Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Oct 1.
Published in final edited form as: Free Radic Biol Med. 2021 Aug 13;174:236–248. doi: 10.1016/j.freeradbiomed.2021.08.011

Pituitary Adenylate Cyclase-Activating Polypeptide Attenuates Mitochondria-Mediated Oxidative Stress and Neuronal Apoptosis after Subarachnoid Hemorrhage in Rats

Yuanjian Fang 1,*, Hui Shi 2,*, Lei Huang 3,4, Reng Ren 1, Cameron Lenahan 3,5, Jie Xiao 3, Yu Liu 3, Rui Liu 3, Rajvee Sanghavi 5, Chenguang Li 1, Sheng Chen 1, Jiping Tang 3,4,6, Jun Yu 1, John H Zhang 3,4,6, Jianmin Zhang 1
PMCID: PMC8985554  NIHMSID: NIHMS1734118  PMID: 34400297

Abstract

Mitochondria-mediated oxidative stress and neuronal apoptosis play an important role in early brain injury following subarachnoid hemorrhage (SAH). Pituitary adenylate cyclase-activating polypeptide (PACAP) has been shown to reduce oxidative stress and cellular apoptosis by maintaining mitochondrial function under stress. The objective of this study is to investigate the effects of PACAP on mitochondria dysfunction - induced oxidative stress and neuronal apoptosis in both vivo and vitro models of SAH. PACAP Knockout CRISPR and exogenous PACAP38 were used to verify the neuroprotective effects of PACAP in rats after endovascular perforation - induced SAH as well as in primary neuron culture after hemoglobin stimulation. The results showed that endogenous PACAP knockout aggravated mitochondria dysfunction - mediated ATP reduction, reactive oxygen species accumulation and neuronal apoptosis in ipsilateral hemisphere at 24h after SAH in rats. The exogenous PACAP38 treatment provided both short- and long- term neurological benefits by attenuating mitochondria - mediated oxidative stress and neuronal apoptosis after SAH in rats. Consistently, the exogenous PACAP38 treatment presented similar neuroprotection in the primary neuron culture after hemoglobin stimulation. Pharmacological inhibition of adenylyl cyclase (AC) or extracellular signal-regulated kinase (ERK) partly abolished the anti-oxidative stress and anti-apoptotic effects provided by PACAP38 treatment after the experimental SAH both in vivo and in vitro, suggesting the involvement of the AC-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and ERK pathway. Collectively, PACAP38 may serve as a promising treatment strategy for alleviating early brain injury after SAH.

Keywords: Pituitary adenylate cyclase-activating polypeptide, subarachnoid hemorrhage, oxidative stress, apoptosis, mitochondria

Graphical Abstract

graphic file with name nihms-1734118-f0007.jpg

1. Introduction

Subarachnoid hemorrhage (SAH) is a severe subtype of stroke with high mortality and morbidity, leading to substantial economic burden to family and society[1]. Early brain injury (EBI) is considered the leading cause for both acute and delayed neurological deficits following SAH[2]. Accumulating evidence suggests that the mitochondria - mediated oxidative stress and neuronal apoptosis plays a key role in the process of EBI after SAH[3–5]. Mitochondria are dynamic organelles that regulate cellular energy metabolism, calcium homeostasis, and reactive oxygen species (ROS) production[6]. Mitochondrial damage under stress results in decreased ATP production, increased ROS burden, impaired calcium buffering, and activated intrinsic apoptosis pathway[7, 8]. Therefore, pharmacological interventions targeting mitochondrial dysfunction would reduce oxidative stress and neuronal apoptosis after SAH.

Pituitary adenylate cyclase-activating polypeptide (PACAP) is a neuropeptide widely distributed in the mammalian central nervous system (CNS), including the hypothalamus and pituitary gland (most abundant), cerebellum, hippocampus, and cortex[9]. Physiological functions of PACAP are diverse including the regulation of neurotransmission, immunity, proliferation, differentiation, and migration. Recent studies have revealed its importance as a neuroprotective neuropeptide in several neurological disorders (e.g. multiple sclerosis[10], migraine[11], traumatic brain injury[12], and cerebral ischemia[13]). PACAP was reported to maintain a mitochondrial function in retinal neurons[14]. Exogenous PACAP treatment markedly alleviated oxidative stress and apoptosis via facilitating the Adenylyl cyclase (AC) / cyclic adenosine monophosphate (cAMP) / protein kinase A (PKA) phosphorylation axis or extracellular signal-regulated kinase (ERK) axis in glial and endothelial cell lines[15, 16]. Our previous study demonstrated the presence of PACAP receptor 1 (PAC1) in both astrocytes, neurons, and endothelial cells SAH rats[17]. PACAP significantly enhanced the cAMP activation and PKA phosphorylation after SAH[17].

Herein, we proposed that PACAP would attenuate mitochondria-mediated oxidative stress and neuronal apoptosis, thus alleviating EBI after SAH. The neuroprotective mechanism may involve the signaling pathways of AC/cAMP/PKA and ERK.

2. Material and methods

2.1. Experiment design

This study included five sub-experiments (Supplementary Figure 1). All subjects were randomly assigned to different experimental groups. Information of experimental groups was blinded to researchers who performed animal surgeries, outcome assessments, and data analysis.

2.1.1. Experiment 1. Role of Endogenous PACAP in Mitochondria-mediated Oxidative Stress and Neuronal Apoptosis after SAH in Rats.

PACAP Knockout CRISPR was used to explore the role of endogenous PACAP in mitochondrial-mediated oxidative stress and neuronal apoptosis in ipsilateral hemisphere, as well as neurobehavior 24h after SAH. Rats were randomly divided into four groups (n = 10/group): Sham, SAH, SAH+Control CRISPR, and SAH+PACAP Knockout CRISPR. Neurobehavioral tests (n = 10/group) were performed in each rat. ATP assays (n = 6/group) were performed to evaluate mitochondrial function. Immunofluorescence staining of Mitosox (n = 4/group) were performed to evaluate mitochondrial oxidative stress. Terminal deoxynucleotidyl transferase dUTP (TUNEL) staining (n = 4/group) were performed to evaluate neuronal apoptosis. Western blot (n=6/group) was used to assess protein levels of PACAP, oxidative stress markers (4-Hydroxynonena (4-HNE and acetylation superoxide dismutase 2 (Ac-SOD2)), and intrinsic apoptosis markers (ratio of Bax/Bcl-2 and cleaved caspase-3).

2.1.2. Experiment 2. Effect of Exogenous PACAP38 Treatment on Mitochondria-mediated Oxidative Stress and Neuronal Apoptosis at 24h after SAH in Rats.

PACAP38 was administrated to evaluate the effects of exogenous PACAP treatment on mitochondria-mediated oxidative stress and neuronal apoptosis in ipsilateral hemisphere at 24h after SAH. Rats were randomly divided into three groups (n = 10/group): Sham, SAH+PBS, and SAH+PACAP38. Neurobehavioral tests (n = 10/group) were performed in each rat. ATP assays (n = 6/group) were performed to evaluate mitochondrial function. Immunofluorescence staining of Mitosox and 8-OHDG (n= 4/group) were performed to evaluate mitochondrial oxidative stress. TUNEL staining and Fluoro-Jade C (FJC) staining (n = 4/group) were performed to evaluate neuronal apoptosis/degeneration.

2.1.3. Experiment 3. Effect of Exogenous PACAP38 Treatment on Long-Term Neuronal Degeneration after SAH in Rats.

Exogenous PACAP38 was administered to evaluate the value of PACAP38 treatment on neuronal degeneration in ipsilateral hemisphere at 28d after SAH. Rats were randomly divided into three groups (n = 6/group): Sham, SAH+PBS, and SAH+PACAP38. Nissl staining and FJC staining were performed to evaluate the neuronal degeneration on the cortex and hippocampus.

2.1.4. Experiment 4. Potential Neuroprotective Molecular Mechanism of PACAP38 Treatment after SAH in Rats.

AC and ERK inhibitors were used to evaluate the mechanism of AC/cAMP/PKA and ERK pathway in the anti-oxidative stress and anti-apoptosis effects provided by PACAP38. Rats were randomly divided into five groups (n = 6/group): Sham, SAH+PBS+DMSO, SAH+PACAP38+DMSO, SAH+PACAP38+SQ22536, and SAH+PACAP38+U0126. Western blot (n=6/group) was used to assess the protein levels of PACAP signaling axis (PACAP, cAMP, PKA, p-PKA, ERK, p-ERK), oxidative stress markers (4-HNE, Ac-SOD2), intrinsic apoptosis markers (Bcl-2, Bax, and cleaved caspase-3). ATP assays (n = 6/group) were performed to evaluate mitochondrial function.

2.1.5. Experiment 5. Effect of Exogenous PACAP38 Treatment on Primary Neuron Culture after Hemoglobin (Hb) Stimulation.

This vitro experiment included two parts. Part A). To explore the effect of PACAP38 on neuronal apoptosis after Hb stimulation. Three groups were divided: Control, Hb+PBS, and Hb+PACAP38. Cell viability was measured using CCK-8 and LDH assays. Propidium Iodide (PI) and Annexin V staining was performed and detected by flow cytometry to evaluate apoptosis. Western blot was used to assess protein levels of cAMP, PKA, p-PKA, ERK, p-ERK, 4-HNE, Ac-SOD2, Bcl-2, Bax, and cleaved caspase-3. ATP assay was performed to evaluate mitochondrial function. Part B). To explore the mechanism of AC/cAMP/PKA and ERK pathway in the neuroprotection provided by PACAP38 after Hb stimulation. Four groups were divided: Hb+PBS+DMSO, Hb+PACAP38+DMSO, Hb+PACAP38+SQ22536, and Hb+PACAP38+U0126. The assessments of cell viability, mitochondria-mediated oxidative stress and neuronal apoptosis as well as protein changes were the same as Part A.

2.2. Animals

All experiments involving animals in this study were approved by the Institutional Animal Care and Use Committee (IACUC) at Loma Linda University, and were in compliance with protocols established by the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Adult male Sprague Dawley rats weighing between 280 – 320g were used for this study. Rats were housed in a temperature- and humidity-controlled facility with 12h/12h light/dark cycle. Rats were provided ad libitum access to food and water.

2.3. Primary Neuron Culture

Primary cortical neuron culture was prepared from fetal (E16–18) Sprague Dawley rats (SLAC, Shanghai, China), as previous studied[ 18]. Briefly, while under deep anesthesia, the fetal rats were decapitated and placed in 75% alcohol for sterilization. The brain cortex was dissected followed by the removal of leptomeninges, vessels, and white matter in HBSS (Thermo Fisher Scientific, MA, USA) under microscope. The brain cortex was trypsinized in 0.125% trypsin for 5 min at 37 °C. The suspensions were filtrated with 40 filter and centrifuged at 1500 r/min for 5 min. Next, the cell pellets were re-suspended in Dulbecco’s modified Eagle’s medium (DMEM, Thermo Fisher Scientific, MA, USA) with FBS and penicillin-streptomycin, and seeded into poly-D-lysine-coated plates. Two hours later, the culture medium was replaced with Neurobasal Medium (Thermo Fisher Scientific, MA, USA) containing GlutaMAX-I (Thermo Fisher Scientific, MA, USA), B27 supplement (Thermo Fisher Scientific, MA, USA), and penicillin-streptomycin. Cells were cultured at 37 °C in 95% humidity with 5% CO2. The culture medium was refreshed every 2 days. All in vitro experiments were repeated at least three times.

2.4. SAH Model

2.4.1. Rat model of SAH

The endovascular perforation was conducted to induce SAH in rats as described in our previous study[17]. Briefly, isoflurane anesthetized rats were intubated and mechanically ventilated. A sharp 4–0 monofilament was inserted from the left external carotid artery to the internal carotid artery and further puncture the bifurcation separating the anterior and middle cerebral arteries. The rats in the sham group underwent all procedures with the exception of endovascular puncture. All vital signs were recorded every 5 minutes to confirm the anesthetic status and prevent distress.

2.4.2. SAH model in vitro

The primary neuron in vitro cultures were treated with 1.5μM Hb (MilliporeSigma, Burlington, MA, USA) dissolved with culture medium for 24h to mimic SAH conditions as described in a previous study[19].

2.5. Drug Administration

In the in vivo experiments, two drug delivery routes of intraperitoneal injection (i.p.) and intraventricular injection (i.c.v.) were used according to our previous study[17]. The exogenous PACAP38 (Phoenix Pharmaceuticals Inc., Burlingame, CA) was dissolved in phosphate-buffered saline (PBS, 0.01 M) and administered via i.p. injection at dosages of 30 μg/kg 1 h after SAH for short-term outcome assessment, and was administered at 1h, 25h, and 49h after SAH for long-term outcome assessment according to our previous study[17]. The engineered form of CRISPR-associated (Cas9) protein system (Santa Cruz Biotechnology, Dallas, TX) was used for endogenous PACAP knockout in this study. PACAP Knockout CRISPR (sc-437378, gRNA sequences: CGAAGCCTACCGCAAAGTCT; CTGTGAAGATGCCGTCCGAG; GTAGCACCTACCTGATCCCA) was administered via i.c.v. injection at a dosage of 2 μg/rat at 48 h before surgery. Efficiency of knockout was validated by the brain protein level of PACAP using western blot. Control CRISPR (sc-418922) was used to control the off-target effects of CRISPR. In addition, AC inhibitor, SQ22536 (2 nmol per rats, dissolved with dimethyl sulfoxide (DMSO), No.1435/10, Tocris Bioscience, Minneapolis, MN), and ERK inhibitor, U0126-EtOH (30mg/kg, dissolved with DMSO, No. 1144/5, Tocris Bioscience, Minneapolis, MN), were administrated 1 h after surgery via i.c.v. injection. The efficiency of inhibition was validated by the brain protein levels of cAMP and p-ERK using western blot.

In the in vitro neuronal culture experiment, exogenous PACAP38 at a dosage of 0.1 μM, was administered 1 h after Hb treatment[20]. SQ22536 (10 μM) and U0126 (1 μM) were administrated 4h before Hb treatment.

2.6. SAH Severity in Rats

The SAH severity was measured according to the SAH grades proposed by Sugawara et. al.[21]. SAH grades ranging from 0–18 were a sum of the scores from 6 appointed segments on the basal cistern. The score from each segment was graded according to the blood volume and thickness ranging from 0 – 3 (0 represents no visible blood, 3 represents thick and diffuse blood). Rats with SAH grade below 9 were excluded from this study.

2.7. Cell Viability and Cytotoxicity

In the in vitro experiment, cell viability was measured using the CCK-8 assay (C0038, Beyotime, Shanghai, China). All procedures were conducted according to the manufacturer’s instruction. The absorbance was measured at 450 nm. Cytotoxicity was measured using the lactate dehydrogenase (LDH) release assay (C0017, Beyotime, Shanghai, China). All procedures were conducted according to the manufacturer’s instruction. The absorbance was measured at 480 nm.

2.8. Annexin V and PI Staining

In the in vitro experiment, Annexin V and PI staining was conducted to detect the annexin V- and PI-positive primary neurons according to our previous study[22]. All procedures were conducted according to the manufacturer’s instruction from the FITC Annexin V Apoptosis Detection Kit (Becton Dickinson, Franklin Lanes, NJ, USA). Stained cells were analyzed using flow cytometry (FACSCalibur; BD Biosciences, San Diego, CA, USA). Surviving neurons were determined to be FITC−/PI−. Early apoptotic neurons were determined to be FITC+/PI−.

2.9. ATP Assay

The ATP levels were assessed according to the manufacturer’s instruction from luciferase-based ATP assay kit (S0026, Beyotime, Shanghai, China) as previously described[23]. The fluorescence levels were measured via fluorophotometer. The ATP concentrations were calculated using the standard curve method. Next, the protein levels of different samples were acquired using a detergent-compatible protein assay kit (Bio-Rad, Hercules, CA, USA). The ATP levels were displayed in the form of nmol/mg.

2.10. Neurobehavioral Assessment

The modified Garcia and Beam Balance tests were used for neurobehavioral assessment as previously described[24]. The modified Garcia test, with scores ranging from 0–18, was performed to evaluate response capacity, alertness, coordination, and motor skills. The Beam Balance test, with scores ranging from 0–4, was performed to evaluate complex movements and coordination. A higher score indicates a better performance.

2.11. Immunofluorescence Staining

Immunofluorescence staining of 8-hydroxy-2ʹ-deoxyguanosine (8-OHDG) and Mitosox were conducted to assess the brain DNA damage associated oxidative stress and mitochondrial superoxide levels. The procedure was conducted as previously described[25]. Briefly, the rats were sacrificed under deep anesthesia at 24 h after SAH by transcardial perfusing with 0.01M PBS and subsequent 10% neutral buffered formalin. The brain was extracted from skull and was further fixed in 10% neutral buffered formalin for 24 h, followed by 4% paraformaldehyde for 24 h. Lastly, they were dehydrated by successively immersed in serial 15 and 30% sucrose solutions for 2 days. The brain was cut into 10-μm coronal frozen slices, for immunofluorescence staining. The brain slices were blocked with 5% normal donkey serum in 0.1% Triton X-100 for 1 h at room temperature, followed by overnight incubation at 4 °C with the following primary antibodies: anti-Mitosox antibody (M36008, Thermo Fisher, CA, USA), anti-8-OHDG antibody (ab62623, Abcam, Cambridge, MA, USA), and anti-NEUN antibody (ab104224, Abcam, Cambridge, MA, USA). On the second day, the brain slices were incubated with species-corresponding fluorescence-conjugated secondary antibodies (Jackson ImmunoResearch, West Grove, PA) for 1 h at room temperature. The images were visualized and photographed using a fluorescence microscope (Leica Microsystems, Wetzlar, Germany). Quantification of positive cells was counted in three randomized areas chosen in the ipsilateral cortex.

2.12. TUNEL Staining

The TUNEL and NeuN co-staining was conducted to measure neuronal apoptosis/neuronal death as previous[26]. The 10-μm coronal frozen slices were first incubated with anti-NeuN antibody (ab104224, Abcam, Cambridge, MA, USA) at 4 °C overnight. On the second day, the brain slices were further stained using In Situ Apoptosis Detection Kit (12156792910 Roche, MO, USA) based on manufacture’s instruction. The images were visualized and photographed using a fluorescence microscope (Leica Microsystems, Wetzlar, Germany). Quantification of positive cells was counted in three randomized areas chosen in the ipsilateral cortex.

2.13. FJC Staining

The FJC staining was conducted to measure neuronal degeneration. All procedures were performed according to the manufacturer’s instruction of the Ready-to-Dilute Staining Kit (Biosensis, CA, USA). The images were visualized and photographed using a fluorescence microscope (Leica Microsystems, Wetzlar, Germany). Quantification of positive cells was counted in three randomized areas chosen in the ipsilateral cortex.

2.14. Nissl Staining

Nissl staining was used to access the neuronal degeneration as previously described[17]. Briefly, the 15-μm coronal frozen slices were submerged in 0.5% cresyl violet solution (Sigma-Aldrich, St. Louis, MO, USA) for 10 min until the desired intensity of staining was achieved. The images were visualized and photographed using an optical microscope (Olympus, Center Valley, PA). The number of Nissl-positive neurons in the cortex and hippocampus was calculated using the ImageJ software and averaged from three different brain slices.

2.15. Western Blot

Western blots were performed as previously described[27, 28]. Briefly, the ipsilateral (left) cerebral hemisphere was homogenized in RIPA lysis buffer (Santa Cruz Biotechnology, Dallas, TX), and centrifuged at 15,000g at 4 °C for 20 min. The supernatant was mixed with loading buffer to reach 5 μg/mL protein concentration. The 20 μg- protein of each sample were loaded for electrophoresis, and were further transferred onto nitrocellulose membranes. Afterwards, the membranes were incubated with the following primary antibodies overnight at 4°C: anti-PACAP antibody (ab181205, Abcam, Cambridge, MA, USA), anti-4-HNE antibody (ab46545, Abcam, Cambridge, MA, USA), anti-Ac-SOD2 antibody (ab137037, Abcam, Cambridge, MA, USA), anti-Bcl-2 antibody (ab59348, Abcam, Cambridge, MA, USA), anti-Bax antibody (ab182734, Abcam, Cambridge, MA, USA), anti-cleaved caspase-3 antibody (D175, Cell Signaling Technology, MA, USA), anti-cAMP antibody (ab76238, Abcam, Cambridge, MA, USA), anti-PKA (4781S, Cell Signaling Technology), anti-p-PKA (4782S, Cell Signaling Technology), anti-ERK1/2 antibody (sc-514302, Santa Cruz Biotechnology, Dallas, TX), anti-p-ERK1/2 antibody (sc-136521, Santa Cruz Biotechnology, Dallas, TX), and anti-β-actin (sc-47778, Santa Cruz Biotechnology, Dallas, TX). On the second day, the species-corresponding secondary antibody (Santa Cruz Biotechnology, Dallas, TX) was incubated with the membrane at room temperature for 1 h. Afterward, the immunoblots were visualized using the ECL Plus chemiluminescence reagent kit (Amersham Bioscience, Pittsburgh, PA), and was quantified using the ImageJ software.

2.16. Statistical Analysis

All data were presented as the mean and standard deviation (mean ± SD). Statistical analysis was performed with Prism 6.0 software (Graph Pad Software, CA, USA) and SPSS 23.0 (IBM, NY, USA). The normality of the data was checked using the Kruskal-Wallis test. One-way ANOVA followed by Tukey’s post hoc test was used for comparison among multiple groups. A p < 0.05 was considered statistically significant.

3. Results

3.1. Animal Use and Mortality

A total of 155 rats were used in our in vivo experiment, of which 123 underwent SAH surgery and 32 underwent sham surgery. Of the rats that underwent SAH surgery, 7 were excluded due to the limited volume of bleeding (SAH grade less than 9). The mortality rate of the SAH rats in this study was 25.8% (30/116) without significant difference among all SAH groups. The detailed mortality in each group is listed in Supplementary Table 1.

3.2. Endogenous Brain PACAP Knockout Exacerbated Mitochondria-Mediated Oxidative Stress and Neuronal Apoptosis at 24h after SAH in Rats

The brain PACAP protein level at 24h after SAH were markedly reduced in the SAH + PACAP Knockout CRISPR group when compared to the SAH group and SAH + Control CRISPR group (both P < 0.05, Figure 1A, B), which validated the efficacy of PACAP Knockout CRISPR. There was no statistical difference between the SAH group and the SAH + Control CRISPR group in protein levels of PACAP and downstream proteins, as well as levels of ATP and neurobehavior scores (both P > 0.999, Figure 1A–B, E–G), which excluded any off-target effects caused by the CRISPR system.

Figure 1. Endogenous PACAP knockout exacerbated mitochondrial dysfunction-induced oxidative stress and neuronal apoptosis at 24h after SAH.

Figure 1.

Open in a new tab

A-B. Representative western blot bands and quantification of PACAP, 4-HNE, Ac-SOD2, Bcl-2, Bax, and cleaved caspase-3 (CC3) in ipsilateral brain hemisphere. n = 6 per group. C-D. Representative microphotograph and quantification of TUNEL (green)-positive neurons (red) in the ipsilateral basal cortex. Scale bar = 100 μm, n = 4 per group. E. Relative ATP level in ipsilateral brain hemisphere. n = 6 per group. F-G. Modified Garcia Score and Beam Balance score. n = 10 per group. *P < 0.05 versus Sham group, #P < 0.05 versus SAH group, @ P < 0.05 versus SAH + Control CRISPR group; One-way ANOVA, Tukey’s post hoc test.

The protein levels of mitochondrial dysfunction-related oxidative stress markers, 4-HNE and Ac-SOD2, and intrinsic apoptosis markers, Bax/Bcl-2 and cleaved caspase-3, were significantly increased in the SAH group and SAH + Control CRISPR, compared to Sham group (both P < 0.05, Figure 1A, B). PACAP Knockout CRISPR significantly aggravated the SAH-induced upregulations of 4-HNE, Ac-SOD2, Bax/Bcl-2, and cleaved caspase-3 increase (both P < 0.05, compared to SAH group or SAH + Control CRISPR group, Figure 1A, B).

The ATP levels (Figure 1E) were significantly decreased in the SAH group and SAH + Control CRISPR group when compared to Sham group (both P < 0.05), which was markedly aggravated by PACAP Knockout CRISPR administration (both P < 0.05, compared to SAH group or SAH + Control CRISPR group).

TUNEL staining and Mitosox staining further confirmed that the TUNEL-positive neurons and Mitosox-expression were significantly increased at 24h after SAH (P < 0.05, compared to Sham group, Figure 1C, D), which were further increased by PACAP Knockout CRISPR after SAH (P < 0.05, compared to SAH + Control CRISPR group Figure 1C, D). Consistently, the SAH-induced decline in neurological scores (modified Garcia Score and Beam Balance score) were also exacerbated by the PACAP Knockout CRISPR administration (both P < 0.05, SAH group/SAH + Control CRISPR group vs SAH + PACAP Knockout CRIPSR group, Figure 1F, G)

3.3. Exogenous PACAP38 Treatment Attenuated Mitochondria-Mediated Oxidative Stress and Neuronal Apoptosis at 24h after SAH in Rats

Exogenous PACAP38 (30 μg/kg) was administrated 1h after SAH induction. TUNEL staining and FJC staining were conducted to demonstrate the neuronal apoptosis/degeneration. As shown in Figure 2A, B, the number of TUNEL- and FJC- positive neurons was markedly increased in the SAH + PBS group at 24h after SAH (both P < 0.05, compared to Sham group). In contrast, the PACAP38 treatment significantly reduced the number of TUNEL- and FJC-positive neurons in SAH + PACAP38 group (both P < 0.05, compared to SAH + PBS group).

Figure 2. Exogenous PACAP38 treatment attenuated mitochondrial dysfunction-induced oxidative stress and neuronal apoptosis at 24h after SAH.

Figure 2.

Open in a new tab

A. Representative microphotograph and quantification of TUNEL (green) - positive neurons (red) in ipsilateral basal cortex. B. Representative microphotograph and quantification of FJC (green)-positive cells in ipsilateral basal cortex. C. Representative microphotograph and quantification of Mitosox (red)-positive cells in ipsilateral basal cortex. D. Representative microphotograph and quantification of 8-OHDG (green)-positive cells in ipsilateral basal cortex. Scale bar = 100 μm, n = 4 per group. E. Relative ATP level in ipsilateral brain hemisphere. n = 6 per group. F-G. Modified Garcia Score and Beam Balance score. n = 10 per group. *P < 0.05 versus Sham group, #P < 0.05 versus SAH + PBS group. One-way ANOVA, Tukey’s post hoc test.

Mitosox and 8-OHDG staining were conducted to access the mitochondrial dysfunction-induced oxidative stress. As shown in Figure 2C, D, the markedly increased Mitosox-positive or 8-OHDG-positive cells in the SAH + PBS group at 24h after SAH (both P < 0.05, compared to Sham group) were significantly attenuated by PACAP38 treatment (P < 0.05, compared to SAH group).

The ATP level was significantly decreased in SAH+PBS group (P < 0.05, compared to Sham group), but increased in SAH + PACAP38 group (P < 0.05, compared to SAH+PBS group) (Figure 2E).

Moreover, SAH-induced neurobehavior deficits (decline of modified Garcia Score and Beam Balance score) were significantly improved by the PACAP38 treatment (P < 0.05, SAH+PBS vs SAH + PACAP38 group, Figure 2F, G).

3.4. Exogenous PACAP38 Treatment Reduced Neuronal Degeneration at 28d after SAH in Rats

Exogenous PACAP38 improved Rotarod test results at weeks 1, 2, and 3 after SAH, and improved Morris water maze test results on days 23–28 after SAH[17]. We further investigated the SAH-induced neuronal degeneration in the ipsilateral cortex of the parietal lobe and the hippocampus.

Nissl staining showed that there were significantly less neurons with normal morphology of sharp demarcation and rich cytoplasm in SAH+PBS group (P < 0.05, compared to Sham group, Figure 3A, C) in ipsilateral parietal cortex and CA1 area of the hippocampus, whereas the PACAP38 treatment preserve the neuronal survival at 28d after SAH (P < 0.05, SAH+PBS vs SAH + PACAP38 group, Figure 3A, C).

Figure 3. Exogenous PACAP38 treatment attenuated neuron degeneration at 28 days after SAH.

Figure 3.

Open in a new tab

A. Representative microphotograph of Nissl staining and quantification of surviving neuron in ipsilateral parietal cortex. Scale bar = 200 μm. B. Representative microphotograph and quantification of FJC (green)-positive degenerating neurons in parietal cortex. Scale bar = 100 μm. C. Representative microphotograph of Nissl staining and quantification of surviving neuron in CA1 area of ipsilateral hippocampus. Scale bar = 200 μm. D. Representative microphotograph and quantification of FJC (green) positive degenerating neurons in CA1 area of ipsilateral hippocampus. Scale bar = 100 μm. n = 6 per group. *P < 0.05 versus Sham group, #P < 0.05 versus SAH + PBS group. One-way ANOVA, Tukey’s post hoc test.

Similarly, there were more FJC-positive neurons in the ipsilateral cortex and hippocampus in the SAH + PBS group at 28d after SAH (P < 0.05, compared to Sham group, Figure 3B, D), which reduced by PACAP38 treatment (P < 0.05, SAH+PBS vs SAH + PACAP38 group, Figure 3B, D).

3.5. Exogenous PACAP38 Alleviated Mitochondria-Mediated Oxidative Stress and Neuronal Apoptosis via AC/cAMP/PKA/ERK Pathway in Rats after SAH

The PACAP38 treatment significantly alleviated SAH-induced downregulation of ATP levels and neurobehavioral scores (Modified Garcia score and Beam Balance score) at 24h after SAH (both P < 0.05, SAH+PACAP38+DMSO group vs SAH+PBS+DMSO group, Figure 4A–C). However, both SQ22536 and U0126 abolished the effects of PACAP38 treatments on ATP levels and neurobehavioral protection at 24h after SAH (both P < 0.05, SAH+PACAP38+SQ22536/U0126 group ra SAH+PACAP38+DMSO group, Figure 4A–C).

Figure 4. AC/cAMP/PKA/ERK pathway involved in the anti-oxidative and anti-apoptotic effects of exogenous PACAP38 after SAH in rats treatment.

Figure 4.

Open in a new tab

A. Relative ATP level in ipsilateral brain hemisphere. B-C. Modified Garcia Score and Beam Balance score. D-E. Representative western blot bands and quantification of PACAP, cAMP, PKA, p-PKA, ERK, and p-ERK. F-G. Representative western blot bands and quantification of 4-HNE, Ac-SOD2, Bcl-2, Bax, and cleaved caspase-3 (CC3). n = 6 per group. *P < 0.05 versus Sham group, #P < 0.05 versus SAH + PBS + DMSO group, @ P < 0.05 versus SAH + PACAP38 + DMSO group. One-way ANOVA, Tukey’s post hoc test.

As shown in Figure 4D, E, the expression of PACAP and its downstream signaling protein levels of cAMP and pPKA/PKA was significantly upregulated at 24h after SAH (both P < 0.05, SAH+PBS+DMSO group vs Sham group). PACAP38 treatment further enhanced such upregulation (both P < 0.05, SAH+PACAP38+DMSO group vs SAH+PBS+DMSO group). The administration of AC inhibitor SQ22536 reversed the effects of PACAP38 treatment on protein levels of cAMP, pPKA/PKA, and pERK/ERK in SAH rats compared with the SAH+PACAP38+DMSO group (both P < 0.05). The ERK inhibitor U0126 only reversed the effects of PACAP38 treatment on protein levels of pERK/ERK levels (P < 0.05, compared to SAH+PACAP38+DMSO group) but not cAMP and pPKA/PKA in SAH rats.

Furthermore, the PACAP38 treatment significantly reduced mitochondria-mediated oxidative stress and apoptotic markers including 4-HNE, Ac-SOD2, Bax/Bcl-2, and cleaved-caspase 3 in SAH rats (P < 0.05, SAH+PACAP38+DMSO group vs SAH+PBS+DMSO group, Figure 4F, G). Consistently, both SQ22536 and U0126 abolished the anti-oxidative stress and anti-neuronal apoptosis effects of PACAP38 treatments in SAH rats (both P < 0.05, SAH+PACAP38+SQ22536/U0126 group vs SAH+PACAP38+DMSO group, Figure 4E, F).

3.6. Exogenous PACAP38 Attenuated Mitochondria-mediated Oxidative Stress and Neuronal Apoptosis via AC/cAMP/PKA/ERK Pathway in Primary Neuron Culture after Hemoglobin Stimulation

The ATP levels (Figure 5A) and cell viability quantified by the CCK-8 level (Figure 5B) were markedly lower in the Hb + PBS group than Control group (both P < 0.05), but were increased by PACAP treatment (both P < 0.05, Hb + PACAP38 group vs Hb + PBS group). In contrast, cell cytotoxicity quantified by the LDH release level (Figure 5C) was significantly greater in the Hb + PBS group (P < 0.05, compared to Control group), but were decreased in Hb + PACAP38 group (P < 0.05, compared to Hb + PBS group).

Figure 5. Exogenous PACAP38 treatment alleviated mitochondrial dysfunction-induced oxidative stress and neuronal apoptosis after Hb stimulation in primary neuron culture.

Figure 5.

Open in a new tab

A. Relative ATP level. B-C. Relative CCK-8 and LDH level. D. Representative dots plot and quantification of flow cytometry. PI(−)/Annexin V(−) represented surviving neurons. PI(−)/Annexin V(+) represented early apoptotic neurons. E-F. Representative western blot bands and quantification of PACAP, cAMP, PKA, p-PKA, ERK, p-ERK, 4-HNE, Ac-SOD2, Bcl-2, Bax and cleaved caspase-3 (CC3). Each experiment was repeated 3 times. *P < 0.05 versus Control group, #P < 0.05 versus Hb + PBS group. One-way ANOVA, Tukey’s post hoc test.

As shown in the Figure 5D, the proportion of surviving cells (PI−/Annexin V−) was significantly decreased in the Hb + PBS group (P < 0.05, compared to Control group), but was preserved in the Hb + PACAP38 group (P < 0.05, compared to Hb + PBS group). The proportion of early apoptotic neurons (PI-/Annexin V+) was significantly greater in the Hb + PBS group (P < 0.05, compared to Control group), but was significantly decreased in the Hb + PACAP38 group (P < 0.05, compared to Hb + PBS group).

The western blot showed that the PACAP38 treatment markedly increased the protein levels of cAMP, p-PKA/PKA, and p-ERK/ERK (both P < 0.05, compared to Control group, Figure 5E, F), but attenuated Hb-induced upregulations of oxidative stress-related proteins and apoptosis-related proteins including 4-HNE, Ac-SOD2, Bax/Bcl-2 and cleaved caspase-3 (both P < 0.05, compared to Hb + PBS group, Figure 5E, F).

In addition, the AC inhibitor, SQ22536, and ERK inhibitor U0126 significantly abolished PACAP38-involoved upregulation of ATP and cell viability (CCK-8 level) (Figure 6A, B), as well as downregulation of cytotoxicity (released LDH level) after Hb induction (both P < 0.05, Hb+PACAP38+SQ22536/U0126 group vs Hb+PACAP38+DMSO group) (Figure 6C).

Figure 6. AC/cAMP/PKA/ERK pathway involved in the exogenous PACAP38-mediated neuroprotection in primary neuron culture.

Figure 6.

Open in a new tab

A. Relative ATP level. B-C. Relative CCK-8 and LDH level. D-E. Representative western blot bands and quantification of PACAP, cAMP, PKA, p-PKA, ERK, p-ERK, 4-HNE, Ac-SOD2, Bcl-2, Bax, and cleaved caspase-3 (CC3). Each experiment repeated 3 times. *P < 0.05 versus Hb+PBS+DMSO group, #P < 0.05 versus Hb + PACAP38 + DMSO group, @ P < 0.05 versus SAH + PACAP38 + SQ22536 group. One-way ANOVA, Tukey’s post hoc test.

Besides, under the condition of Hb stimulation, the SQ22536 reversed PACAP38-mediated p-PKA/PKA and p-ERK/ERK upregulation (both P < 0.05, Hb+PACAP38+SQ22536 group vs Hb+PACAP38+DMSO group, Figure 6D, E). However, the U0126 only reversed PACAP38-mediated p-ERK/ERK upregulation (P < 0.05, Hb+PACAP38+U0126 group vs Hb+PACAP38+DMSO group, Figure 6D, E).

Both SQ22536 and U0126 abolished PACAP38-mediated downregulation of 4-HNE, Ac-SOD2, Bax/Bcl-2, and cleaved caspase-3 in the setting of Hb stimulation (both P < 0.05, Hb+PACAP38+SQ22536/U0126 group vs Hb+PACAP38+DMSO group, Figure 6D, E).

4. Discussion

Mitochondrial dysfunction contributes to the oxidative stress and apoptosis during the pathophysiological processes of EBI after SAH[5, 27]. In the present study, we investigated the effects of PACAP on the mitochondria-mediated oxidative stress and neuronal apoptosis after the experimental SAH in vivo and in vitro. The specific novel findings are as follows: 1) the knockout of endogenous brain PACAP by PACAP Knockout CRISPR exacerbated mitochondria-mediated oxidative stress and neuronal apoptosis, as well as neurological deficits at 24h after SAH in rats; 2) exogenous PACAP38 treatment attenuated mitochondria-mediated oxidative stress and neuronal apoptosis, as well as neurological deficits at 24h after SAH in rats; 3) exogenous PACAP38 treatment reduced neuronal degeneration in the ipsilateral cortex and hippocampus at 28d after SAH in rats; 4) activation of AC/cAMP/PKA/ERK pathway was involved in the anti-oxidative stress and anti-apoptosis effect of PACAP38 treatment after SAH in rats; 5) exogenous PACAP38 treatment reduced mitochondria-mediated oxidative stress and intrinsic apoptotic activation through the AC/cAMP/PKA/ERK pathway in Hb-stimulated primary neuron cultures.

PACAP, first discovered in the ovine hypothalamus in 1989[29], is widely distributed in the mammalian peripheral and CNS with diverse biological functions[9]. In addition to its physiological roles in the neuronal development[30], PACAP also exerted the neuroprotective effects in a variety of brain injury[31]. According to the number of amino acids at the N-terminus, PACAP has two subtypes, namely, PACAP27 and PACAP38. Because PACAP38 is the predominant subtype in mammalian tissues[9], the majority of studies have explored PACAP-mediated neuroprotection via administration of exogenous PACAP38. The role of PACAP38 treatment in stroke was first evaluated by Uchida et al. in a rat transient global ischemia stroke model[13]. They demonstrated that exogenous PACAP38 administration by both i.c.v or i.p could significantly prevent neuronal death within the CA1 area after ischemia[13]. Following studies further provided evidence that exogenous PACAP38 could reduce the infarct area in rat models of transient middle carotid artery occlusion (MCAO)[32] and permanent MCAO[33]. However, few studies have investigated the role of PACAP in hemorrhagic stroke.

Previous clinical studies revealed that higher plasma PACAP levels are associated with benign clinical course and better long-term prognosis in patients with SAH and intracerebral hemorrhage, which highlight the potential neuroprotection of endogenous PACAP in hemorrhagic stroke[34, 35]. Nonetheless, our early study was known as the only study for investigating the underlying mechanism of PACAP-mediated neuroprotection after SAH. We first demonstrated that both endogenous and exogenous PACAP could alleviate acute cerebral edema formation by protecting the blood-brain barrier and glymphatic system function in a rat model of SAH[17]. In the present study we further investigated the role of endogenous PACAP and the effects of exogenous PACAP38 treatment in the mitochondrial dysfunction-mediated oxidative stress and neuronal death after SAH. Mitochondria is the subcellular organelle responsible for cellular energy metabolism and reactive oxygen species production[6]. Mitochondrial damage initiates immediately and lasts for the entire process of EBI after SAH[36], which leads to decreased ATP production, increased mitochondria ROS burden, and the activation of the intrinsic apoptosis pathway[7]. Our results showed that CRISPR knockout of brain endogenous PACAP exacerbated ATP reduction, DNA damage associated oxidative stress, mitochondrial superoxide accumulation, as well as intrinsic caspase-3 dependent apoptosis in rats at 24h after SAH in vivo or hemoglobin-stimulated primary neurons in vitro. The exogenous PACAP38 treatment improved the mitochondrial dysfunction and neuronal survival after SAH.

To be noted, PACAP38 has been shown to attenuate both oxidative stress and apoptosis in several neural cell lines, including cerebellar granule neurons[37], astrocytes[15], and endothelial cells[16]. Incubation of cerebellar granule cells with PACAP38 inhibited hydrogen peroxide-evoked oxidative stress and neuronal apoptosis via facilitation of selective receptor, PAC1, and the ERK axis[37]. PACAP38 also inhibited hydrogen peroxide-induced ROS accumulation and prevent inhibition of endogenous mitochondrial antioxidant enzyme, SOD, and catalase activities in astrocyte cell lines[15]. Besides, PACAP38 preserved mitochondrial membrane integrity and reduced caspase-3 activation by activating the PAC1, PKA, and ERK axis[15]. The PACAP38 also exerted potent anti-oxidative stress and anti-apoptosis effects through the PAC1/ERK signaling pathway in mouse hemangioendothelioma cells[16]. Exogenous PACAP38 treatment could prevent oxidative DNA stress and neuronal apoptosis in a rat model of global brain ischemia[20]. While we did not investigate the role of PAC1 in this study, we previously found that PAC1 was expressed on neurons, astrocytes, and endothelial cells at 24h after SAH. Additionally, inhibition of PAC1 markedly abolished PACAP38-mediated BBB/glymphatic protection [17].

PACAP is a potent stimulator of AC, which promotes cAMP accumulation and gene expression. The AC/cAMP/PKA was the classical down-stream signaling pathway of PACAP. The pPKA could directly promote the transcriptions of several cell survival genes, such as cAMP-response element binding protein, janus kinase, signal transducer and activator of transcription 3, and transforming growth factor beta[9]. However, the PACAP-activated AC/cAMP/PKA signaling also enhanced mitogen-activated protein kinase (MAPK) activation to subsequently promote the cyclic AMP response element-binding protein (CREB) transcription to improve cell viability[38]. Both the cAMP/PKA and MAPK pathways protected mitochondrial function under stress[39, 40]. The PACAP-mediated anti-oxidative stress and anti-apoptosis effects were abolished by the inhibitors of the cAMP/PKA pathway or MAPK pathway in vitro[15, 16, 37]. In the current study, either AC inhibitor SQ22536 or ERK inhibitor U0126, abolished the PACAP38-mediated mitochondrial protection in SAH rats and hemoglobin stimulated neuronal culture. While the inhibition of AC downregulated pERK levels in PACAP38 treated SAH rats or hemoglobin stimulated neurons, the inhibition of ERK phosphorylation did not affect the protein levels of cAMP or pPKA. These findings suggested that PACAP38 treatment could activate AC/cAMP/PKA signaling and further facilitate ERK phosphorylation and attenuate mitochondrial dysfunction in the setting of SAH in vivo and in vitro.

There are several limitations in this study. First, we applied the PACAP Knockout CRISPR for genetic knockout of brain PACAP in this study. A transgenic animal model is needed to further validate our findings. Second, we only focus on the AC/cAMP/PKA/ERK axis as underlying mechanism of the neuroprotection provided by PACAP 38 after SAH. Other molecular signaling pathways associated with PACAP 38 benefits cannot be excluded. Lastly, the gender difference was not evaluated in the current study.

5. Conclusions

Endogenous PACAP plays a critical role in protecting mitochondrial function after SAH in rats. Administration of exogenous PACAP38 attenuated mitochondria-mediated oxidative stress and neuronal apoptosis through the AC/cAMP/PKA/ERK signaling pathway in SAH rats in vivo and hemoglobin-stimulated primary neuron in vitro. Thus, exogenous PACAP38 may serve as a potential new treatment for alleviating EBI after SAH.

Supplementary Material

2
3

Highlight.

  1. Knockout of PACAP exacerbated oxidative stress and neuronal apoptosis after SAH

  2. PACAP38 treatment attenuated oxidative stress and neuronal apoptosis after SAH

  3. PACAP38 treatment improved neurological function after SAH

  4. AC/cAMP/PKA/ERK axis was involved in the neuroprotection of PACAP38 treatment

Acknowledgments

Source of Funding:

This study was supported by grants from the National Institutes of Health (NS081740 and NS082184) of John H. Zhang, and National Natural Science Foundation of China (81870916, 81871107 and 81971097) of Jianmin Zhang, Sheng Chen and Jun Yu, respectively.

Footnotes

Conflict of Interest:

The authors declare no conflict of interest concerning the materials used in this study or findings specified in this paper.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Reference

  • [1].Macdonald RL, Schweizer TA, Spontaneous subarachnoid haemorrhage, Lancet 389(10069)(2017) 655–666. [DOI] [PubMed] [Google Scholar]
  • [2].Fujii M, Yan J, Rolland WB, Soejima Y, Caner B, Zhang JH, Early brain injury, an evolving frontier in subarachnoid hemorrhage research, Transl Stroke Res 4(4) (2013) 432–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Zuo G, Zhang T, Huang L, Araujo C, Peng J, Travis Z, Okada T, Ocak U, Zhang G, Tang J, Lu X, Zhang JH, Activation of TGR5 with INT-777 attenuates oxidative stress and neuronal apoptosis via cAMP/PKCepsilon/ALDH2 pathway after subarachnoid hemorrhage in rats, Free Radic Biol Med 143 (2019) 441–453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [4].Mo J, Enkhjargal B, Travis ZD, Zhou K, Wu P, Zhang G, Zhu Q, Zhang T, Peng J, Xu W, Ocak U, Chen Y, Tang J, Zhang J, Zhang JH, AVE 0991 attenuates oxidative stress and neuronal apoptosis via Mas/PKA/CREB/UCP-2 pathway after subarachnoid hemorrhage in rats, Redox Biol 20 (2019) 75–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [5].Xu W, Yan J, Ocak U, Lenahan C, Shao A, Tang J, Zhang J, Zhang JH, Melanocortin 1 receptor attenuates early brain injury following subarachnoid hemorrhage by controlling mitochondrial metabolism via AMPK/SIRT1/PGC-1alpha pathway in rats, Theranostics 11(2) (2021) 522–539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Hoffmann L, Rust MB, Culmsee C, Actin(g) on mitochondria - a role for cofilin1 in neuronal cell death pathways, Biol Chem 400(9) (2019) 1089–1097. [DOI] [PubMed] [Google Scholar]
  • [7].Norat P, Soldozy S, Sokolowski JD, Gorick CM, Kumar JS, Chae Y, Yagmurlu K, Prada F, Walker M, Levitt MR, Price RJ, Tvrdik P, Kalani MYS, Mitochondrial dysfunction in neurological disorders: Exploring mitochondrial transplantation, NPJ Regen Med 5(1) (2020) 22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8].Park JH, Lo EH, Hayakawa K, Endoplasmic Reticulum Interaction Supports Energy Production and Redox Homeostasis in Mitochondria Released from Astrocytes, Transl Stroke Res (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [9].Fang Y, Ren R, Shi H, Huang L, Lenahan C, Lu Q, Tang L, Huang Y, Tang J, Zhang J, Zhang JH, Pituitary Adenylate Cyclase-Activating Polypeptide: A Promising Neuroprotective Peptide in Stroke, Aging Dis 11(6) (2020) 1496–1512. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10].Tan YV, Waschek JA, Targeting VIP and PACAP receptor signalling: new therapeutic strategies in multiple sclerosis, ASN Neuro 3(4) (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Kaiser EA, Russo AF, CGRP and migraine: could PACAP play a role too?, Neuropeptides 47(6) (2013) 451–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Toth D, Tamas A, Reglodi D, The Neuroprotective and Biomarker Potential of PACAP in Human Traumatic Brain Injury, Int J Mol Sci 21(3) (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Uchida D, Arimura A, Somogyvari-Vigh A, Shioda S, Banks WA, Prevention of ischemia-induced death of hippocampal neurons by pituitary adenylate cyclase activating polypeptide, Brain Res 736(1–2) (1996) 280–6. [DOI] [PubMed] [Google Scholar]
  • [14].Cheng HH, Ye H, Peng RP, Deng J, Ding Y, Inhibition of retinal ganglion cell apoptosis: regulation of mitochondrial function by PACAP, Neural Regen Res 13(5) (2018) 923–929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15].Douiri S, Bahdoudi S, Hamdi Y, Cubi R, Basille M, Fournier A, Vaudry H, Tonon MC, Amri M, Vaudry D, Masmoudi-Kouki O, Involvement of endogenous antioxidant systems in the protective activity of pituitary adenylate cyclase-activating polypeptide against hydrogen peroxide-induced oxidative damages in cultured rat astrocytes, J Neurochem 137(6) (2016) 913–30. [DOI] [PubMed] [Google Scholar]
  • [16].Racz B, Gasz B, Borsiczky B, Gallyas F Jr., Tamas A, Jozsa R, Lubics A, Kiss P, Roth E, Ferencz A, Toth G, Hegyi O, Wittmann I, Lengvari I, Somogyvari-Vigh A, Reglodi D, Protective effects of pituitary adenylate cyclase activating polypeptide in endothelial cells against oxidative stress-induced apoptosis, Gen Comp Endocrinol 153(1–3) (2007) 115–23. [DOI] [PubMed] [Google Scholar]
  • [17].Fang Y, Shi H, Ren R, Huang L, Okada T, Lenahan C, Gamdzyk M, Travis ZD, Lu Q, Tang L, Huang Y, Zhou K, Tang J, Zhang J, Zhang JH, Pituitary Adenylate Cyclase-Activating Polypeptide Attenuates Brain Edema by Protecting Blood-Brain Barrier and Glymphatic System After Subarachnoid Hemorrhage in Rats, Neurotherapeutics 17(4) (2020) 1954–1972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Yuan B, Zhou XM, You ZQ, Xu WD, Fan JM, Chen SJ, Han YL, Wu Q, Zhang X, Inhibition of AIM2 inflammasome activation alleviates GSDMD-induced pyroptosis in early brain injury after subarachnoid haemorrhage, Cell Death Dis 11(1) (2020) 76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Zille M, Karuppagounder SS, Chen Y, Gough PJ, Bertin J, Finger J, Milner TA, Jonas EA, Ratan RR, Neuronal Death After Hemorrhagic Stroke In Vitro and In Vivo Shares Features of Ferroptosis and Necroptosis, Stroke 48(4) (2017) 1033–1043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Stetler RA, Gao Y, Zukin RS, Vosler PS, Zhang L, Zhang F, Cao G, Bennett MV, Chen J, Apurinic/apyrimidinic endonuclease APE1 is required for PACAP-induced neuroprotection against global cerebral ischemia, Proc Natl Acad Sci U S A 107(7) (2010) 3204–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21].Sugawara T, Ayer R, Jadhav V, Zhang JH, A new grading system evaluating bleeding scale in filament perforation subarachnoid hemorrhage rat model, J Neurosci Methods 167(2) (2008) 327–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Fang Y, Lu J, Wang X, Wu H, Mei S, Zheng J, Xu S, Lenahan C, Chen S, Zhang J, Hong Y, HIF-1alpha Mediates TRAIL-Induced Neuronal Apoptosis via Regulating DcR1 Expression Following Traumatic Brain Injury, Front Cell Neurosci 14 (2020) 192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Zheng J, Shi L, Liang F, Xu W, Li T, Gao L, Sun Z, Yu J, Zhang J, Sirt3 Ameliorates Oxidative Stress and Mitochondrial Dysfunction After Intracerebral Hemorrhage in Diabetic Rats, Front Neurosci 12 (2018) 414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Luo Y, Fang Y, Kang R, Lenahan C, Gamdzyk M, Zhang Z, Okada T, Tang J, Chen S, Zhang JH, Inhibition of EZH2 (Enhancer of Zeste Homolog 2) Attenuates Neuroinflammation via H3k27me3/SOCS3/TRAF6/NF-kappaB (Trimethylation of Histone 3 Lysine 27/Suppressor of Cytokine Signaling 3/Tumor Necrosis Factor Receptor Family 6/Nuclear Factor-kappaB) in a Rat Model of Subarachnoid Hemorrhage, Stroke 51(11) (2020) 3320–3331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [25].Wu X, Luo J, Liu H, Cui W, Guo K, Zhao L, Bai H, Guo W, Guo H, Feng D, Qu Y, Recombinant Adiponectin Peptide Ameliorates Brain Injury Following Intracerebral Hemorrhage by Suppressing Astrocyte-Derived Inflammation via the Inhibition of Drp1-Mediated Mitochondrial Fission, Transl Stroke Res 11(5) (2020) 924–939. [DOI] [PubMed] [Google Scholar]
  • [26].Zong X, Dong Y, Li Y, Yang L, Li Y, Yang B, Tucker L, Zhao N, Brann DW, Yan X, Hu S, Zhang Q, Beneficial Effects of Theta-Burst Transcranial Magnetic Stimulation on Stroke Injury via Improving Neuronal Microenvironment and Mitochondrial Integrity, Transl Stroke Res 11(3) (2020) 450–467. [DOI] [PubMed] [Google Scholar]
  • [27].Huang Y, Guo Y, Huang L, Fang Y, Li D, Liu R, Lu Q, Ren R, Tang L, Lian L, Hu Y, Tang J, Chen G, Zhang JH, Kisspeptin-54 attenuates oxidative stress and neuronal apoptosis in early brain injury after subarachnoid hemorrhage in rats via GPR54/ARRB2/AKT/GSK3beta signaling pathway, Free Radic Biol Med 171 (2021) 99–111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Liu Y, Hu XB, Zhang LZ, Wang Z, Fu R, Knockdown of Arginyl-tRNA Synthetase Attenuates Ischemia-Induced Cerebral Cortex Injury in Rats After Middle Cerebral Artery Occlusion, Transl Stroke Res 12(1) (2021) 147–163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Cardoso JCR, Garcia MG, Power DM, Tracing the Origins of the Pituitary Adenylate-Cyclase Activating Polypeptide (PACAP), Front Neurosci 14 (2020) 366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].Rivnyak A, Kiss P, Tamas A, Balogh D, Reglodi D, Review on PACAP-Induced Transcriptomic and Proteomic Changes in Neuronal Development and Repair, Int J Mol Sci 19(4) (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [31].Reglodi D, Tamas A, Jungling A, Vaczy A, Rivnyak A, Fulop BD, Szabo E, Lubics A, Atlasz T, Protective effects of pituitary adenylate cyclase activating polypeptide against neurotoxic agents, Neurotoxicology 66 (2018) 185–194. [DOI] [PubMed] [Google Scholar]
  • [32].Lazarovici P, Cohen G, Arien-Zakay H, Chen J, Zhang C, Chopp M, Jiang H, Multimodal neuroprotection induced by PACAP38 in oxygen-glucose deprivation and middle cerebral artery occlusion stroke models, J Mol Neurosci 48(3) (2012) 526–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Reglodi D, Somogyvari-Vigh A, Vigh S, Maderdrut JL, Arimura A, Neuroprotective effects of PACAP38 in a rat model of transient focal ischemia under various experimental conditions, Ann N Y Acad Sci 921 (2000) 119–28. [DOI] [PubMed] [Google Scholar]
  • [34].Jiang L, Wang WH, Dong XQ, Yu WH, Du Q, Yang DB, Wang H, Shen YF, The change of plasma pituitary adenylate cyclase-activating polypeptide levels after aneurysmal subarachnoid hemorrhage, Acta Neurol Scand 134(2) (2016) 131–9. [DOI] [PubMed] [Google Scholar]
  • [35].Ma BQ, Zhang M, Ba L, Plasma pituitary adenylate cyclase-activating polypeptide concentrations and mortality after acute spontaneous basal ganglia hemorrhage, Clin Chim Acta 439 (2015) 102–6. [DOI] [PubMed] [Google Scholar]
  • [36].Sun JY, Zhao SJ, Wang HB, Hou YJ, Mi QJ, Yang MF, Yuan H, Ni QB, Sun BL, Zhang ZY, Ifenprodil Improves Long-Term Neurologic Deficits Through Antagonizing Glutamate-Induced Excitotoxicity After Experimental Subarachnoid Hemorrhage, Transl Stroke Res (2021). [DOI] [PubMed] [Google Scholar]
  • [37].Vaudry D, Pamantung TF, Basille M, Rousselle C, Fournier A, Vaudry H, Beauvillain JC, Gonzalez BJ, PACAP protects cerebellar granule neurons against oxidative stress-induced apoptosis, Eur J Neurosci 15(9) (2002) 1451–60. [DOI] [PubMed] [Google Scholar]
  • [38].Vaudry D, Falluel-Morel A, Bourgault S, Basille M, Burel D, Wurtz O, Fournier A, Chow BK, Hashimoto H, Galas L, Vaudry H, Pituitary adenylate cyclase-activating polypeptide and its receptors: 20 years after the discovery, Pharmacol Rev 61(3) (2009) 283–357. [DOI] [PubMed] [Google Scholar]
  • [39].Valsecchi F, Ramos-Espiritu LS, Buck J, Levin LR, Manfredi G, cAMP and mitochondria, Physiology (Bethesda) 28(3) (2013) 199–209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [40].Javadov S, Jang S, Agostini B, Crosstalk between mitogen-activated protein kinases and mitochondria in cardiac diseases: therapeutic perspectives, Pharmacol Ther 144(2) (2014) 202–25. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

2
NIHMS1734118-supplement-2.tiff (1.8MB, tiff)
3
NIHMS1734118-supplement-3.docx (16.2KB, docx)

RESOURCES