Expression profiling of rosmarinic acid biosynthetic genes and some physiological responses from Mentha piperita L. under salinity and heat stress

Abstract

Peppermint is of great economic importance, mainly due to its valuable essential oils. The present study aimed to compare the expression level of genes coding for proteins involved in the rosmarinic acid biosynthesis pathway and some physiological responses in peppermint under three levels of salinity (0, 60 and 120 mM) and two levels of thermal stresses (at 25 °C, optimal plant heat, and 35 °C, for thermal stress). The results showed that salinity at 25 °C resulted in an increased relative level of phenolic compounds, proline and antioxidant activity by 1.88, 1.92 and 2.58 times after 72 h respectively at salinity of 120 mM. Rosmarinic acid as well as soluble sugar, chlorophyll and K⁺/N⁺ ratio showed a decreasing trend by 3.2, 1.8, 4.6 and 9 times after 72 h respectively at salinity of 120 mM at 35 °C. Gene expression analysis showed a significant increase in HPPR and C4H expression and a significant decrease in RAS expression in plants subjected to simultaneous stresses. The higher levels of C4H and HPPR expression indicate the roles of these genes in defense processes and the effects of phenolic compounds in inhibiting oxidative stress. Our results may help increase knowledge about the stress-dependent alterations in gene expression profiles and physiological patterns in plants. This information may be used for medicinal plant improvement programs aimed at increasing rosmarinic acid production.

Introduction

Peppermint (Mentha piperita L.) is a perennial herbaceous plant which belongs to Lamiaceae family, originated from the cross between M. aquatica and M. spicata. This plant is known to be native to the Mediterranean region, but it is cultivated worldwide for spice, medicinal, and perfume productions (Afkar and Zand 2020). Peppermint essential oil is widely used as a component of food and cosmetic products. The last report of FAOSTAT on peppermint production, emphasize an increasing trend in the world peppermint production which, in 2020 was 48,437 tons, over 1.7-fold bigger than world production in 1990 (28,672 tons) (FAO 2020). Moreover, in the last 24 years, an increase of about 70% in the cultivated area was registered (Orolan et al. 2017). The major oil producing nations are Bulgaria, Italy, China, and the USA, which supplies nearly 90% of global peppermint oil production (Nayak, et al. 2020).

It is estimated that the total salinity affected area in the world is about 830 million hectares, but due to saline water and climate change, about 50% of arable land will face salinity problem (Munns and Tester 2008). Salinity stress is a common abiotic stress that affects the quality and yield of agricultural products. Plants respond to this stress by very different and complex physiological, genetic, biochemical, cellular, and molecular processes (Isayenkov and Maathuis 2019). As soon as intracellular changes are perceived, various signaling pathways are initiated to convert physical stress into an appropriate biochemical response which triggers the expression of a specific set of stress-responsive genes. The full activities of all these induced signaling cascades lead to plant adaptation and thus stress tolerance (Riyazuddin et al. 2020). Environmental stresses lead to the production of reactive oxygen species (ROS) that cause oxidative damage (Xie et al. 2019). Plants have antioxidant mechanisms to reduce damages by reactive oxygen species. Fathi et al. (2020) showed that the application of growth regulators under salinity moderated the negative effects of salinity in Mentha piperita by increasing the synthesis of antioxidant enzymes and proline. The use of modern omics has become significantly important for the identification and characterization of new secondary metabolites, transcriptomics, genomics and proteomics of medicinal plants (Miransari et al. 2021). The signaling compound crosstalk such as gasotransmitters (nitric oxide (NO), hydrogen sulfide (H2S), hydrogen peroxide (H₂O₂), calcium (Ca²⁺), reactive oxygen species (ROS)) and plant growth regulators (auxin, ethylene, abscisic acid, and salicylic acid) have a decisive role in regulating plant stress signaling and (Singhal et al. 2021). Moreover, recent significant progresses in omics techniques (transcriptomics, genomics, proteomics, and metabolomics) have helped to reinforce the deep understanding of molecular insight for multiple stress tolerance. In a review article, Singhal et al. (2021) discussed in detail the crucial cell signaling compounds crosstalk and integrative multi-omics techniques for salinity stress tolerance in plants.

The main active compounds of peppermint are due to the presence of menthone, isomenthone, and different isomers of menthol (Alankar 2009), flavonoid glycoside, polyphenols (e.g. rosmaric acid, cinamic acid, caffeic acid), luteolin-diglucoronide and eriodictyol glucopyranosyl-rhamnopyranoside (Areias et al. 2001). Polyphenols compounds constitute a large group of plant secondary metabolites with very diverse structures. Rosmarinic acid is a major phenolic compound with a high medicinal value in various plant species that has several biological activities including antiviral, antibacterial, antioxidant, anti-allergic, anti-inflammatory, and anti-cancer activities (Messeha et al. 2020). Its chemical compositions consists of an ester with caffeic acid and 3,4-dihydroxyphenyl lactic acid produced in plants through the biosynthetic pathway for phenylpropanoid. Tyrosine and phenylalanine amino acids are the substrates of this biosynthetic pathway, and tyrosine aminotransferase and phenylalanine ammonia lyase are the primary enzymes catalyzing this pathway, and finally, Cinnamic acid 4-hydroxylase (C4H), Hydroxyphenylpyruvate reductase (HPPR), and rosmarinic acid synthase (RAS) enzymes lead to the synthesis of rosmarinic acid (Guo-Quan et al. 2017, Li et al. 2019).

As plants have potential to change the expression patterns of their genes in response to environmental stresses, molecular studies can help increase knowledge about the induction of tolerance mechanisms (Gull et al. 2019). Many agricultural lands are affected by salinity stress in arid and semi-arid regions. In these regions, the effect of salinity is intensified by high temperatures. Therefore, it is very important to study the response of plants to combination of salinity and heat stress. We aimed: (1), to evaluate the effects of salinity, heat and combined stress on rosmarinic acid induction in different time interval in peppermint (2), to compare the expression level of genes coding for proteins involved in the rosmarinic acid biosynthesis pathway and (3), to investigate some biochemical mechanisms involved in salinity and heat tolerance in peppermint.

Materials and methods

Plant material and growing conditions

Peppermint seedlings (from rhizome of equal size and diameter) were provided from Pakan Bazr Company (Isfahan, Iran). The seedlings were transferred to plastic pots with a diameter of 20 cm and a height of 30 cm filled with a mixture of garden soil, sand, manure and vermicompost in a ratio of 1:1:1:2, respectively. Based on manufacturer (Isfahan organic fertilizer factory, Iran) vermicompost had the following characteristics: Organic matter, 28.3%; total N, 2.4%; pH, 7.7; P, Fe, Mn and Cu equal to 3.2, 5.3, 0.2 and 0.1 mg g-1 respectively. Some characteristics of soil used in pots are shown in Table 1. Healthy seedlings at the same sizes were kept in a greenhouse with 16 h of light and 8 h of darkness at 25 ± 2 °C and humidity of 60%, and irrigated every other day before stress treatments.

Table 1.

Some characteristics of soil used in the pots

Clay (%)	Silt (%)	Sand (%)	pH	EC (ds m−1)	OC (g kg−1)	N (g kg−1)	P (mg kg−1)	Ca (mg kg−1)	Mg (mg kg−1)	Fe (mg kg−1)	Zn (mg kg−1)
8	19	73	7.2	1.9	6.4	0.4	15.8	15.6	8.4	8.5	1

Salinity and heat stresses

After the growth of peppermint seedlings to a height of 10–12 cm and 10–15 leaves (2 months old), salinity stress was applied to the seedlings at two levels of 60 and 120 mM of sodium chloride (tap water with salinity of 5 mM as a control) and heat stress at 35 °C (25 °C as an optimal conditions). Salinity stress was applied by irrigating the pots with 200 ml of corresponding solutions, and the pots were placed in growth chambers at 25 °C and 35 °C (Fathi et al. 2020). To prevent shock to the plants, salinity treatments were applied gradually. In order to ensure the desired salinity level, the salinity of the springlet of pots was measured once a week, and in case of excessive increase in the desired salinity level, leaching with water was performed. Leaves sampling occurred at 24, 48, and 72 h post treatments and they were kept at − 80 °C to measure their amounts of phenolic compounds, proline, DPPH radical scavenging capacity, rosmarinic acid, total sugar, chlorophyll and potassium to sodium ratio and to evaluate expression levels of genes involved in the synthesis of rosmarinic acid.

Physiological traits

Phenolic compounds

The total phenol content was determined based on Folin-Ciocalteu reagent method (Hayouni et al. 2007). The sample absorbance was measured at 760 nm by a spectrophotometer (Analytik 210, Germany) and compared with gallic acid equivalents calibration curve.

DPPH radical scavenging capacity

The DPPH radical scavenging capacity was determined based on the method of Barros et al. (2007). The percentage of DPPH radical inhibition was measured using the equation I% = (A_blank − A_sample/A_blank) × 100. The blank sample contained 3 ml of 85% methanol with leaf sample without DPPH solution. The sample absorbance was measured at 520 nm using a spectrophotometer.

Proline

Total proline was measured based on the method of Bates et al. (1973). The sample absorbance was measured at 520 nm by a spectrophotometer.

Rosmarinic acid

Concentrations of 1, 6, 30, 60, 120, and 240 mg/l of rosmarinic acid were prepared in acetonitrile solvent and the retention time and area under their peak by direct injection of 20 μl of it into a high-performance liquid chromatography (HPLC) device (Agilent 1100 Series, equipped with a four-solvent gradient pump with a photodiode detector, column C₁₈, 30 cm) were determined. Leaf tissue samples were powdered in the presence of liquid nitrogen. Two milliliters of 1% acetic acid was added to 0.1 g of powdered tissue and transferred to an ultrasonic device (Euronda, Italy). The samples centrifuged at 10,000 g for five minutes and injected 20 µl of the supernatant into the HPLC device after passing through the filter. The areas under the peak of chromatograms of leaf samples were calculated and placed in the calibration equation, and the concentration of rosmarinic acid was calculated in leaf samples in µg/mg DW (Adham 2015).

Ratio of potassium to sodium

The leaf tissue samples were digested in a mixture of HNO₃:HClO₄ (4:1) based on the method of Waling et al. (1989). The concentration of Sodium and potassium were analyzed using the flame photometer (Jenway, England).

Total sugar

Total sugar was measured based on the method of Kochert (1987). The sample absorbance was measured at 485 nm by a spectrophotometer (Analytik jena 210, Germany) and the sugar contents in peppermint seedlings calculated using the standard glucose curve.

Chlorophyll content

The fresh tissue of the plant leaves was grounded in the presence of 2 ml of 80% acetone in a porcelain mortar and then passed through the filter paper. The absorbance of the solution was measured simultaneously at two different wavelengths, 663 nm for chlorophyll a and 645 nm for chlorophyll b and chlorophyll contents was calculated by following equations (Lichtenthaler and Wellburn 1983).

$$\text{Chlorophyll}\text{a}=\left(19.3\times {\text{A}}_{663\text{nm}}-0.86\times {\text{A}}_{645\text{nm}}\right)\text{V}/100\text{w}$$ 1

$$\text{Chlorophyll}\text{b}=\left(19.3\times {\text{A}}_{645\text{nm}}-3.6\times {\text{A}}_{663\text{nm}}\right)\text{V}/100\text{w}$$ 2

$$\text{Total}\text{chlorophyll}=\text{Chlorophyll}\text{a}+\text{Chlorophyll}\text{b}$$ 3

RNA extraction and real-time PCR

The RNA extraction was performed using the BioFACT™ Total RNA Prep kit (South Korea) according to the instructions provided by the manufacturer. The quality and quantity of the RNA was determined using a NanoDrop Spectrophotometer (Implen, NP80, Germany). To remove DNA, 5 μg of RNA was treated with 1 μl of DNase I (20 U/μl) at 37 °C for 30 min, and then incubated with 1 μl of EDTA (50 mM) at 65 °C for 10 min. The synthesis of cDNA was performed using the BioFACT™ RT Series kit (South Korea) according to the instructions provided by the manufacturer.

Primers for Cinnamic acid 4-hydroxylase (C4H), Hydroxyphenylpyruvate reductase (HPPR), and actin genes were designed based on the sequences previously identified in peppermint using OligoArchitect™ program (www.oligoarchitect.com). Since there were no sequence information available for rosmarinic acid synthase (RAS) gene in the GenBank for peppermint, we designed the gene primers based on the conserved areas by the BLASTn alignment (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch) of the sequences were introduced for the RAS gene in other plant species (Table 2. The RAS sequence of Salvia miltiorrhiza (Lamiaceae) was used as the blast query. We evaluated the primer annealing temperature in PCR and optimized the performance of all primers at an annealing temperature of 60 °C (Table 3).

Table 2.

The top 10 hits of BLASTn results for the Rosmarinic acid synthase (RAS) gene using the Salvia miltiorrhiza’s RAS sequence as the blast query

No.	Description	Query cover (%)	E-value	Percent identity (%)	Accession number (GenBank)
1	Salvia miltiorrhiza rosmarinic acid synthase (RAS) mRNA, complete cds	100	0.0	100	KM575933.1
2	Salvia miltiorrhiza rosmarinic acid synthase mRNA, complete cds	100	0.0	99.53	FJ906696.1
3	Melissa officinalis ras gene for hydroxycinnamoyl-CoA:hydroxyphenyllactate hydroxycinnamoyltransferase	100	0.0	88.33	FR670523.1
4	PREDICTED: Salvia splendens rosmarinate synthase-like (LOC121753299), mRNA	99	0.0	87.64	XM_042148552.1
5	PREDICTED: Salvia splendens rosmarinate synthase (LOC121747317), mRNA	99	0.0	87.64	XM_042141335.1
6	Glechoma hederacea mRNA for hydroxycinnamoyl-CoA:hydroxyphenyllactate hydroxycinnamoyltransferase 1 (ras1 gene)	99	0.0	85.14	HG423394.1
7	Ocimum tenuiflorum rosmarinic acid synthase mRNA, complete cds	100	0.0	83.44	MN542659.1
8	Solenostemon scutellarioides mRNA for hydroxycinnamoyl transferase (cbhct1 gene)	100	0.0	83.31	AM283092.1
9	Prunella vulgaris rosmarinic acid synthase mRNA, complete cds	99	0.0	81.35	KM053280.1
10	Glechoma hederacea mRNA for hydroxycinnamoyl-CoA:hydroxyphenyllactate hydroxycinnamoyltransferase 2 (ras2 gene)	91	0.0	84.47	HG423395.1

The accession number of the sequences in GenBnak database are provided

Table 3.

Sequences of gene-specific primer pairs used in Real-time PCR experiment

Gene		Sequence primer (5′………3′)	Accession number
HPPR	F	GGTTTCCAACACGCCCGATG	MG893899.1
	R	CCCACTCTTTTGCCACTGAACT
C4H	F	TGCCGTTCTTCACCAACAAGGTC	MH208308.2
	R	CCGCCTCAACACGATCCCAT
RAS	F	TTAGGCGTGGCAAACGAGCACCA	–
	R	CTGGTACTCGGAGTGGTTGAACT
Actin	F	CAAAGAGAAGCTGGCCTACAT	KR082011.1
	R	CAGCTCCGATAGTGATGACCT

The quantitative Polymerase Chain Reaction (qPCR) was performed using the BIOFACT™ 2X Real-Time PCR Master Mix (For SYBR Green I) mixture on an Applied Biosystems StepOne™ Real-time PCR detection system according to the instructions provided by the manufacturer. The mean values of three independent technical and two biological replicates per treatment, were used for normalization of expression data and the fold changes were calculated, using the comparative Ct (ΔΔCt) method. The actin gene was used as the reference gene for normalizing data. (Schmittgen and Livak 2008).

Statistical analysis

All experiments were performed in a completely randomized design in three replicates. The analysis of variance of data (using three-way ANOVA) and the comparison of means was done by Duncan's test using SPSS version 19 (SPSS Inc., Chicago, IL, USA).

Results

Physiological assessments

The ANOVA of physiological evaluations (Table 4) indicated that the temperature, salinity, time, and their interaction had significant effects on proline, rosmarinic acid, phenol, K⁺/Na⁺, total sugar, chlorophyll a, total chlorophyll and the DPPH radical scavenging capacity (P ≤ 0.01). Salinity × time interaction did not show significant effect on proline. Temperature and also salinity × temperature × time interaction did not show significant effect on chlorophyll b content.

Table 4.

Mean squares of analysis of variance for the relative expression level of genes

S.O.V	df	Mean square (M.S)
		Rosmarinic acid	Proline	K+/N+	Phenol	DPPH radical scavenging capacity	Total sugar	Chlorophyll a	Chlorophyll b	Total Chlorophyll
Heat (A)	1	15.585**	3.271**	2.834**	0.472**	375.778**	5711.363**	0.549**	0.000 ns	0.568**
Salinity (B)	2	804.830**	16.439**	269.120**	1.922**	531.169**	5974.225**	1.770**	0.062**	2.450**
Time (C)	2	90.424**	9.035**	2.944**	4.062**	578.987**	1598.354**	0.465**	0.006**	0.576**
Interaction A × B	2	90.923**	3.927**	0.863**	0.899**	21.648**	254.230**	0.231**	0.002**	0.224**
Interaction A × C	2	4.357**	14.338**	3.946**	1.185**	169.528**	130.595*	0.006*	0.002**	0.014*
Interaction B × C	4	50.012**	0.010ns	0.721**	1.257**	157.802**	292.870**	0.065**	0.001**	0.073**
Interaction A × B × C	4	18.594**	2.831**	1.523**	1.514**	46.813**	128.565*	0.010**	0.000ns	0.012*
Error	36	0.037	0.092	0.116	0.029	0.214	38.274	0.002	0.000	0.003

ns, *, ** not significant or significant at 5 or 1% probability level, df degree of freedom, C.V coefficient of variation

Proline

The results indicated that enhancing the salinity caused a significant increase in the amount of proline at 25 °C, so that the proline content raised by 2.3, 2.5, and 1.9 times after 24, 48, and 72 h respectively at salinity of 120 mM compared to the control (Fig. 3A). At 25 °C and salinity of 60 mM, the proline content increased after 48 h and then decreased significantly after 72 h. At 35 °C, proline content raised after 24 and 72 h in salinity of 60 and 120 mM but it was not happen for 48 h.

Fig. 3.

Mean comparison for the relative expression of C4H, HPPR and RAS genes at different temperature and salinity levels. Bars indicate standard errors. Different letters indicate a statistically significant difference at the 5% level

Rosmarinic acid

The results indicated that increasing salinity reduced significantly the amount of rosmarinic acid at both 25 °C and 35 °C (Fig. 3B). At 25 °C, increasing salinity reduced the amount of rosmarinic acid significantly compared to the control, and the process intensified over time only at salinity of 60 mM. The amount of rosmarinic acid was significantly reduced under salinity of 120 mM at 25 °C, by 11 times compared to the control after the 24 h and did not show significant changes over time. At 35 °C under control condition, the amount of rosmarinic acid during the first 24 h slightly decreased compared to 25 °C, but a significant decrease (2.6 times) was seen in rosmarinic acid after 48 h and it increased again after 72 h. At 35 °C, increasing the salinity level to 120 mM significantly reduced the amount of rosmarinic acid compared to the control and did not change after 48 h but significantly increased after 72 h (compared to 24 h).

K⁺/Na⁺ ratio

Results showed that applying salinity of 60 mM and 120 mM at 25 °C and 35 °C caused a significant reduction in the K⁺/Na⁺ in peppermint seedling (Fig. 3C). At 25 °C K⁺/Na⁺ decreased by 8.44, 10.37, and 9.35 times after 24, 48, and 72 h respectively in salinity of 60 mM compared to the control. At 35 °C under no salinity, a significant decrease was seen in the K⁺/Na⁺ after 24 and 72 h but it did not change in 48 h compared to 25 °C at 35 °C. Applying the salinity of 60 mM and 120 mM caused a significant reduction in the K⁺/Na⁺ in peppermint seedlings compared to the control. The lowest amount of K⁺/Na⁺ was measured in the salinity of 120 mM at 35 °C and it reduced over time after 72 h.

Phenol

At 25 °C, phenol content decreased at salinity of 60 mM after 24 h and it had an increasing trend over time, so that it caused an increase of 1.88 times after 72 h compared to the control (Fig. 3D). At the salinity level of 120 mM, a significant increase was seen in phenol at 48 h, but again it was decreased by 1.39 times after 72 h compared to the control. At 35 °C under control condition, there was a significant reduction in phenol contents compared to the same treatment at 25 °C. At 35 °C, applying a salinity level of 60 mM caused an increasing trend in the phenolic contents compared to the control and same treatment at 25 °C. The phenolic content was significantly increased in the salinity of 120 mM at 35 °C after 72 h.

DPPH radical scavenging capacity

The results indicated that enhancing the salinity at 25 °C caused a significant increase in DPPH radical scavenging capacity, so that it was increased by 1.8, 1.7, and 2.6 times after 24, 48, and 72 h respectively at salinity of 120 mM compared to the control. At 35 °C, the same increasing trend was observed in DPPH radical scavenging capacity at salinity of 120 mM compared to the control and to the same treatment at 25 °C. DPPH radical scavenging capacity was increased 4.4 and 4.7 times after 72 h in salinity levels of 60 mM and 120 mM respectively compared to the control (Fig. 3E).

Total sugar

The results showed that salinity stress at 25 °C significantly declined the amount of total sugar (Fig. 3F). The decreasing trend was higher at the higher salinity level over time, so that in salinity of 120 mM after 72 h led to a decrease of 2.6 times in the total sugar content compared to the control. The same decreasing trend was also seen at 35 °C, and increasing salinity significantly decreased total sugar in peppermint seedlings. At 35 °C, the amount of total sugar was declined by 1.7, 2.3, and 2.7 times after 24, 48, and 72 h respectively at salinity level of 120 mM compared to the control.

Chlorophyll content

Results showed that chlorophyll a and total chlorophyll (but not chlorophyll b) decreased at 35 °C in control compared to similar treatment at 25 °C (Fig. 3G–I). The amount of chlorophyll a and total chlorophyll declined (4.6 and 4.4 times less than the control respectively) after 72 h in salinity of 120 mM at 35 °C. Chlorophyll b also faced a significant reduction under salinity stress. The effect of salinity intensified over time in both 25 °C and 35 °C. The comparison of the corresponding treatments between 25 and 35 °C in no salinity conditions indicated a significant increase in chlorophyll b at the first 24 h.

Gene expression analysis

The analysis of variance for the expression of genes involved in the rosmarinic acid biosynthesis pathway indicated that the temperature × salinity × time interaction had significant effects on the expression of C4H, HPPR, and RAS genes (P ≤ 0.01) (Table 5). C4H expression at the salinity of 60 mM and 120 mM at 25 °C showed a significant increase (4.1 and 3.6 times respectively) after 24 h compared to the control (Fig. 2A), and the level of C4H expression decreased over time. At 35 °C, significant increase (2.8 times) was seen in the C4H expression level compared to 25 °C in all treatments. At this temperature, salinity levels of 60 mM and 120 mM after 24 h showed a significant increase in gene expression level (3.9 and 4.8 times respectively) compared to the control. Salinity of 60 mM and 120 mM at 35 °C significantly increased HPPR gene expression (Fig. 2B) after 24 h, while it decreased over time. Expression analysis of RAS gene (Fig. 2C) treated with salinity levels of 60 mM and 120 mM at 25 °C indicated a decreasing trend over time as compared to the control. At the temperature of 35 °C, the RAS expression significantly decreased compared to similar treatment at 25 °C over time.

Table 5.

Mean squares of analysis of variance for the relative expression level of genes

s.o.v	Mean square (M.S)
	DF	HPPR	C4H	RAS
Heat (A)	5	0.704**	1.688**	4.063**
HPT (B)	2	0.190**	0.590**	1.174**
Interaction A × B	10	0.065**	0.108**	0.277**
Error	36	0.011	0.020	0.030

HPT hours post treatment, HPPR (hydroxyphenylpyruvate reductase), C4H (Cinnamate-4-hydroxylase) and RAS (rosmarinic acid synthase), **Significant at 1% probability level, DF degree of freedom, CV coefficient of variation

Fig. 2.

Mean comparison for the proline, rosmarinic acid, phenol, sugar, chlorophyll a, b and total chlorophyll contents, K/Na ratio, and antioxidant activity at different temperature and salinity levels. Bars indicate standard errors. Different letters indicate a statistically significant difference at the 5% level

Discussion

Abiotic stresses negatively affect plant growth and productivity and are major causes of widespread agricultural losses worldwide (Amini Hajiabadi et al. 2021). Abiotic constraints, mainly salinity and heat stress, may work alone, but they often work together, and plants have developed adaptive and protective tools to deal with such combined adversities (Gull et al. 2019). The basic mechanisms of tolerance in plants include the activation of various genes regulated by stress through cellular and molecular responses (Isayenkov and Maathuis 2019). However, the physiological and metabolic responses of peppermint to combined effects of salinity and heat stresses have received no attention.

In the present study, the salinity stress decreased the K⁺/Na⁺ in the peppermint leaf. The plants under salinity stress suffer from nutritional imbalance and osmotic stress (Mosleh Arani et al. 2011). Due to their physicochemical similarities, potassium and sodium compete for transporters (Mosleh Arani et al. 2015). So that under salinity stress, the uptake of potassium is difficult for plants in the presence of sodium and eventually the K⁺/Na⁺ in the cell decreases. Mentha pulegium also faced accumulation of Na⁺ and reduction of K⁺ in leaves, stems, and roots, resulting in lower plant growth under salinity stress (Oueslati et al. 2010). At 35 °C, the K⁺/Na⁺ increased after 48 h (in the control and 60 ds/m) and again declined after 72 h. The alteration of K⁺/Na⁺ ratio in peppermint implying that maintaining Na⁺and K⁺ homeostasis may be especially significant for peppermint to deal with combined salinity/heat stress. Some plants can sustain the balance of ion homeostasis by enhancing the selective absorption of K⁺ and/or Na⁺ to resist adverse effects of stress (Hu et al. 2021; Urbanavičiūtė et al. 2021).

Results showed proline increased in all salinity levels at 35° C and 25° C. An important adaptive mechanism in most of plants is the biosynthesis of compatible osmolytes. Proline protects cells against ROS accumulation, facilitates water uptake and protects enzyme activity. (Isayenkov and Maathuis 2019). In the present study, proline content in peppermint under salinity and heat stress showed a decreasing trend over time after being increased in the early stages of the stress. Proline is an unstable amino acid that decomposes rapidly during the time and acts as a source of nitrogen (Wyse and Netto 2011). Abiotic stresses, especially combined stress such as salinity and heat have a greater impact on crop production. Alhaithloul et al. (2019) showed also accumulation of proline in response to drought and heat stress, with maximal accumulation observed in response to the combined drought and heat stress in peppermint.

The results showed that salinity stress decreased rosmarinic acid in peppermint. In accordance with our results Todorova et al. (2020) showed a significant decrease in rosmarinic acid in Salvia officinalis under salinity stress. They argued that salinity stress might affect the enzymes responsible for the phenolic metabolism. It was suggested that salinity stress may lead to partial suppression of phenolic biosynthesis enzymes or activation of polyphenol oxidases or peroxidases utilizing phenolic as co-substrates. At 35 °C under no salinity, the amount of rosmarinic acid decreased compared to 25 °C. Fletcher et al. (2005) also reported that heat stress affected negatively on total content of rosmarinic acid in Mentha spicata. The reduction of rosmarinic acid during heat stress may be due to either a decrease in the biosynthesis of rosmarinic acid or a rapid degradation process. Rosmarinic acid is synthesized from l-tyrosine and l-phenylalanine (Fig. 1). Rosmarinic acid synthase catalyzes the (R)-3,4-dihydroxyphenyl lactic acid and coumaroyl-CoA to form the rosmarinic acid precursor 4-coumaroyl-4′-hydroxyphenyllactate. Studies suggests that two distinct cytochrome P450 enzymes hydroxylate 4-coumaroyl-4′-hydroxyphenyllactate at the 3 and 3' positions to form rosmarinic acid (Petersen 1997). The 3'-hydroxylase has been shown to be sensitive to heat stress above 25° C in Coleus, whereas the 3-hydroxylase is not. The reduction of rosmarinic acid accumulation in peppermint grown under heat stress at 35° C may be caused by the failure of the temperature-sensitive 3'-hydroxylase to hydroxylate the 4'-hydroxyphenyllactate ring. The next enzymes upstream in rosmarinic acid biosynthesis are 4-hydroxyphenyllactic acid 4-coumaroyl transferase, tyrosine aminotransferase and hydroxyphenylpyruvate reductase. Three of these enzymes are heat-stable, with optimal enzyme activity at temperatures between 30° and 35° (40°) C. Therefore heat stress would not play a role in changing biological activity for these enzymes.

Fig. 1.

A brief scheme of the biosynthetic pathway for rosmarinic acid with some side reactions. The yellow box indicates the position of Rosmarinic acid. The blue arrows indicate enzymatic reactions. The red arrows show the enzymes of which the genes were selected for expression analysis in this study. PAL phenylalanine ammonia-lyase, C4H cinnamic acid 4-hydroxylase, 4CL 4-coumarate CoA ligase, TAT tyrosine aminotransferase, HPPR hydroxyphenylpyruvate reductase, HPPD hydroxyphenylpyruvate dioxygenase, RAS rosmarinic acid synthase

Another way to explain the loss of rosmarinic acid may lie in competing reactions. It is shown that plants catalyze 4-hydroxyphenylpyruvate to homogentisate via hydroxyphenylpyruvate dioxygenase (Fig. 1). This reaction is very important in plants, since homogentisate is the precursor to prenylquinones. Prenylquinones are important scavengers of reactive oxygen species particularly under stress conditions. Higher demand for prenylquinones during heat stress could lead to raised production of homogenistate, declining the available 4-hydroxyphenylpyruvate for rosmarinic acid production (Petersen 1997). This may also explain the lack of rosmarinic acid accumulation in peppermint.

The rosmarinic acid content significantly decreased by salinity and/or heat stress but its amount increased in response to combined stresses as compared to the corresponding optimal condition. Reports discussing the combined effects of salinity and heat stress on secondary metabolites specially rosmarinic acid is rare. In accordance with our results, Alhaithloul and et al. (2019) showed also that the combined effects of drought and heat stress declined the phenolic compounds (rosmarinic acid, ferulic, p-coumaric and caffeic) compared to the control but their amounts was significantly higher than drought or heat alone.

In contrast with rosmarinic acid, DPPH radical scavenging capacity and total phenol was increased after 72 h at salinity levels of 60 mM and 120 mM at 35 °C compared to the control. This finding implies that antioxidants were activated in peppermint during salinity stress to counteract any stressful factors. Pistelli et al. (2019) also showed that heat stress at 38° C significantly enhanced antioxidant capacity in Melissa officinalis L. Fathi et al. (2020) also showed that menthol contents were inhibited by salinity stress while salinity enhanced enzymatic antioxidant in peppermint.

In the present study, the effect of salinity treatment at both salinity levels (60 mM and 120 mM) and at 35 °C reduced the chlorophyll content and consequently reduced the total sugar content in peppermint seedlings. The evaluation of chlorophyll content is a tool for interpreting stress tolerance in plants. Plants under salinity stress usually produce large quantities of ROS, leading to chlorophyll degradation (Chrysargyris et al. 2019). This reduction may also be due to decreased absorption of K⁺, Mn²⁺, Fe⁺, P⁺ (Guo et al. 2020), decreased of 5-aminolaevulinic acid content and increased chlorophyllase enzyme activity (Oraei et al. 2009; Mosleh arani et al. 2018). The inhibition of photosynthesis by heat stress is interpreted as the inability to maintain RuBisCO in an active form (Sedaghatmehr et al. 2019, Wang et al. 2015). Various studies have reported decreasing levels of chlorophyll content under abiotic stresses. Chrysargyris et al. (2019) found that simultaneous application of salinity and toxicity of copper in Mentha spicata reduced the content of chlorophyll and total sugar. The effect of salinity stress on rice also indicated that increasing the salinity level up to 100 mM reduced the chlorophyll content (Liu et al. 2019). The reduction of chlorophyll content under salinity stress is mainly due to a decrease in Aminolevulinic acid (ALA) synthase, an enzyme that catalyzes the synthesis of di-aminolevulinic acid as the first common precursor in the biosynthesis of chlorophyll.

Gene expression analysis showed a significant increase in Cinnamic acid 4-hydroxylase (C4H), Hydroxyphenylpyruvate reductase (HPPR) expression and a significant decrease in rosmarinic acid synthase (RAS) expression in peppermint subjected to simultaneous stress. Rosmarinic acid as a defense compound can reduce oxidative damage and prevent cell death from free radicals (Fletcher et al. 2005; Pistelli et al. 2019). Biogenetic and molecular studies on Mentha and Coleus blumei proposes a biosynthesis pathway in which rosmarinic acid is built by 3,4-hydroxyphenyl lactic acid and 4-Cumaryl-CoA esters through controlling the expression of C4H, HPPR, and RAS genes. Li et al. (2017) evaluated transcriptome changes in six tissues of Dracocephalum tanguticum and reported that 22 genes, including four PAL genes, three C4H genes, five 4CL genes, three TAT genes, two HPPR genes, and five RAS genes were involved in the biosynthesis of rosmarinic acid. In accordance with our results, a higher level of C4H expression in Carthamus tinctorius under salinity stress, wound, and salicylic acid treatment after 6 h was reported (Sadeghi et al. 2013). Kim et al. (2013) also showed an increased in C4H expression at different growth stages of Hibiscus cannabinus under the wound, salinity, cold, H₂O₂, abscisic acid, and salicylic acid. Cheng et al. (2018) reported that C4H transcription in Ginkgo biloba increased by UV-B, cold, salicylic acid, and abscisic acid treatments, indicating a possible role of C4H in response to stress and hormonal signals. Huang et al. (2008) also reported the increasing trend of C4H under UV-B, jasmonic acid, and abscisic acid treatments in Salvia miltiorrhiza. Dewanjee et al. (2014) evaluated the impact of Aternaria alternata fungus on improving the production of rosmarinic acid and found that despite the accumulation of H₂O₂ and higher oxidative stress under pathogen stress, no significant change occurred in the RAS expression, while the HPPR expression slightly increased. Accumulation of rosmarinic acid and higher expression of PAL, TAT, and RAS genes in Melissa officinalis plants under treatment with different concentrations of abscisic acid was also reported (Mousavi and Shabani 2019). Moreover, in contrast with our results, Vafadar et al. (2020) reported a higher level of PAL and RAS expression in Dracocephalum kotschyi under salinity stress.

Transcriptome analysis of plants subjected to simultaneous salinity and heat combination is rare. Plants affected by simultaneous conditions of drought and heat combination demonstrated that this stress combination resulted in a new profile of transcript expression that could not be predicted by the study of each of the different stresses applied individually (Pandey et al. 2015). Transcriptomic studies in Arabidopsis thaliana plants under drought, heat and their combination indicated that this stress combination altered the expression of more than 770 unique transcripts, not altered by drought or heat stress applied individually, including those encoding different heat shock proteins (HSPs), several protein kinases, proteins involved in ROS detoxification, proteases and enzymes involved in lipid biosynthesis and starch degradation (Rizhsky et al. 2004). Tobacco plants subjected to a combination of drought and heat stress specifically up-regulated HSP coding transcripts and phenylalanine ammonia lyase (PAL) proteins (Rizhsky et al. 2002). More study needs in crosstalk mechanisms of signaling compounds, and omics technology for understanding salinity stress tolerance and increasing the production of medicinal plants in saline fields.

Conclusions

It is concluded that heat stress intensified the effects of salinity in peppermint in two important physiological indexes, chlorophyll and total sugar. The rosmarinic acid significantly decreased by salinity and/or heat stress but its amount increased in response to the combined stresses compared to the corresponding optimal condition. Peppermint responded to salinity and heat stress by increasing total phenol and DPPH radical scavenging capacity. Increased C4H and HPPR expression under concurrent salinity and heat stress indicated the roles of these genes in the induction of rosmarinic acid in peppermint. In conclusion, the peppermint needs moderate-temperature conditions for optimum rosmarinic acid biosynthesis and its growing for large-scale production of rosmarinic acid would not be suitable in salinity and tropical areas.

Authors' contributions

Azam Gholamnia: Data curation, Investigation, Writing- Original draft, Asghar mosleh Arani: Conceptualization, Methodology, Hamid Sodaeizadeh: Statistical supervision, Saeed Tarkesh Esfahani and Somaieh Ghasemi: Reviewing and Editing, Software Validation.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Availability of data and materials

Not applicable.

Code availability

Not applicable.

Declarations

Conflict of interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Consent to participate

Informed consent was obtained from all individual participants included in the study.

Consent for publication

The participant has consented to the submission of the case report to the journal.

Ethics approval

Not applicable.