), H3K9 (abcam, #ab32129), H3K27 (abcam, #ab177178) and FOXP3 antibodies (abcam, #ab10901) were used to precipitate DNA that used for PCR amplification of their binding sites in FOXP3 or HNF4α genes. The sequences were shown in Table 2.

Statistical analysis

SPSS software (v.19.0, SPSS, Chicago, Illinois, USA) was used for statistical analysis. The continuous data between two groups were compared by Student’s unpaired t-test, and the results are presented as the mean ± SEM. Frequencies of categorical variables were compared using the χ2 test. P < 0.05 was considered statistically significant (*P < 0.05, **P < 0.01).

Results

Predicted downstream targets of HDAC6

To explore the role of HDAC6 mediated epigenetic modification in BA-induced gastric IM, we transfected GES-1 cells with HDAC6 overexpression or negative control viruses and then performed RNA-seq. From the heat map, we could see that the overexpression of HDAC6 can reduce the expression of various genes in GES-1 cells (Figure 1A). KEGG data showed that abnormally expressed genes induced by HDAC6 were mainly involved in the signaling pathways related to tumor or signal transduction (Figure 1B). Considering that the deacetylation of HDACs on the histone of the target gene can inhibit its transcription, we crossed the downregulated genes after HDAC6 overexpression with the genes after DCA treatment in GES-1 cells (Figure 1C). STOX1, BLOC1S5-TXNDC5 and FOXP3 were identified (Figure 1D). Through bioinformatics analysis, we found that FOXP3 has potential binding sites in the promoter region of HNF4α. Therefore, we hypothesized that FOXP3 may be an HDAC6 target that connects to HNF4α.

Figure 1.

Figure 1

Open in a new tab

Screening of HDAC6 downstream target genes. A. Heatmap of differential messenger RNA (mRNA) expression between negative control (NC) and HDAC6 overexpressed gastric epithelial cell line (GES)-1 cells. Expression values shown are mean values (Fold change >2.0; P < 0.05). Red: increased expression, blue: decreased expression. B. KEGG enrichment analysis of differentially expressed genes. C. Workflow to examine the change of genes in GES-1 cells after DCA treatment or HDAC6 overexpression. D. The decreased messenger RNA (mRNAs) in mRNA profile of HDAC6 overexpressed cells were overlapped with that of DCA treated GES-1 cells to obtain the predicted potential targets of HDAC6.

HDAC6 and DCA decreased FOXP3 in gastric cells

We first assessed the effect of DCA on FOXP3 expression. The results showed that compared with the control group, DCA significantly reduced FOXP3 expression at both mRNA level and protein level in GES-1 cells and mouse primary gastric mucosa cells (Figure 2A, 2B). The immunofluorescence results showed that DCA inhibited FOXP3 in GES-1 cells (Figure 2C). We also found that, after HDAC6 overexpression in GES-1 cells, the FOXP3 protein and mRNA levels decreased significantly (Figure 2D, 2E). In contrast, FOXP3 was significantly increased in AGS cells after HDAC6 knockdown compared with control cells (Figure 2F, 2G). Together, these results suggest that DCA and HDAC6 can induce decreased FOXP3 levels in gastric cells.

Figure 2.

Figure 2

Open in a new tab

HDAC6 negatively regulates FOXP3 in gastric cells. A. mRNA levels of FOXP3 were decreased by DCA treatment in GES-1 cells and primary cells of gastric mucosa in mice. Incubating time: 24 hours; dosage: 100 µM. β-actin RNA was used as internal control in all qRT-PCR assays. Student’s t-test. B. Protein levels of FOXP3 and HDAC6 in GES-1 cells and primary cells treated with DCA (100 µM) for 24 hours. β-actin levels were used as internal control in all immunoblot assays. C. Immunofluorescence showed FOXP3 expression in the nuclei of GES-1 cells. D, E. Immunoblot and qRT-PCR analysis showed upregulation of HDAC6 by lentiviral vectors led to inhibition of FOXP3. Student’s t-test. F, G. Knockdown of HDAC6 by small interfering RNA (siRNA) led to increase of FOXP3. Student’s t-test. **P < 0.01. N.S., not significant.

FOXP3 is decreased in IM tissues and negatively correlated with HDAC6 and HNF4α

To investigate the relevance of FOXP3 with gastric IM clinically, we examined its expression in IM and surrounding tissues. The results showed that FOXP3 expression in IM tissues was significantly lower than in gastritis tissues (1.54±0.21; 0.39±0.18, Figure 3A). Then, we compared the expression of Foxp3 with HDAC6 or HNF4A in IM tissues (Figure 3B). These results indicate that FOXP3 is decreased in IM tissues and negatively correlated with HDAC6 and HNF4α.

Figure 3.

Figure 3

Open in a new tab

FOXP3 was decreased in gastric intestinal metaplasia (IM). A. qRT-PCR results of expression of FOXP3 in 10 paired IM and surrounding tissues. B. Comparison of FOXP3, HDAC6 and HNF4α mRNA expression in the biopsies. **P < 0.01.

FOXP3 mediates the regulation of HDAC6 on intestinal markers

To further explore the regulatory effect of FOXP3 on intestinal markers, we assessed the expression changes of downstream molecules after altering the expression levels of HDAC6 and FOXP3 in gastric cells. The results showed that, after transfection with siFOXP3 in GES-1 cells, decrease of FOXP3 was accompanied by a significant increase of these markers (Figure 4A); however, upon FOXP3 overexpression in AGS cells, the intestinal markers decreased significantly compared with the control group (Figure 4B). We then infected GES-1 cells with an HDAC6 overexpression vector and FOXP3 overexpression vector simultaneously. The promotion effect of HDAC6 on HNF4α and downstream intestinal markers was partially reversed by FOXP3 (Figure 4C). Conversely, in AGS cells treated with siHDAC6, the decrease in the downstream markers was increased by siFOXP3 (Figure 4D). In addition, overexpression of FOXP3 also inhibited the activation of intestinal markers by DCA (Supplementary Figure 1A, 1B). Collectively, these results indicate that FOXP3 can negatively regulate downstream intestinal markers and mediates their regulation by HDAC6.

Figure 4.

Figure 4

Open in a new tab

FOXP3 inhibited the expression of intestinal markers in gastric cells. A. Downregulation of FOXP3 caused consequential enhancement of MUC2, KLF4 and CDX2 in GES-1 cells. B. Intestinal markers were decreased by FOXP3 overexpression in AGS cells. C. The enhancement of intestinal markers induced by HDAC6 overexpression was diminished by upregulation of FOXP3 in GES-1 cells. D. Knockdown of FOXP3 rescued expression of intestinal markers reduced by siHDAC6 in AGS cells. **P < 0.01. N.S., not significant.

HDAC6 promotes histone deacetylation at the FOXP3 loci

It is well known that HATs can open gene locus and promote its transcription. On the contrary, HDACs induces gene locus closure and inhibits its transcription (Figure 5A). To clarify how HDAC6 regulates FOXP3, we examined the epigenetic changes at the FOXP3 loci. The sequences of the FOXP3 promoter and CNS region were shown in Figure 5B. First, the acetylation level of histone H3Ac, H3K9Ac, H3K27Ac and H4Ac in the FOXP3 locus was detected after DCA treatment or HDAC6 overexpression in GES-1 cells. The acetylation level of them in the DCA groups was significantly lower compared to their control groups respectively (Figure 5C). Then, the ChIP assays were performed to verify that HDAC6 could directly bind to the FOXP3 promoter (Figure 5D). Moreover, we could see that histone acetyltransferase EP300 overexpression promoted FOXP3 expression and inhibited HNF4α (Figure 5E), which further indicated that the FOXP3 expression level in gastric cells was regulated by histone acetylation modification. Collectively, these results indicate the importance of epigenetic regulation in DCA or HDAC6 induced suppression of FOXP3.

Figure 5.

Figure 5

Open in a new tab

HDAC6 induces extensive chromatin modifications at FOXP3 loci. A. Histone acetyltransferase (HATs) and histone deacetylases (HDACs) affect the dynamics of chromatin remodeling during gene transcription. B. Schematic diagram depicting FOXP3 locus structure and the sequences in the FOXP3 promoter and CNS regions. C. ChIP assays for H3Ac, H3K9Ac, H3K27Ac, H4Ac modifications in FOXP3 locus. IgG serves as immunoprecipitation control. Student’s t-test. D. ChIP assays for HDAC6 in FOXP3 promoter and CNS regions in GES-1 cells. Student’s t-test. E. FOXP3 and HNF4α protein levels was examined by western blot analysis in AGS cells treated with EP300-expressing vectors or control. *P < 0.05, **P < 0.01. N.S., not significant.

FOXP3 inhibits HNF4α transcription

Then, to clarify the relationship between FOXP3 and HNF4α, we examined the effect of FOXP3 on HNF4α expression. First, FOXP3 was overexpressed or knocked down in AGS and GES-1 cells respectively. The immunoblot and qRT-PCR results showed that FOXP3 negatively regulated HNF4α in gastric cells (Figure 6A). Next, the luciferase reporter assays showed that DCA or siFOXP3 treatment promoted the HNF4α promoter activity (Figure 6B). ChIP assay further indicated that FOXP3 could bind to the ChIP 2 and ChIP 3 sequences of the HNF4α promoter, and DCA promoted the combination (Figure 6C). In addition, we examined the regulatory effect of FOXP3 on downstream intestinal markers mediated by HNF4α. Decreased levels of MUC2, KLF4 and CDX2 induced by FOXP3 overexpression in AGS cells was reversed by HNF4α overexpression (Figure 6D); however, the simultaneous transfection of GES-1 cells with siFOXP3 and siHNF4α resulted in decreased activation of downstream intestinal markers (Figure 6E). Together, these results suggest that FOXP3 can inhibit the transcription of HNF4α, and HNF4α can mediate the regulation of FOXP3 on intestinal markers.

Figure 6.

Figure 6

Open in a new tab

FOXP3 negatively regulated HNF4α transcription. A. FOXP3 inversely regulated HNF4α at both mRNA and protein levels. Student’s t-test. B. The promoter activity of HNF4α was enhanced by DCA and siFOXP3 treatment in GES-1 cells. Student’s t-test. C. A ChIP assay demonstrated the direct binding of FOXP3 to the HNF4α promoter in GES-1 cells. Student’s t-test. D. AGS cells were co-infected with FOXP3-expressing vectors and HNF4α-expressing vectors. The expression of intestinal markers was detected by immunoblot. E. Upregulated intestinal markers expression induced by siFOXP3 was attenuated by siHNF4α in GES-1 cells. F. A schematic model of miR-1/HDAC6/FOXP3/HNF4α pathway in gastric cells. In response to BA, miR-1 inhibition promotes HNF4α and HDAC6, which increase the transcription of intestinal markers including MUC2, KLF4 and CDX2. **P < 0.01. N.S., not significant.

DCA promotes intestinal mucus secretion in Hnf4α transgenic mice

To verify the effect of DCA on gastric mucosa and the expression level of Foxp3 in gastric mucosa in vivo, we treated the Hnf4α transgenic mouse model with DCA (Figure 7A). As shown in Supplemental Figure 2A, after 12 months of DCA treatment, compared with the Ctrl/WT and DCA/WT mice, we observed significantly enlarged abnormal glands near the squamous epithelium at the squamocolumnar junction (SCJ) of Ctrl/Rosa26Hnf4α mice and DCA/Rosa26Hnf4α mice, which were more serious in the DCA treated transgenic mice. Further, gastric mucosal atrophy was observed in the Ctrl/Rosa26Hnf4α mice and DCA/Rosa26Hnf4α mice. The number of mice with different gastric mucosal lesions in each group was shown in Table 3. Then, we collected the small intestine and large intestine tissues of the Ctrl/WT mice for AB-PAS staining. The gastric mucosa of the other three groups showed light purple staining, while the DCA/Rosa26Hnf4α mice showed the same staining as goblet cells in the intestinal tissue, indicating that intestinal mucus secretion may occur (Supplementary Figure 2B) (data of other two groups not shown). The AB-PAS staining results also showed obvious blue staining in the Ctrl/Rosa26Hnf4α mice and DCA/Rosa26Hnf4α mice, with the strongest staining was found in the latter group (Supplementary Figure 2C). The expression levels of Hdac6, Foxp3 and Hnf4α in these tissues were also detected. The Foxp3 levels in the Ctrl/WT and DCA/WT mice were significantly higher compared to the Ctrl/Rosa26Hnf4α mice, and DCA treatment further reduced Foxp3 expression. In contrast, the expression of Hnf4α was enhanced in the Ctrl/Rosa26Hnf4α mice coinciding with increased Hdac6. DCA treatment further induced the expression of Hnf4α and Hdac6 in the transgenic mice (Figure 7B, 7C). Collectively, these findings indicate that Hnf4α transgenic mice undergo gastric mucosal changes in the SCJ region similar to BE and atrophy in gastric antrum. Moreover, Hnf4α promotes Hdac6 but inhibits Foxp3, which is consistent with the results of the in vitro experiments.

Figure 7.

Figure 7

Open in a new tab

HDAC6/FOXP3/HNF4α loop in mice. A. Experimental strategy of establishing gastric intestinal metaplasia model in mice. Active Hnf4α expression was induced after tamoxifen treatment. B. Representative pictures of IHC staining for FOXP3, HDAC6 and HNF4α at the SCJ of WT and Rosa26Hnf4α mice with or without DCA treatment. Scale bars: 20 µm (bottom). C. Expression of these molecules in the gastric antrum of four groups of mice. Scale bars: 20 µm (bottom).

Table 3.

Histopathological changes of gastric mucosa in mice (χ2 test)

Histopathological changes (n) Ctrl/WT DCA/WT Ctrl/Rosa26Hnf4α DCA/Rosa26Hnf4α p-value
N 8 5 2 0
NAG 0 3 1 3 < 0.01
AG 0 0 4 2
IM-like lesions 0 0 1 3
Open in a new tab

Note: N, Normal stomach; NAG, None-atrophic gastritis; AG, Atrophic gastritis; IM, Intestinal metaplasia.

Discussion

In this study, we confirmed the important role of HDAC6 mediated epigenetic modification in BA-induced gastric IM. HDAC6 causes chromatin remodeling at the FOXP3 locus under DCA treatment which induces downregulation of FOXP3 in gastric cells. Reduced levels of FOXP3 enhances the transcription of HNF4α. Therefore, HDAC6/FOXP3/HNF4α loop promotes BA-induced gastric IM and may be involved in the development of GC.

HDAC6, which is classified in class II HDACs, could close DNA to inhibit transcription. HDAC6 is reportedly involved in tumor progression, such as oral cancer and leukemia [38,39]. Similarly, HDAC6 was overexpressed in GC cells, and inhibition of HDAC6 could significantly reduce cell proliferation [27]. Activation of the Akt/TYMS signaling pathway mediated by HDAC6 also participates in apoptosis and chemoresistance of GC cells [40]. In a previous study, we found that HDAC6 and HNF4α formed a closed loop to promote gastric IM under the regulation of miR-1 [18]. HNF4α, as a transcription factor, stimulates HDAC6 transcription; however, how HDAC6 activates HNF4α or promotes IM remains unclear. HDAC6 inhibitors can promote FOXP3 expression by regulating acetylation of the gene, thus promoting the immunosuppressive effect of Treg cells [41]. At the same time, bioinformatics analysis found that FOXP3 has putative binding sites for the HNF4α promoter, so we hypothesized that FOXP3 might be the downstream modification target of HDAC6. We first provided evidence that HDAC6 overexpression and BA could decrease the mRNA and protein levels of FOXP3. In addition, FOXP3 negatively regulated MUC2, KLF4 and CDX2 which suggested that this molecule may be involved in BA-induced IM.

Recently, the role of FOXP3 in tumor development, in a Treg independent manner, has attracted increasing attention. Most studies have shown that this molecule is associated with poor prognosis of patients [42,43]. Both in vivo and in vitro studies have confirmed that FOXP3 plays an anti-cancer role in breast cancer and prostate cancer. In this study, we found that the expression of FOXP3 in gastritis tissues was significantly higher than in IM tissues. In vitro experiments further confirmed that FOXP3 could be involved in the regulation of HDAC6 on downstream HNF4α and intestinal markers. To determine whether HDAC6 regulated FOXP3 by epigenetic modification, we analyzed the histone acetylation level at FOXP3 locus after DCA treatment, and H3Ac, H3K9Ac, H3K27Ac and H4Ac showed significant suppression. Furthermore, ChIP assays confirmed that HDAC6 could directly bind to the FOXP3 promoter. The results also showed that FOXP3 can inhibit the transcription of HNF4α, which subsequently affects the downstream intestinal markers. The above results of this study combined with previous studies showed that miR-1 decreased under the stimulation of BA, leading to increased expression of downstream target molecules HNF4α and HDAC6, and HNF4α further increased HDAC6 promoter activity. Additionally, HDAC6 reduced FOXP3 through epigenetic modification which could further increase HNF4α through transcriptional suppression, thus forming a closed loop that promotes the activation of intestinal markers and IM occurrence.

Another important finding of this study is that DCA treatment of Hnf4α transgenic mice for 12 months caused gastric mucosa atrophy at the antrum and abnormal columnar glands at the SCJ of gastric mucosa which is similar to the histopathologic changes in L2-IL-1β mice reported by Quante et al [11]. Compared with Ctrl/Rosa26Hnf4α mice, gastric mucosa inflammation and intestinal mucus secretion were more obvious in the DCA/Rosa26Hnf4α mice. Furthermore, the Hdac6, Hnf4α and Foxp3 expression levels in the gastric mucosal cells before and after BA stimulation was examined, and the results were consistent with the in vitro results and further indicated the existence of HDAC6/FOXP3/HNF4α regulatory loop. Unfortunately, we did not detect the expression of intestinal markers TFF3 and MUC2 in mouse gastric mucosa containing goblet like cells (data not shown). We will continue to review the literature to find more suitable molecules and examine them in these tissues. In addition, it is noteworthy that the establishment of a bile reflux mouse model in the future may better verify our hypothesis.

In conclusion, this study demonstrated that HDAC6 stimulated by BA could epigenetically regulate FOXP3, which promoted gastric IM by inhibiting HNF4α transcription. Therefore, we propose a model of BA-induced gastric IM (Figure 6F). The activation of the HDAC6/FOXP3/HNF4α loop regulated by miR-1 promotes BA-induced gastric IM. The inhibition of HDAC6 may break this loop and prevent the occurrence of gastric IM or even GC in patients with bile reflux.

Acknowledgements

We wish to thank Zhang Lifeng and Yong Guo (Xijing Hospital of Digestive Diseases) for technical assistance. This work was supported by grant from National Natural Science Foundation of China (No. 81873554 to YQS). This study was supported in part by Shaanxi Innovation Promotion Project (N0. 2018TD-003 to YQS) and independent project of State Key Laboratory of cancer biology (No. CBSKL2019ZZ07 to YQS).

Disclosure of conflict of interest

None.

Supporting Information

ajcr0012-1409-f8.pdf (777.9KB, pdf)

References

  • 1.Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68:394–424. doi: 10.3322/caac.21492. [DOI] [PubMed] [Google Scholar]
  • 2.Correa P. Human gastric carcinogenesis: a multistep and multifactorial process--First American Cancer Society Award Lecture on Cancer Epidemiology and Prevention. Cancer Res. 1992;52:6735–6740. [PubMed] [Google Scholar]
  • 3.Chuang CH, Yang HB, Sheu SM, Hung KH, Wu JJ, Cheng HC, Chang WL, Sheu BS. Helicobacter pylori with stronger intensity of CagA phosphorylation lead to an increased risk of gastric intestinal metaplasia and cancer. BMC Microbiol. 2011;11:121. doi: 10.1186/1471-2180-11-121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sue S, Shibata W, Maeda S. Helicobacter pylori-induced signaling pathways contribute to intestinal metaplasia and gastric carcinogenesis. Biomed Res Int. 2015;2015:737621. doi: 10.1155/2015/737621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Saikawa Y, Fukuda K, Takahashi T, Nakamura R, Takeuchi H, Kitagawa Y. Gastric carcinogenesis and the cancer stem cell hypothesis. Gastric Cancer. 2010;13:11–24. doi: 10.1007/s10120-009-0537-4. [DOI] [PubMed] [Google Scholar]
  • 6.Leung WK, Lin SR, Ching JY, To KF, Ng EK, Chan FK, Lau JY, Sung JJ. Factors predicting progression of gastric intestinal metaplasia: results of a randomised trial on Helicobacter pylori eradication. Gut. 2004;53:1244–1249. doi: 10.1136/gut.2003.034629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lee YC, Chen TH, Chiu HM, Shun CT, Chiang H, Liu TY, Wu MS, Lin JT. The benefit of mass eradication of Helicobacter pylori infection: a community-based study of gastric cancer prevention. Gut. 2013;62:676–682. doi: 10.1136/gutjnl-2012-302240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Jiang JX, Liu Q, Zhao B, Zhang HH, Sang HM, Djaleel SM, Zhang GX, Xu SF. Risk factors for intestinal metaplasia in a southeastern Chinese population: an analysis of 28,745 cases. J Cancer Res Clin Oncol. 2017;143:409–418. doi: 10.1007/s00432-016-2299-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Debruyne PR, Witek M, Gong L, Birbe R, Chervoneva I, Jin T, Domon-Cell C, Palazzo JP, Freund JN, Li P, Pitari GM, Schulz S, Waldman SA. Bile acids induce ectopic expression of intestinal guanylyl cyclase C Through nuclear factor-kappaB and Cdx2 in human esophageal cells. Gastroenterology. 2006;130:1191–1206. doi: 10.1053/j.gastro.2005.12.032. [DOI] [PubMed] [Google Scholar]
  • 10.Tatsugami M, Ito M, Tanaka S, Yoshihara M, Matsui H, Haruma K, Chayama K. Bile acid promotes intestinal metaplasia and gastric carcinogenesis. Cancer Epidemiol Biomarkers Prev. 2012;21:2101–2107. doi: 10.1158/1055-9965.EPI-12-0730. [DOI] [PubMed] [Google Scholar]
  • 11.Quante M, Bhagat G, Abrams JA, Marache F, Good P, Lee MD, Lee Y, Friedman R, Asfaha S, Dubeykovskaya Z, Mahmood U, Figueiredo JL, Kitajewski J, Shawber C, Lightdale CJ, Rustgi AK, Wang TC. Bile acid and inflammation activate gastric cardia stem cells in a mouse model of Barrett-like metaplasia. Cancer Cell. 2012;21:36–51. doi: 10.1016/j.ccr.2011.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kazumori H, Ishihara S, Rumi MA, Kadowaki Y, Kinoshita Y. Bile acids directly augment caudal related homeobox gene Cdx2 expression in oesophageal keratinocytes in Barrett’s epithelium. Gut. 2006;55:16–25. doi: 10.1136/gut.2005.066209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Morita S, Matsumoto Y, Okuyama S, Ono K, Kitamura Y, Tomori A, Oyama T, Amano Y, Kinoshita Y, Chiba T, Marusawa H. Bile acid-induced expression of activation-induced cytidine deaminase during the development of Barrett’s oesophageal adenocarcinoma. Carcinogenesis. 2011;32:1706–1712. doi: 10.1093/carcin/bgr194. [DOI] [PubMed] [Google Scholar]
  • 14.Li T, Guo H, Li H, Jiang Y, Zhuang K, Lei C, Wu J, Zhou H, Zhu R, Zhao X, Lu Y, Shi C, Nie Y, Wu K, Yuan Z, Fan DM, Shi Y. MicroRNA-92a-1-5p increases CDX2 by targeting FOXD1 in bile acids-induced gastric intestinal metaplasia. Gut. 2019;68:1751–1763. doi: 10.1136/gutjnl-2017-315318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Chen L, Toke NH, Luo S, Vasoya RP, Fullem RL, Parthasarathy A, Perekatt AO, Verzi MP. A reinforcing HNF4-SMAD4 feed-forward module stabilizes enterocyte identity. Nat Genet. 2019;51:777–785. doi: 10.1038/s41588-019-0384-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Davison JM, Lickwar CR, Song L, Breton G, Crawford GE, Rawls JF. Microbiota regulate intestinal epithelial gene expression by suppressing the transcription factor Hepatocyte nuclear factor 4 alpha. Genome Res. 2017;27:1195–1206. doi: 10.1101/gr.220111.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wu H, Reizel T, Wang YJ, Lapiro JL, Kren BT, Schug J, Rao S, Morgan A, Herman A, Shekels LL, Rassette MS, Lane AN, Cassel T, Fan TWM, Manivel JC, Gunewardena S, Apte U, Sicinski P, Kaestner KH, Albrecht JH. A negative reciprocal regulatory axis between cyclin D1 and HNF4alpha modulates cell cycle progression and metabolism in the liver. Proc Natl Acad Sci U S A. 2020;117:17177–17186. doi: 10.1073/pnas.2002898117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wang N, Chen M, Ni Z, Li T, Zeng J, Lu G, Wang J, Zhang J, Wu S, Shi Y. HDAC6/HNF4alpha loop mediated by miR-1 promotes bile acids-induced gastric intestinal metaplasia. Gastric Cancer. 2021;24:103–116. doi: 10.1007/s10120-020-01108-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhang B, Wu Q, Li B, Wang D, Wang L, Zhou YL. m(6)A regulator-mediated methylation modification patterns and tumor microenvironment infiltration characterization in gastric cancer. Mol Cancer. 2020;19:53. doi: 10.1186/s12943-020-01170-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Jie M, Wu Y, Gao M, Li X, Liu C, Ouyang Q, Tang Q, Shan C, Lv Y, Zhang K, Dai Q, Chen Y, Zeng S, Li C, Wang L, He F, Hu C, Yang S. CircMRPS35 suppresses gastric cancer progression via recruiting KAT7 to govern histone modification. Mol Cancer. 2020;19:56. doi: 10.1186/s12943-020-01160-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Qin ZY, Wang T, Su S, Shen LT, Zhu GX, Liu Q, Zhang L, Liu KW, Zhang Y, Zhou ZH, Zhang XN, Wen LZ, Yao YL, Sun WJ, Guo Y, Liu KJ, Liu L, Wang XW, Wei YL, Wang J, Xiao HL, Liu P, Bian XW, Chen DF, Wang B. BRD4 promotes gastric cancer progression and metastasis through acetylation-dependent stabilization of snail. Cancer Res. 2019;79:4869–4881. doi: 10.1158/0008-5472.CAN-19-0442. [DOI] [PubMed] [Google Scholar]
  • 22.Schader T, Lowe O, Reschke C, Malacarne P, Hahner F, Muller N, Gajos-Draus A, Backs J, Schroder K. Oxidation of HDAC4 by Nox4-derived H2O2 maintains tube formation by endothelial cells. Redox Biol. 2020;36:101669. doi: 10.1016/j.redox.2020.101669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bruhn C, Ajazi A, Ferrari E, Lanz MC, Batrin R, Choudhary R, Walvekar A, Laxman S, Longhese MP, Fabre E, Smolka MB, Foiani M. The Rad53(CHK1/CHK2)-Spt21(NPAT) and Tel1(ATM) axes couple glucose tolerance to histone dosage and subtelomeric silencing. Nat Commun. 2020;11:4154. doi: 10.1038/s41467-020-17961-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Shao LW, Peng Q, Dong M, Gao K, Li Y, Li Y, Li CY, Liu Y. Histone deacetylase HDA-1 modulates mitochondrial stress response and longevity. Nat Commun. 2020;11:4639. doi: 10.1038/s41467-020-18501-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Li Z, Lu X, Liu Y, Zhao J, Ma S, Yin H, Huang S, Zhao Y, He X. Gain of LINC00624 enhances liver cancer progression by disrupting the HDAC6-TRIM28-ZNF354C corepressor complex. Hepatology. 2021;73:1764–1782. doi: 10.1002/hep.31530. [DOI] [PubMed] [Google Scholar]
  • 26.Bhat-Nakshatri P, Kumar B, Simpson E, Ludwig KK, Cox ML, Gao H, Liu Y, Nakshatri H. Breast cancer cell detection and characterization from breast milk-derived cells. Cancer Res. 2020;80:4828–4839. doi: 10.1158/0008-5472.CAN-20-1030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Park SJ, Kim JK, Bae HJ, Eun JW, Shen Q, Kim HS, Shin WC, Yang HD, Lee EK, You JS, Park WS, Lee JY, Nam SW. HDAC6 sustains growth stimulation by prolonging the activation of EGF receptor through the inhibition of rabaptin-5-mediated early endosome fusion in gastric cancer. Cancer Lett. 2014;354:97–106. doi: 10.1016/j.canlet.2014.07.041. [DOI] [PubMed] [Google Scholar]
  • 28.van Loosdregt J, Vercoulen Y, Guichelaar T, Gent YY, Beekman JM, van Beekum O, Brenkman AB, Hijnen DJ, Mutis T, Kalkhoven E, Prakken BJ, Coffer PJ. Regulation of Treg functionality by acetylation-mediated Foxp3 protein stabilization. Blood. 2010;115:965–974. doi: 10.1182/blood-2009-02-207118. [DOI] [PubMed] [Google Scholar]
  • 29.Khumalo J, Kirstein F, Hadebe S, Brombacher F. IL-4Ralpha signaling in CD4+CD25+ FoxP3+ T regulatory cells restrains airway inflammation via limiting local tissue IL-33. JCI Insight. 2020;5:e136206. doi: 10.1172/jci.insight.136206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Helmin KA, Morales-Nebreda L, Acosta MAT, Anekalla KR, Chen SY, Abdala-Valencia H, Politanska Y, Cheresh P, Akbarpour M, Steinert EM, Weinberg SE, Singer BD. Maintenance DNA methylation is essential for regulatory T cell development and stability of suppressive function. J Clin Invest. 2020;130:6571–6587. doi: 10.1172/JCI137712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Won KY, Kim HK, Kim GY, Song MJ, Lim SJ. Hippo pathway and tumoral FOXP3 expression correlate with tumor growth in squamous cell carcinoma of the lung. Pathol Res Pract. 2020;216:153003. doi: 10.1016/j.prp.2020.153003. [DOI] [PubMed] [Google Scholar]
  • 32.Qi H, Li W, Zhang J, Chen J, Peng J, Liu Y, Yang S, Du J, Long X, Ng CS, Li MY, Chen GG. Glioma-associated oncogene homolog 1 stimulates FOXP3 to promote non-small cell lung cancer stemness. Am J Transl Res. 2020;12:1839–1850. [PMC free article] [PubMed] [Google Scholar]
  • 33.Zuo T, Liu R, Zhang H, Chang X, Liu Y, Wang L, Zheng P, Liu Y. FOXP3 is a novel transcriptional repressor for the breast cancer oncogene SKP2. J Clin Invest. 2007;117:3765–3773. doi: 10.1172/JCI32538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Yang S, Liu Y, Li MY, Ng CSH, Yang SL, Wang S, Zou C, Dong Y, Du J, Long X, Liu LZ, Wan IYP, Mok T, Underwood MJ, Chen GG. FOXP3 promotes tumor growth and metastasis by activating Wnt/beta-catenin signaling pathway and EMT in non-small cell lung cancer. Mol Cancer. 2017;16:124. doi: 10.1186/s12943-017-0700-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wu L, Yi B, Wei S, Rao D, He Y, Naik G, Bae S, Liu XM, Yang WH, Sonpavde G, Liu R, Wang L. Loss of FOXP3 and TSC1 accelerates prostate cancer progression through synergistic transcriptional and posttranslational regulation of c-MYC. Cancer Res. 2019;79:1413–1425. doi: 10.1158/0008-5472.CAN-18-2049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wang L, Li B, Zhang L, Li Q, He Z, Zhang X, Huang X, Xu Z, Xia Y, Zhang Q, Li Q, Xu J, Sun G, Xu Z. miR-664a-3p functions as an oncogene by targeting Hippo pathway in the development of gastric cancer. Cell Prolif. 2019;52:e12567. doi: 10.1111/cpr.12567. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 37.Yin H, Chu A, Liu S, Yuan Y, Gong Y. Identification of DEGs and transcription factors involved in H. pylori-associated inflammation and their relevance with gastric cancer. PeerJ. 2020;8:e9223. doi: 10.7717/peerj.9223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wang XC, Ma Y, Meng PS, Han JL, Yu HY, Bi LJ. miR-433 inhibits oral squamous cell carcinoma (OSCC) cell growth and metastasis by targeting HDAC6. Oral Oncol. 2015;51:674–682. doi: 10.1016/j.oraloncology.2015.04.010. [DOI] [PubMed] [Google Scholar]
  • 39.Losson H, Gajulapalli SR, Lernoux M, Lee JY, Mazumder A, Gerard D, Seidel C, Hahn H, Christov C, Dicato M, Kirsch G, Han BW, Schnekenburger M, Diederich M. The HDAC6 inhibitor 7b induces BCR-ABL ubiquitination and downregulation and synergizes with imatinib to trigger apoptosis in chronic myeloid leukemia. Pharmacol Res. 2020;160:105058. doi: 10.1016/j.phrs.2020.105058. [DOI] [PubMed] [Google Scholar]
  • 40.Liang X, Shi H, Yang L, Qiu C, Lin S, Qi Y, Li J, Zhao A, Liu J. Inhibition of polypyrimidine tract-binding protein 3 induces apoptosis and cell cycle arrest, and enhances the cytotoxicity of 5- fluorouracil in gastric cancer cells. Br J Cancer. 2017;116:903–911. doi: 10.1038/bjc.2017.32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Beier UH, Wang L, Han R, Akimova T, Liu Y, Hancock WW. Histone deacetylases 6 and 9 and sirtuin-1 control Foxp3+ regulatory T cell function through shared and isoform-specific mechanisms. Sci Signal. 2012;5:ra45. doi: 10.1126/scisignal.2002873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Ma GF, Miao Q, Liu YM, Gao H, Lian JJ, Wang YN, Zeng XQ, Luo TC, Ma LL, Shen ZB, Sun YH, Chen SY. High FoxP3 expression in tumour cells predicts better survival in gastric cancer and its role in tumour microenvironment. Br J Cancer. 2014;110:1552–1560. doi: 10.1038/bjc.2014.47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Suh JH, Won KY, Kim GY, Bae GE, Lim SJ, Sung JY, Park YK, Kim YW, Lee J. Expression of tumoral FOXP3 in gastric adenocarcinoma is associated with favorable clinicopathological variables and related with Hippo pathway. Int J Clin Exp Pathol. 2015;8:14608–14618. [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ajcr0012-1409-f8.pdf (777.9KB, pdf)

Articles from American Journal of Cancer Research are provided here courtesy of e-Century Publishing Corporation

RESOURCES