Skip to main content
Physiology and Molecular Biology of Plants logoLink to Physiology and Molecular Biology of Plants
. 2022 Mar 22;28(3):559–572. doi: 10.1007/s12298-022-01152-0

Increase in alpha-linolenic acid content by simultaneous expression of fatty acid metabolism genes in Sesame (Sesamum indicum L.)

Muthulakshmi Chellamuthu 1, Kanimozhi Kumaresan 1, Selvi Subramanian 1,
PMCID: PMC8986930  PMID: 35465201

Abstract

Sesame is considered one of India’s important sources of edible oil and an excellent dietary source for its nutritional and medicinal value. Sesame DGAT1 and PDAT1 genes were co-expressed with omega 3 FAD genes. Systemic isolation of sesame DGAT1, PDAT1, ER type FAD3, and chloroplast type FAD7/8 genes were performed. Their sequence was analyzed for genomic organization, amino acid characterization, organ specificity, and phylogenetic relationships. The insilico analysis revealed the unique features of DGAT1, PDAT1, and FAD3 gene sequences, whereas FAD7 and FAD8 sequences had the same protein characters and were grouped in phylogeny analysis, only variation was found in their mRNA UTR regions. Functional expression of sesame TAG synthesis genes and omega-3 FAD genes was studied in yeast mutant H1246 deficient for TAG synthesis. Functional analyses in yeast with the presence of ALA confirmed the identity of sesame FAD3, FAD7 and FAD8 genes. Recombinant expression of pESC + DGAT1 + FAD3 vector in yeast mutant resulted in lipid accumulation with 10% higher ALA content. Thus this gene combination can be co-expressed in sesame and other plant systems to increase the lipid accumulation with high omega-3 fatty acid (ALA) content.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12298-022-01152-0.

Keywords: Sesame, Alpha-linolenic acid, Co-expression, Polyunsaturated fatty acid, PCR

Introduction

Cultivated sesame is native to India hence termed as Sesamum indicum L. It is an herbaceous oilseed crop. The oilseeds as well as the leaves are having nutraceutical and pharmaceutical properties. In recent times, the bioactive food components present in sesame are exploited for their various human health-enhancing properties (Nakano et al. 2006). The major fatty acids of sesame oil contain oleic acid (39.6% ), linoleic acid (46%), and traces of α-linolenic acid (ALA,18:3Δ9, 12, 15). The oleic and linoleic fatty acid contents of Indian sesame germplasm collections range from 34.71 to 45.61% and 38.49 to 49.60% (Dar et al. 2019). Sesame seeds also contain a group of compounds called lignans, which have been reported to have many pharmacological properties. In the year 2030, the vegetable oil consumption of the world is expected to rise to 200 billion Kilograms (Anilakumar et al. 2010).

Triacylglycerol (TAG) is the major component present in vegetable oils and serves as an energy source. This storage lipid accumulated in seeds is utilized during seed germination whereas TAGs present in the vegetative tissues are used for plant development and in the synthesis of defense compounds. Seed oils are the chief source of energy used as human food, feedstock, or fuel for industries (Troncoso Ponce et al. 2011).In plants, TAGs are synthesized both by acyl-CoA dependent and independent pathways. The rate-limiting enzymes belonging to these pathways are DGAT (Diacylglycerol acyltransferase) and PDAT (Phospholipid: diacylglycerol acyltransferase) (Murphy 2005). The isoforms of DGAT1 and 2 enzymes are responsible for synthesizing TAG in most organisms (Du and Benning 2016). Plants deficient in DGAT are found to accumulate less TAG. When DGAT enzymes are overexpressed, the triglycerides are found to increase in several organisms such as plants, yeast, and animals (Kalscheuer and Steinbuchel 2003). The DGAT1 and DGAT2 enzymes are located in the endoplasmic reticulum (ER), and their function is not redundant but has a specific role in TAG production (Cao et al. 2013). The PDAT enzyme was first categorized in yeast and this enzyme was found to have the primary function in TAG assembly (Shockey et al. 2005). However, the role of this enzyme in plant leaves is not found yet. In Arabidopsis, mutation analyses of the PDAT1 gene have shown a very little negative effect on triglyceride accumulation (Dahlqvist et al. 2000). Overexpression of PDAT1 in Arabidopsis leaves increases fatty acid and TAG production (Kelly et al. 2013). Arabidopsis has two and castor bean has three PDAT genes which are homologous to the yeast counterpart (Jilian et al. 2013; Stahl et al. 2004).

Fatty acids synthesized in plants have two fates: it undergoes either prokaryotic pathway or eukaryotic pathway. In the prokaryotic pathway, fatty acids are converted into complex lipids in the plastid and then exported to the ER for complex lipid assembly in the eukaryotic pathway. Plants contain omega-3 fatty acid desaturase enzymes in two compartments: the chloroplast and ER. The two plastidial desaturases FAD7 and 8 are found in the chloroplast inner membrane. The microsomal FAD3 is present in the ER facing cytosol (Van et al. 2011). Polyunsaturated Fatty Acids (PUFA) are produced by these desaturase enzymes which introduce double bonds in either saturated or monounsaturated fatty acids (Bhunia et al. 2016). Plant fats, predominantly seed oil is made up of fatty acids and they will be nutritious if they are most unsaturated. In addition, plant membranes are also constituted by either short or long-chain unsaturated fatty acid which decides the membrane fluidity (Andreu et al. 2010). Plant omega3 FADs were identified and characterized in various species such as Arabidopsis thaliana, Brassica napus, Linum usitatissimum, Glycine max, and Carthamus tinctorius (Cagliari et al. 2011; Yang et al. 2012; Vrinten et al. 2005; Roman et al. 2012). In rice, ALA content was found to be increased when soybean and rice FAD3 genes were over-expressed using GluC promoter which is endosperm specific and Ubi-1which is a constitutive promoter (Guan et al. 2014). Overexpression of soybean fatty acid desaturase (fad3C) led to an increase in α-linolenic acid in sesame seeds under the control of seed-specific 2 S albumin promoter (Bhunia et al. 2014). In transgenic tobacco plants, the expression of sesame plastidial ω-3 fatty acid desaturase (FAD7) leads to increased amounts of a-linolenic acid and decreased levels of linoleic acid (Bhunia et al. 2015). The 46 candidate genes were identified for major loci, including genes related to oil content, fatty acid synthesis, and yield. In addition, two major genes associated with black pigmentation of the seed coat and lignification are linked to a wide range of oil contents are reported by Wei et al. (2015).

Plant fatty acid metabolism genes can be studied by using the single cellular eukaryotic organism, yeast as a suitable model system. In yeast also the lipids accumulate mainly as triglycerides and lipid bodies (Liu et al. 2012). The H1246 yeast mutant lacking the genes dga1, lro1, are1, and are2 has a defective sterol esterification activity of TAG metabolism (Leber et al. 1994; Oelkers et al. 2002) was used in several studies. DGAT1 gene was characterized and shown to increase the oil content in Sapium sebiferum using the yeast mutant H1246 (Peng et al. 2016). Sesame gene encoding DGAT and PDAT enzymes were expressed in yeast H1246 mutant and these mutants exhibited higher oil content (Chellamuthu et al. 2019). When Ricinus communis PDAT1 was co-expressed with castor fatty acid hydroxylase in Arabidopsis, the amount of hydroxyl fatty acids increased by 58% (Stahl et al. 2004). Flax PDAT1 was found to be co-expressed with FAD3 genes in yeast, and it was found to have a higher ALA content (Pan et al. 2013). This study is performed to find out the gene combinations of sesame to increase the oil with a higher amount of ALA content using a yeast mutant model. Yeast H1246 strain was chosen and the expression studies proved that a specific gene combination identified in this study could have a significant role in increasing the lipid and α-linolenic acid content in a heterologous system.

Materials and methods

Plant Materials

The sesame seed TMV-7 variety was acquired from Tamil Nadu Agricultural University, Coimbatore. Young leaves, mature leaves, young stem, mature stem, root, flowers, developing and mature seeds were collected from sesame plants. Plant samples were stored in RNA later buffer (Qiagen) in order to get a good quantity and quality of RNA at a later time.

Sequence Retrieval for Gene Isolation

The coding (CDS) and protein sequences of sesame omega-3 FAD genes FAD3, FAD7, and FAD8, DGAT1 and PDAT1 were retrieved from the National Centre for Biotechnology Information (NCBI). BLASTN is used to identify them from the sesame genome using Arabidopsis genes as a reference. Primers for full-length gene amplification of sesame omega 3 desaturase genes FAD3, FAD7, and FAD8 along with DGAT1 and PDAT1 were designed (Table 1). Primers were also designed for the sesame ubiquitin gene which served as a control for constitutive expression as a reference gene (Table 2).

Table 1.

List of primers used for co-expression of omega 3 desaturases and TAG synthesis genes

S.No Gene name Forward primer Reverse primer
1. FAD3

EcoRI

5’-TATGAATTCATGGCCGTAATTTCAGGCCT-3’

ClaI

5’-TATATCGATATGGCCGTAATTTCAGGCCT-3’

SacI

5’-TATGAGCTCATAGTATTAGTTGGTATGGAGCTTTGA-3’

PacI

5’-TATTTAATTAAATAGTATTAGTTGGTATGGAGCTTTGA-3’

2. FAD7

EcoRI

5’-TATGAATTCATGGCGAGTTGGGTTTTATC-3’

ClaI

5’-TATATCGATATGGCGAGTTGGGTTTTATC-3’

SacI

5’-TATGAGCTCTCACGATTTCTCAGCTCCAGT-3’

PacI

5’-TATTTAATTAATCACGATTTCTCAGCTCCAGT-3’

3. FAD8

EcoRI

5’-TATGAATTCATGGCCAGTTGGGTATTATC-3’

ClaI

5’-TATATCGATATGGCCAGTTGGGTATTATC-3’

SacI

5’-TATGAGCTCTCAGTTCAGCTCAGGATCAG-3’

PacI

5’-TATTTAATTAATCAGTTCAGCTCAGGATCAG-3’

4. DGAT1

BamHI

5´-TATGGATCCATGGCGATTTTGGACTCG-3´

KpnI

5´-TATGGTACCCTACCTTGCACTAGCTTTTC-3´

5 PDAT1

SalI

5´-TATGTCGACATGGCGATCATGAGGCGTAG − 3´

HindIII

5’TATAAGCTTCTAAAGTCTTAATTTAATCCTTTCTG-3’

Table 2.

List of primers used for qRT-PCR analysis

Gene name Forward primer Reverse primer
FAD3 5’- CGGAAGAGATCAATGGCGGTC − 3’ 5’- GATGTCCGCAATCCTGAACGG − 3’
FAD7 5’- GGCGGAGAAGAATTTGACCC- 3’ 5’- ACAAAGGCCAAACAACCCAA- 3’
FAD8 5’ –TGTTCTGGGCTCTCTTCGTT-3’ 5’-AAGGGTGCCAGGATTCATCA − 3’
Ubiquitin 5´-CACCAAGCCGAAGAAGATCAAG-3´ 5´-CCTCAGCCTCTGCACCTTTC-3´

Phylogenetic Analysis

Sesame DGAT1, PDAT1, FAD3, FAD7, and FAD8 sequences were used as queries to extract sequences from other plants using database search tools available in NCBI. The protein sequences of DGAT1, PDAT1 FAD3, FAD7, and FAD8 of different species were given in supplementary Tables 1and 2. The following abbreviations of different species were used for phylogenetic analysis Sesamum indicum(Si), Arabidopsis thaliana(At), Erythranthe guttata(Eg), Ricinus communis(Rc), Jatropha curcas(Jc), Linum usitatissimum(Lu), Camelina sativa(Csa), Brassica napus(Bn), Populus euphratica(Pe), Citrus sinensis(Csi), Helianthus annuus(Ha), Saccharomyces cerevisiae (Sc), Vitis vinifera(Vv), Prunus mume(Pm), Populus trichocarpa(Pt), Cajanus cajan (Cc), Olea europaea (Oe), Arachis ipaensis (Ai), Glycine max(Gm), Arachis hypogaea (Ah), Xanthoceras sorbifolium (Xs), Medicago truncatula (Mt), Solanum lycopersicum (Sl), Vernicia fordii (Vf),Perilla frutescens (Pf), Striga asiatica (Sa), Prunus sibirica (Ps), Camellia sinensis (Csi), Cannabis sativa (Csa), Hevea brasiliensis (Hb), Capsicum annuum (Ca), Solanum tuberosum (St), Elaeis guineensis (Egu) and Manihot esculenta (Me). A multiple sequence alignment program MUSCLE was used to align them and the Maximum- Likelihood tree prediction algorithm using Molecular Evolutionary Genetics Analysis Version 7.0 (MEGA7). The divergence and evolutionary clustering were calculated using the JTT matrix. The statistical reliability of the branching order is evaluated by bootstrapping for 500 replicates.

Sequence Characterization

To predict the gene structures for each DGAT1, PDAT1, and FAD genes the Gene Structure Display Server (GSDS, http://gsds1.cbi.pku.edu.cn/) is performed. Gene structures are cross verified by the protein sequences available in the NCBI database. Protein characteristics such as molecular weight (MW) and isoelectric points (pIs) were determined using the tools available at (http://www.cn.expasy.org/tools). TargetP-2.0 was used to predict the signal peptides thereby the location of the protein (https://services.healthtech.dtu.dk/service.php?TargetP-2.0). Conserved domains were identified with SMART (http://smart.embl-heidelberg.de/).TOPCONS (http://topcons.net/) was used to predict transmembrane helices. NetPhos 3.1 (https://services.healthtech.dtu.dk/service.php?NetPhos-3.1) was used to predict phosphorylation sites. SOPMA was used to predict the secondary structures of DGAT1, PDAT1, and omega 3 FAD proteins. (https://npsa-prabi.ibcp.fr/NPSA/npsa_sopma.html).

mRNA Expression Analysis of Omega-3 FAD Genes

Total RNA from various sesame plant samples was isolated by the TriZol method. Quantitative analyses of the mRNA present in sesame tissues such as young leaves, mature leaves, young stem, mature stem, roots, flowers, developing seeds and mature seeds were measured. Primers were designed for the desaturase genes for FAD3 (microsomal), FAD7, FAD8 (chloroplast) and for the reference ubiquitin (UBQ6) gene. A reaction mixture of 10 µl was used for qRT-PCR experiments using PowerUP SYBR green master mix (Applied Biosystems, USA), which included 5 µl of 2x SYBR master mix, 0.5µ l of each primer (10µM), and 1 µl of 100ng cDNA. The Real-Time PCR detection system CFX96 (Bio-Rad, USA) was used. The following PCR reaction conditions were used: single UDG activation at 50 °C for 2 min, followed by denaturation at 95 °C for 2 min. After that, 40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s, 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s were performed (melt curve). Three independent PCR runs were carried out in order to calculate the expression levels by the 2-∆∆Ct technique and to report them with confidence.

Isolation of Full-Length Sesame Omega-3 FAD Genes

The TriZol reagent (Invitrogen, USA) was used to extract total RNA from various tissues of sesame. To determine the presence and quality of extracted RNA, 1.5% agarose gel electrophoresis was performed. Quantification of total RNA using Nanodrop (DeNovix, USA) and RevertAid first strand cDNA synthesis kit was used to convert 2 µg of RNA into cDNA (Thermo Scientific, USA). PCR Amplification of full length FAD3, FAD7 and FAD8 genes using ExTaq DNA polymerase (Takara, Japan). The PCR conditions were as follows: denaturation at 98 °C for 10 s, annealing at 55 °C, 58 °C, and 60 °C for 30 s, and extension at 72 °C for 1 min per kb. The PCR amplicons of varied sizes were assessed in a 1% agarose gel and purified using a gel extraction kit (Thermo Scientific, USA). CloneJET PCR cloning kit was used to clone the purified fragments. (Thermo Scientific, USA).The clones were verified by sequencing and the sequences were submitted to Genbank (Temporary ID: MZ218118, MZ218120).

Cloning of Omega-3 Desaturase with DGAT1 and PDAT1 Genes

Six different gene constructs were prepared for co-expression analysis. DGAT1 and PDAT1 genes were cloned in pESC which possess GAL1 promoter. The terminator is from the cytochrome c isoform 1 (CYC1). The omega 3 fatty acid desaturases were cloned under the control GAL10 promoter and alcohol dehydrogenase 1 (ADH1) terminator. The following combination of genes was transformed in pESC vector with DGAT1 + FAD3/FAD7/FAD8 and PDAT1 + FAD3/FAD7/FAD8.

Transformation of Recombinant Plasmids in Yeast Mutant

Yeast competent cells were prepared based on the protocol described by Lu (2011). The recombinant plasmids (pESC + DGAT1 + FAD3, pESC + DGAT1 + FAD7, pESC + DGAT1 + FAD8, pESC + PDAT1 + FAD3, pESC + PDAT1 + FAD7, pESC + PDAT1 + FAD8) of these above combinations were used in this study. For yeast transformation, the PEG/ LiAc technique with minor modifications was employed to transform these constructs into the yeast H1246 mutant MATa (dga1D lroD are1D are2D). The aforementioned yeast mutant is unable to produce oil. It was obtained from ScanBi laboratories in Sweden (Oelkers et al. 2002). Herring sperm DNA was used instead of salmon sperm DNA. The final mixture was plated in synthetic complete medium lacking uracil (Himedia Laboratories, Mumbai) and yeast nitrogen base (Himedia Laboratories, Mumbai), including 2% glucose and 2% agar. Yeasts were grown for four days by incubating at 30° C. Colony PCR was performed for verification. Positive colonies were maintained overnight at 28 °C in a liquid dropout medium containing 2% glucose, 2% raffinose and 2% galactose. In this medium, they were incubated for 72 h at 28 °C. Wild S. cerevisiae as positive and H1246 mutant strain and empty pESC vector as two negative controls were inoculated in YPD broth and incubated for 72 h at 28 °C.

Nile Red Staining of Intracellular Lipids

The TAG accumulation was measured by the Nile red staining method of intracellular lipid bodies (Wagner et al. 2010). Nile red (Sigma, USA) stain was prepared by dissolving it in acetone 1 mg/ml. The harvested yeast cells (1ml) were dissolved in 1xPBS and 5 µl of Nile red stain. Yeast cells were cultured in the dark for 30 min before being rinsed three times in 1xPBS and then dissolved in 100 µl of 1xPBS.The yeast cells were stained and visualized using Nikon Eclipse Ti microscope. The lipid bodies in yeast cells were quantified at emission and excitation wavelengths of 628 nm and 549 nm respectively.

Extraction of Total Lipids

Total lipid was recovered from yeast for quantification. For extraction, the procedure described in (Knittelfelder and Kohlwein 2017) was employed. TLC separation of total lipids was performed using the protocol (Wagner et al. 2010). The total lipids were separated by thin layer chromatography using the solvent system hexane/diethyl ether/acetic acid (80:20:1). The silica plates (Merck) were exposed to 10% copper sulphate pentahydrate in 8% phosphoric acid and incubated at 170 °C for 15 min.

Fatty acid Analysis

The modified protocol for total fatty acid extraction and trans methylation with methanolic H2SO4 was used in accordance with 6890 N gas chromatography (Agilent Technologies, USA) (Browse et al. 1986). The gas chromatograph (GC) was equipped with a flame ionization detector and an HP-5 capillary column (30 m x0.32 mm x0.10 m). The carrier gas used was High purity nitrogen. The oven can maintain a temperature of 100 °C for up to 1.5 °C and achieve a maximum temperature of 250 °C. The injector and detector temperatures were maintained to 260 °C. Temperatures in the injector and detector were kept at 260 °C. The fatty acid peaks were identified using the retention time of a commercial standard FAME mixture (C8-C24 FAME mix Sigma, USA). Three replications were executed independently to analyze the fatty acids.

Results

Selection of DGAT1, PDAT1 and Omega-3 FAD Genes Using Phylogenetic Analysis.

The phylogenetic relationship of sesame DGAT1, PDAT1 and omega3 FAD proteins and other plant species were analyzed using the maximum likelihood (ML) method. Clustering of DGAT1 and PDAT1 proteins into two major clades demonstrated their evolutionary relationship (Fig. 1).SiDGAT1and SiPDAT1 proteins were grouped with DGAT and PDAT proteins respectively from eudicots and they were separated by monocot EguDGAT1and EguPDAT1. Sesame DGAT1 and PDAT1 grouped with lamiales such as Erythranthe guttata (Eg), Olea europaea(Oe), Perilla frutescens(Pf) and Striga asiatica(Sa) and then with non-lamiales such as Helianthus annuus(Ha) which belongs to the order asterales. Ricinus communis (Rc), Linum usitatissimum(Lu), Populus euphratica(Pe), Jatropha curcas(Jc), Populus trichocarpa(Pc), Vernicia fordii (Vf), Hevea brasiliensis (Hb) and Manihot esculenta (Me) are grouped which belongs to the order malpighiales.

Fig. 1.

Fig. 1

Phylogenetic analysis of DGAT1 and PDAT1 gene families reconstructed by the Maximum like hood (ML) method. A complete alignment of 75 protein sequences was used. Bootstrapping with 500 replicates was used to establish the confidence limits of the tree branches. There were a total of 879 positions in the final dataset. Colored branches indicated different groups of proteins Red: DGAT1 and Green: PDAT1. Taxa terminologies are abbreviated using the first letter of the genus and the species name as given in Supplementary Table 1

Phylogenetic analysis of omega-3 FAD proteins (FAD3, FAD7 and FAD8) was shown in Fig. 2. The tree reveals that the evolutionary partitioning of omega-3 FAD genes into two major clades: I- FAD3, II- FAD7, and FAD8. As mentioned earlier SiFAD7 and SiFAD8 sequences are identical and they were found together. These two gene sequences are similar in most of the crops under analysis. Hence, within species clusters of these two genes are seen in several cases. Sesamum indicum and Populus euphratica genes were found clustered for all three genes.

Fig. 2.

Fig. 2

Phylogenetic tree of omega3 FAD3, FAD7 and FAD8 gene families reconstructed by the Maximum like hood (ML) method from the complete alignment of 59 proteins sequences. Bootstrapping with 500 replicates was used to establish the confidence limits of the tree branches. There were a total of 272 positions in the final dataset. Colored branches indicated different groups of proteins Red: FAD3, Green: FAD7 and FAD8. Taxa terminologies are abbreviated using the first letter of the genus and the species name as given in the Supplementary Table 2

Insilico Characterization of DGAT1, PDAT1 and ω-3 FADs of Sesame.

The genome annotation provided the data for identifying sesame DGAT1, PDAT1 and ω-3 FADs. We identified seven DGAT1 isoforms, six PDAT1 isoforms, one FAD3, three FAD7 and one FAD8 genes in various chromosomal positions of sesame genome. The exon-intron regions of DGAT1, PDAT1 and ω-3 FADs of sesame were predicted using GSDS 2.0 software. Sesame DGAT1-A contains 16 exons, DGAT1-B, DGAT1-C DGAT1-D and DGAT1-G comprise 6 exons whereas DGAT1-E shares 13 exons and DGAT1-F contains 7 exons (Fig. 3). Sesame PDAT1-A, PDAT1-B, PDAT1-C, PDAT1-D and PDAT1-F consist of 6 exons whereas PDAT1-E contains 5 exons. Omega 3 FADs of sesame FAD3, FAD7-A, FAD7-B, FAD7-C and FAD8 shares 8 exons. Full length cDNA of sesame DGAT1 was obtained with the longest mRNAs of 1,646 ~ 2,165 bp, ORFs of 1,380 ~ 1,632 bp, 5’UTRs of 50 ~ 231 bp and 3’UTRs of 117 ~ 341 bp (Table 3). Sesame PDAT1 contains the longest mRNAs of 2,338 ~ 3,142 bp, ORFs of 1,974 ~ 2,067 bp, 5’UTRs of 176 ~ 516 bp and 3’UTRs of 164 ~ 561 bp. ω-3 FADs of sesame mRNAs of 1,577 ~ 2,015 bp, ORFs of 1,236 ~ 1,344 bp, 5’UTRs of 4 ~ 362 bp, 3’UTRs of 234 ~ 350 bp respectively.

Fig. 3.

Fig. 3

Gene structures of DGAT1, PDAT1 and ω-3 FADs of sesame. 5’UTR/3’UTR, exons and introns are shown as blue rectangles, yellow rectangles and black lines respectively

Table 3.

Basic parameters of DGAT1, PDAT1 and omega 3 fatty acid desaturases mRNA from sesame. The mRNA sequences of DGAT1, PDAT1 and omega 3 fatty acid desaturases were retrieved from NCBI

Gene name mRNA accession mRNA length (bp) ORF and position Length of 5’ UTR (bp) Length of 3’ UTR (bp) Polyadenylation Signal
DGAT1-A (Gene used for cloning) NM_001304405.1 2165

1632

193–1824

192 341 T1254 ATAAA
DGAT1-B XM_011094254.2 1806

1398

165–1562

164 244 A1599 ATAAT
DGAT1-C XM_011089929.2 1722

1512

54-1565

53 157 A1561 ATAAA
DGAT1-D XM_011089930.2 1700

1380

63-1442

62 258 T 1561ATAAA
DGAT1-E XM_020697556.1 1934

1467

232–1698

231 236 T1293 ATAAA
DGAT1-F XM_011077691.2 1646

1479

51-1529

50 117 G1481ATAAA
DGAT1-G XM_011094255.2 1796

1392

161–1552

160 244 G1585ATAAA
PDAT1-A(Gene used for cloning) XM_020697972.1 3077

2025

517–2541

516 536 G2485ATAAA
PDAT1-B XM_011095486.2 3117

2067

515–2581

514 536 G2525ATAAA
PDAT1-C XM_011095485.2 3128

2067

515–2581

514 547 T2672ATAAA
PDAT1-D XM_020697971.1 3142

2067

515–2581

514 561 T2686ATAAA
PDAT1-E XM_011081541.2 2338

1998

177–2174

176 164 T1530ATAAA
PDAT1-F XM_011074264.2 2642

1974

246–2219

245 423 T1703ATAAA
FAD3(Gene used in this study) XM_011082487.1 1577

1236

114–1343

113 234 A1497ATAAA
FAD7-A(Gene used in this study) NM_001319690.1 1622

1344

5-1348

4 274 G1352ATAAT
FAD7-B U25817.1 1622

1344

5-1348

4 274 G1352ATAAT
FAD7-C XM_011078407.2 2015

1311

363–1673

362 342 G1420ATAAA
FAD8(Gene used in this study) XM_011086599.2 2006

1344

313–1656

312 350 G1660ATAAT

DGAT1’s amino acid level is 463 ~ 543, with the MW of 51.36 ~ 61.93 kDa and a predicted pI of 7.13 ~ 9.35. Sesame PDAT1 has a projected pI value of 5.87 ~ 8.11 and is 657 ~ 688 amino acids long with a molecular weight of 73.24 ~ 75.66 kDa. ω-3 FADs comprises 409 ~ 447 aa in length and had the MW of 46.60 ~ 51.11 and pI of 7.44 ~ 8.48 respectively (Table 4). Sesame DGAT1-A and DGAT1-F showed 68.86% and 64.72% identity with Arabidopsis DGAT1 whereas other DGAT1 isoforms exhibited 17.03 ~ 19.32%. PDAT1-A, PDAT1-B, PDAT1-C, PDAT1-E and PDAT1-F showed 75.26% identity with Arabidopsis PDAT1 however sesame PDAT1-D shares 72.12%. Sesame FAD3 shared 68.91% identity with AtFAD3, 75.47% with FAD7 and 82.71% with FAD8 of Arabidopsis respectively (Supplementary file 4). According to SMART and Pfam analyses, the sesame DGAT1-A and DGAT1-E proteins were found to be members of MBOAT (membrane bound O-transferase) protein family. A MBOAT domain was found in DGAT1-A (aa 179–533) and DGAT1-E (aa264-479) positions, and it is primarily involved in acyl transfer. WES acyltransferase (wax ester synthase) and DUF1298 are found in DGAT1-B, DGAT1-C, DGAT1-D, DGAT1-F, and DGAT1-G proteins. LCAT (Lecithin-cholesterol acyltransferase) domain was noticed in all PDAT1 isoforms of sesame. Omega 3 FAD proteins from sesame contains DUF3474 and FA_desaturase domain which is conserved in all FAD isoforms. Subcellular location of DGAT1, PDAT1 and omega 3 FADs were predicted using TargetP 2.0 (Table 4). Transmembrane helices were predicted using TOPCONS, DGAT1-A had nine transmembrane helices, DGAT1-E contains six transmembrane helices whereas PDAT1-A/B/C/D comprises one transmembrane helix and an omega 3 FADs protein contains four transmembrane helices respectively (Table 4; Supplementary file 3). Potential phosphorylation sites were predicted using NetPhos 3.1 were shown in Table 4. Secondary structure of proteins analysed using SOPMA indicates, DGAT1 isoforms contain 35.95 ~ 48.98% α-helices, 8.61 ~ 18.36% extended strands, 2.25 ~ 4.37% β-turns and 38.49 ~ 43.57% random coils (Supplementary file 4).PDAT1 isoforms comprises 34.59 ~ 39.70% α-helices, 11.73 ~ 15.13% extended strands, 4.81 ~ 6.10% β-turns and 42.31 ~ 45.49% random coils whereas ω-3 FAD proteins contain 35.35 ~ 39.36% α-helices, 12.22 ~ 15.14% extended strands,3.80 ~ 4.36% β-turns and 44.04 ~ 46.31% random coils respectively.

Table 4.

Predicted key parameters of DGAT1, PDAT1 and ω-3 FAD proteins of sesame. Protein sequences of DGAT1, PDAT1 and omega 3 desaturases were retrieved from NCBI. Molecular weight (MW) and isoelectric point (pI) of each protein were calculated using http://www.cn.expasy.org/tools. Subcellular location were predicted using https://services.healthtech.dtu.dk/service.php?TargetP-2.0. Conserved domains were determined by SMART (http://smart.embl-heidelberg.de). Transmembrane helices were predicted using http://topcons.net/. Phosphorylation sites were determined using https://services.healthtech.dtu.dk/service.php?NetPhos-3.1

Gene name Protein accession Protein length (aa) Molecular mass pI Conserved domain
(SMART)
Subcellular location Transmembrane helices
TOPCONS
Phosphorylation sites
NetPhos 3.1
Name Position
DGAT1-A NP_001291334.1 543 61936.20 8.06 MBOAT 179–533 Plasma membrane TM1:78–98,TM2:120–140,TM3:153–173,TM4:178–198,TM5:265–285,TM6:314–334,TM7:385–405,TM8:408–428,TM9:442–462  S:30,T:8,Y:7
DGAT1-B XP_011092556.1 465 51549.99 8.79

WES_acyltransferase

DUF1298

36–254

311–456

Chloroplast TM1:60–80,TM2:113–133  S:24,T:11,Y:2
DGAT1-C XP_011088231.2 503 56419.45 8.89

WES_acyltransferase

DUF1298

88–240

344–489

Mitochondria TM1:131–151,TM2:153–173,TM3:312–332  S:30,T:19,Y:5
DGAT1-D XP_011088232.2 459 51931.13 9.30

WES_acyltransferase

DUF1298

88–240

344–453

Plasma membrane TM1:97–117,TM2:150–170,TM3:312–332  S:31,T:20,Y:4
DGAT1-E XP_020553215.1 488 55361.96 7.13 MBOAT 264–479 Plasma membrane TM1:78–98,TM2:121–141,TM3:152–172,TM4:179–199,TM5:265–285,TM6:314–334  S:31,T:11,Y:7
DGAT1-F XP_011075993.1 492 54908.46 9.35

WES_acyltransferase

DUF1298

20–257

330–474

Plasma membrane TM1:107–127,TM2:129–149,TM3:297–317  S:23,T:9,Y:3
DGAT1-G XP_011092557.1 463 51364.76 8.67

WES_acyltransferase

DUF1298

36–254

309–454

Chloroplast TM1:60–80,TM2:113–133  S:24,T:11,Y:2
PDAT1-A XP_020553631.1 674 73872.51 8.11 LCAT

150–434

495–635

Chloroplast TM1:1–22  S:37,T:13,Y:8
PDAT1-B XP_011093788.1 688 75669.47 7.88 LCAT

150–434

469–649

Chloroplast TM1:1–22  S:38,T:13,Y:10
PDAT1-C XP_011093787.1 688 75669.47 7.88 LCAT

150–434

469–649

Chloroplast TM1:1–22  S:37,T:13,Y:10
PDAT1-D XP_020553630.1 688 75669.47 7.88 LCAT

150–434

469–649

Chloroplast TM1:1–22  S:37,T:13,Y:10
PDAT1-E XP_011079843.1 665 74769.61 6.40 LCAT 124–626 Cytoplasmic - S:32,T:17,Y:11
PDAT1-F XP_011072566.1 657 73242.67 5.87 LCAT

121–433

444–618

Cytoplasmic - S:28,T:15,Y:14
FAD3 XP_011080789.1 409 46601.18 8.48

DUF3474

FA_desaturase

5–94

99–361

Endoplasmic reticulum TM1:10–30, TM2:33–53 ,TM3:167–187,TM4:195–215  S:20,T:15,Y:6
FAD7-A NP_001306619.1 447 51116.47 8.16

DUF3474

FA_desaturase

1-137

111–403

Chloroplast TM1:54–74,TM2:76–96,TM3:213–233,TM4:238–258  S:15,T:10,Y:3
FAD7-B AAA70334.1 447 51116.47 8.16

DUF3474

FA_desaturase

1-137

111–403

Chloroplast TM1:54–74,TM2:76–96,TM3:213–233,TM4:238–258  S:15,T:10,Y:3
FAD7-C XP_011076709.1 436 49931.07 7.44

DUF3474

FA_desaturase

1-131

137–398

Chloroplast TM1:48–68,TM2:71–91,TM3:207–227,TM4:233–253  S:18,T:10,Y:4
FAD8 XP_011084901.1 447 51116.47 8.16

DUF3474

FA_desaturase

1-137

111–403

Chloroplast TM1:54–74,TM2:76–96,TM3:213–233,TM4:238–258  S:15,T:10,Y:3

Expression Analysis of Omega-3 FADs of Sesame

The omega 3 desaturase genes FAD3 (microsomal), FAD7, and FAD8 (chloroplast) in sesame were isolated, and their mRNA expression levels were measured using quantitative real-time PCR technique. The expression of sesame FAD3, FAD7, and FAD8 mRNA in different tissues was investigated. All three omega 3 desaturase mRNAs were analyzed in various sesame tissues, FAD3 was higher in mature stems than other tissues. FAD7 and FAD8 were highly expressed in young stems than other tissues. The mRNA level of the microsomal FAD3 gene was found lower in mature seeds. However, plastidial FAD7 and FAD8 mRNA levels were observed to be higher in young stems.

Functional Characterization of Sesame DGAT1 and PDAT1 Genes with ω-3 FADs in Yeast.

To evaluate their specific function in fatty acid production, the DGAT1, PDAT1, and omega 3 FAD genes were expressed in a yeast H1246 mutant defective in TAG synthesis. Co-expression of DGAT1 with any one of the FAD genes, FAD3/FAD7/FAD8 and PDAT1 with any one of the FAD genes, FAD3/FAD7/FAD8 genes in yeast H1246 mutant were envisaged the lipid bodies stained using Nile red dye (Fig. 5 A-5 F). The occurrence of oil bodies in yeast transformants was compared with negative controls (Yeast H1246 mutant) for TAG formation. Lipid bodies were found in wild-type S. cerevisiae serving as a positive control (Fig. 5G), but not in the H1246 mutant strain or the negative control mutant were both transformed with an empty pESC vector (Fig. 5 H and 5I).

Fig. 5.

Fig. 5

Lipid body formation of sesame DGAT1 and PDAT1 with ω-3 FAD genes in yeast mutant. Nile red stained yeast cells confirming lipid body accumulation in yeast mutants expressing sesame DGAT1 + FAD3 (A), DGAT1 + FAD7 (B), DGAT1 + FAD8(C), PDAT1 + FAD3 (D), PDAT1 + FAD7(E), PDAT1 + FAD8 (F) genes. The wild type Saccharomyces cerevisiae (G) cells with nile red staining (positive control). TAG deficient quadruple yeast mutant H1246 (H) and the yeast mutant harboring the empty vector pESC-URA (I) devoid of fat bodies

Analysis of Total Lipids by TLC

The lipids were isolated from stationary phase yeast cells. Total lipid separation revealed that expression of DGAT1 with FAD3/FAD7/FAD8 and PDAT1 with FAD3/FAD7/FAD8 genes indicated a noticeable spot corresponding to TAG which is also present in the positive control wild-type S.cerevisiae (Fig. 6). In the H1246 yeast mutant and the empty pESC vector, TAG was not visible. These findings suggest that the DGAT1 and PDAT1 gene combinations can effectively restore lipid bodies in yeast via interactions with the fatty acid synthesis pathway, which is stable according to Nile red staining results.

Fig. 6.

Fig. 6

TLC separation of yeast quadruple mutant H1246 with sesame DGAT1, PDAT1 with omega 3 desaturase genes. (1) yeast mutant expressing DGAT1 + FAD3 (2) DGAT1 + FAD7 (3) DGAT1 + FAD8 (4) PDAT1 + FAD3 (5) PDAT1 + FAD7 (6) PDAT1 + FAD8 (7) the TAG deficient mutant H1246 (8) yeast mutant harboring pESC empty vector were used as negative control (9) wild type S.cerevisiae as positive control were analyzed. TAG-triacylglycerol, FFA- free fatty acid, DAG- diacylglycerol

Fatty acid Profiling of DGAT1 and PDAT1 with Omega-3 Desaturases.

Fatty acid analysis for co-expression of sesame DGAT1 and PDAT1 genes with omega 3 FADs using gas chromatography (Fig. 7). In comparison to the yeast mutant and wild type S. cerevisiae, the expression of three DGAT1 and three PDAT1 gene combinations in yeast mutants have a different fatty acid composition. Yeast with DGAT1 + FAD3 combination showed up to a 10% increase in ALA content whereas in PDAT1 + FAD3 showed a 9% of ALA content. ALA was detected in yeast mutants transformed with recombinant plasmids, implying that all six recombinant vectors express functional omega-3 desaturases. There was also a significant increase in –omega-3(C18:3) and a decrease in omega-9 (C18:1) and omega-6 (C18:2) fatty acids. In addition, the transformants also exhibited significant changes in certain other fatty acid production. According to these findings, co-expression of sesame DGAT1 and PDAT1 with − 3 FADs increased the integration and endogenous unsaturated fatty acid incorporation into lipids.

Fig. 7.

Fig. 7

Fatty acid composition of yeast mutant expressing DGAT 1 and PDAT with omega 3 desaturase genes. C16:0 –palmitic acid, C16:1 palmitoleic acid, C18:0-stearic acid, C18:1-oleic acid.C18:2-linoleic acid and C18:3-linolenic acid. Wild type Saccharomyces cerevisiae was used as a positive control. The bars represent the standard deviation of three technical replicates

Discussion

Sesamum indicum L. is a significant source of edible oil in India. The average yield of sesame is 413 Kg/ ha in India as compared to 535 kg/ha in other countries. Hence, there is a scope for increasing the oil yield by tapping the genetic potential of the crop. It also consists of trace quantities of α- linolenic acid (ALA) that is required for human health. The quality of the seed and oil will improve if the omega-3 fatty acid concentration is increased. Omega-6 and omega-3 fatty acids are the two most significant fatty acids for humans and should be consumed in a (1:1) ratio (Simopoulos 2016). The present dietary pattern of humans has higher omega-6 fatty acids than omega3 fatty acids. Our earlier investigations on DGAT and PDAT genes have shown increased oil content in yeast mutants (Chellamuthu et al. 2019). The purpose of this research is to look at the roles of DGAT1 and PDAT1 in the expression of desaturases, with the goal of increasing ALA content and oil accumulation. Even though ALA is present in trace amounts in sesame oil, it cannot be used as a direct source for ALA. The current study aims to analyze the combinatorial outcome of fatty acid desaturases with TAG synthesis genes to increase the oil and quality. The DGAT1 enzyme has been implicated in the critical step of TAG synthesis in oilseed crops such as peanut, soybean, and rapeseed (Chi et al. 2014; Li et al. 2010; Lock et al. 2009). The PDAT1 enzyme also plays a major part in TAG production even though the expression of DGAT1 was mainly throughout the stages of seed growth in different plant species (Cao et al. 2013; Kim et al. 2011).

In order to isolate the above genes, phylogenetic and domain analyses were performed to choose DGAT1 and PDAT1 genes. The sesame DGAT1-A and DGAT1-E belonged to the MBOAT protein family (Table 4). This region may be associated in acyl transfer, and the spanning region S146 HAGLF-N in DGAT1-A and DGAT1-E and R164 LIIEN active site catalytic residues in Arachis hypogaea and Arabidopsis thaliana is highly conserved (Chi et al. 2014; Zou et al. 1999).HKW-XX-RH-X-Y-X-P, a DAG/phorbal ester binding motif known in sesame DGAT1-A and DGAT1-E but not in other isoforms; nonetheless, it was previously described in Arabidopsis thaliana (Zou et al. 1999). DGAT1-A was found to be a potential candidate for higher acyl transferase activity since it contains nine transmembrane domains (Supplementary Fig. 3) The wax ester synthase like acyl transferase (WES_acyltransferase) was predicted in sesame DGAT1-B, DGAT1-C, DGAT1-D, DGAT1-F and DGAT1-G and it contains a conserved region of HHXXXDG the active site motif responsible for ester bond formation and also it has DUF1298 domain which is conserved among hypothetical plant proteins (Supplementary file. 2). Similarly, this domain was also present in Arabidopsis and Euglena gracilis (Li et al. 2008; Tomiyama et al. 2017). The presence of an LCAT (lecithin: cholesterol acyltransferase) domain in the putative sesame PDAT1 isoforms belongs to the LCAT superfamily, and it contains one transmembrane that is conserved among other PDATs such as Camelina sativa and is likely involved in lipid bilayer destabilization, facilitating fatty acid-binding to the active site of the enzymes (Yuan et al. 2017). The sesame FAD3 (microsomal) has one unknown domain DUF3474 at positions 5 to 94 and one fatty acid desaturase domain at positions 99 to 361. Sesame FAD7 and FAD8 have only one domain i.e. FA_Desaturase at 112 to 403 positions. Based on the FAD3 domain present at positions 99 to 361, clustering pattern found in the phylogenetic tree (Fig. 2) and N-terminal signal peptide sequences the sesame microsomal FAD3 gene was chosen. The FA desaturase domain was revealed to be connected to an unknown DUF3474 domain in bacteria and eukaryotes (Letunic et al. 2015). According to the subcellular localization using TargetP analysis sesame DGAT1-A, DGAT1-D, DGAT1-E and DGAT1-F may be localized in the plasma membrane and DGAT1 isoforms which are located in the chloroplast whereas the sesame PDAT1-A, B, C, and D was localized in chloroplast and other isoforms of PDAT1 was present in the cytoplasm. Besides, it has been stated that some PDATs are localized in the chloroplasts of microalga Chlamydomonas reinhardtii and others located in the plasma membrane of Ricinus communis (Yoon et al. 2012; Pan et al. 2015). Membrane receptors and channel proteins are integral membrane proteins made up of several transmembrane helices that assemble into bundles that cross the lipid bilayer via tertiary or quaternary structures. The biological role of these proteins is to rearrange the transmembrane bundle structure and also maintain the catalytic structure of fatty acid desaturases (Lim et al. 2015). Phosphorylation of proteins plays a role in various physiological processes such as enzyme activity alteration from active to inactive and vice versa. Phosphorylation may cause a structural change in the transmembrane domain which directly regulates the enzyme activity and also alter the protein conformation and modulate the biological function (Grosely et al. 2013).

The evolutionary relationship of sesame DGAT1 and PDAT1 were grouped with lamiales such as Perilla frutescens, Striga asiatica and Olea europaea than with asterales such as Helianthus annuus (Fig. 1). The DGAT1 and PDAT1 enzymes arise from totally diverse families throughout the occurrence of eukaryotes (Turchetto Zolet et al. 2011). An evolutionary study of PDATs from Linum usitatissimum (LuPDAT1) and Ricinus communis (RcPDAT1-2) are closely related which belongs to the order malpighiales (Stahl et al. 2004; Kim et al. 2011). Sequence similarity of sesame FAD7 and FAD8 mRNA and proteins were more identical. The evolutionary pattern of sesame FAD7 and FAD8 was clustered with Perilla frutescens FAD7/FAD8, Olea europaea FAD7 which belongs to the order Lamiales and also clustered with Gossypium hirsutum FAD7 which is divergent between order Lamiales and order Malvales (Fig. 2). However, the evolution of front-end desaturases in the previous study in safflower ω-3 FADs revealed that the tree was not systemic enough to analyze the evolution rules (Roman et al. 2012). Most of the plants comprise both the ER and chloroplastic ω-3 FADs which means divergently evolved and both categories are required for higher plants (Xue et al. 2018).

The tissue-specific mRNA expression pattern of TAG synthesis and desaturase genes of sesame indicates a higher expression in vegetative tissues. These results suggest their other functions apart from oil accumulation. In flax, the DGAT1 expression was considerably up-regulated in seeds when the analysis throughout the seed development stage reached a maximum at 20 days post-anthesis (DPA) whereas in PDAT1 the expression was substantially higher in seeds than other vegetative tissues (Pan et al. 2013). Tissue specific expression of sesame ω-3 FADs were analyzed in various tissues revealed that microsomal FAD3 mRNA accumulation in the mature stem was the most abundant than other vegetative tissues whereas the expression pattern of FAD7 and FAD8 was higher in young stems (Fig. 4). These observations about mRNA expression could suggest that the membrane fluidity could be the major function than accumulation in seed oil. Similarly, FAD3-1 expression was higher in stem tissues than in other vegetative tissues studied in Salvia hispanica, whereas FAD7 and FAD8 expression were higher in the stem, flowers, middle stage seeds, and late stage seeds (Xue et al. 2018).

Fig. 4.

Fig. 4

Quantitative Real time PCR experiment of omega 3 desaturase: young leaves (YL), young stems(Y St), and mature leaves (ML), mature stems (M St), roots (R), Open flowers (OF), developing seeds (DS) and mature seeds (MS). The mRNA abundance was normalized with respect to the ubiquitin 6 gene as an endogenous control. The bars represent the standard deviation of three biological replicates

Heterologous yeast co-expression of sesame confirms the catalytic activity of DGATI + FAD3 showed an increase in ALA content than PDAT1 + FAD3 (Fig. 7). Similarly, co-expression of LuDGAT1 with LUFAD3B showed only lower amounts of TAG were produced with an ALA: LA conversion of ~ 2:1 ratio whereas LuPDAT1, LuPDAT2 with LuFAD3B has predominantly produced TAG with an ALA: LA conversion of 10:1ratio in flaxseed (Pan et al. 2013). Although yeast has been demonstrated to be a best system for investigating the participation of microsomal desaturases such as FAD2 and FAD3, it is not appropriate for chloroplastic desaturases such as FAD6/FAD7/FAD8 due to specific electron transport route requirements (Vrinten et al. 2005; Guo et al. 2014; Xue et al. 2017). In Perilla fructens, expression of FAD3bY gene in yeast cells increases the ALA content up to 10.61% whereas Salvia hispanica FAD3-2Y also increased the ALA levels by about 16.91% (Xue et al. 2018).

The present study provides a systemic and functional characterization of sesame DGAT1, PDAT1 and ω-3 FAD genes using insilico, invivo and invitro yeast expression systems. The findings will facilitate genetic engineering aspects for high levels of oil and omega 3 fatty acid content in sesame.

Availability of data and material

All the appropriate information is provided in the manuscript and supplementary files.

Electronic Supplementary Material

Below is the link to the electronic supplementary material.

Supplementary Material 2 (52.9KB, docx)
Supplementary Material 3 (166.6KB, docx)
Supplementary Material 4 (496.2KB, docx)
Supplementary Material 5 (324.9KB, docx)

Acknowledgements

The authors would like to express their gratitude to the Department of Biotechnology, PSG College of Technology, and the Department of Science and Technology, Government of India for providing funding and infrastructure. We thank Dr.Sten Stymne and Dr.Jenny Lindberg Yilmaz for providing the Yeast H1246 mutant strain.

Declarations

Conflict of interest

The authors declare that no conflict of interest.

Consent for publication

All authors approved the manuscript for publication.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Andreu V, Lagunas B, Collados R, Picorel R, Alfonso M. The GmFAD7 gene family from soybean: identification of novel genes and tissue-specific conformations of the FAD7 enzyme involved in desaturase activity. J Exp Bot. 2010;61(12):3371–3384. doi: 10.1093/jxb/erq158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anilakumar KR, Pal A, Khanum F, Bawa AS. Nutritional, medicinal and industrial uses of sesame (Sesamum indicum L.) seeds-an overview. Agricultures Conspectus Scientificus. 2010;75(4):159–168. [Google Scholar]
  3. Bhunia RK, Chakraborty A, Kaur R, Gayatri T, Bhattacharyya J, Basu A, Maiti MK, Sen SK. Seed-specific increased expression of 2S albumin promoter of sesame qualifies it as a useful genetic tool for fatty acid metabolic engineering and related transgenic intervention in sesame and other oil seed crops. Plant Mol Biol. 2014;86(4–5):351–365. doi: 10.1007/s11103-014-0233-6. [DOI] [PubMed] [Google Scholar]
  4. Bhunia RK, Kaur R, Maiti MK. Metabolic engineering of fatty acid biosynthetic pathway in sesame (Sesamum indicum L.): assembling tools to develop nutritionally desirable sesame seed oil. Phytochem Rev. 2015;15(5):799–811. [Google Scholar]
  5. Bhunia RK, Chakraborty A, Kaur R, et al. Enhancement of α-linolenic acid content in transgenic tobacco seeds by targeting a plastidial ω-3 fatty acid desaturase (fad7) gene of Sesamum indicum to ER. Plant Cell Reports. 2016;35:213–226. doi: 10.1007/s00299-015-1880-z. [DOI] [PubMed] [Google Scholar]
  6. Browse J, IMcCourt P, Somerville C. A mutant of Arabidopsis deficient in C18:3 and C16:3 leaf lipids. Plant Physiol. 1986;81(13):859–864. doi: 10.1104/pp.81.3.859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cagliari A, Margis R, Dos Santos Maraschin F, Turchetto-Zolet AC, Loss G, MargisPinheiro M. Biosynthesis of Triacylglycerols (TAGs) in plants and algae. Int J Plant Biology. 2011;2(1):e10. [Google Scholar]
  8. Cao H, Shockey JM, Klasson KT, Chapital DC, Mason CB. Developmental Regulation of Diacylglycerol Acyltransferase Family Gene Expression in Tung Tree Tissues. PLoS ONE. 2013;8(10):e76946. doi: 10.1371/journal.pone.0076946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chellamuthu M, Kumaresan K, Subramanian S, Muthumanickam H. Functional analysis of sesame diacylglycerol acyltransferase and phospholipid: diacylglycerol acyltransferase genes using in silico and in vitro approaches. Plant Mol Biology Report. 2019;37(3):146–156. [Google Scholar]
  10. Chi X, Hu R, Zhang X, Chen M, Chen N, Pan L et al (2014) Cloning and Functional Analysis of Three Diacylglycerol Acyltransferase Genes from Peanut (Arachis hypogaea L.).PLoS ONE. 9(9), e105834 [DOI] [PMC free article] [PubMed]
  11. Dahlqvist A, Stahl U, Lenman M, Banas A, Lee M, Sandager L, Ronne H, Stymne H (2000) Phospholipid: diacylglycerol acyltransferase: An enzyme that catalyzes the acyl CoA-independent formation of triacylglycerol in yeast and plants. Proceedings of the National Academy of Science of the United States of America. 97(12), 6487–6492 [DOI] [PMC free article] [PubMed]
  12. Dar AA, Kancharla PK, Chandra K, Sodhi YS, Arumugam N. Assessment of variability in lignan and fatty acid content in the germplasm of Sesamum indicum L. J Food Sci Technol. 2019;56(2):976–986. doi: 10.1007/s13197-018-03564-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Du ZY, Benning C (2016) Triacylglycerol accumulation in photosynthetic cells in plants and algae. In: Nakamura Y, Li-Beisson Y (eds) Lipid in plant and algae development. Subcellular Biochemistry. Springer International Publishing, p 86 [DOI] [PubMed]
  14. Grosely R, Kopanic JL, Nabors S, Kieken F, Spagnol G, Al-Mugotir M, Zach S, Sorgen PL. Effects of phosphorylation on the structure and backbone dynamics of the intrinsically disordered connexin43 C-terminal domain. J Biol Chem. 2013;288(34):24857–24870. doi: 10.1074/jbc.M113.454389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Guan LL, Wu W, Hu B, Li D, Chen JW, Hou K, Wang L. Developmental and growth temperature regulation of omega-3 fatty acid desaturase genes in safflower (Carthamus tinctorius L.) Genet Mol Res. 2014;3(3):6623–6637. doi: 10.4238/2014.August.28.7. [DOI] [PubMed] [Google Scholar]
  16. Guo HH, Li QQ, Wang TT, Hu Q, Deng WH, Xia XL, et al. XsFAD2 gene encodes the enzyme responsible for the high linoleic acid content in oil accumulated in Xanthoceras sorbifolia seeds. J Sci Food Agric. 2014;94(3):482–488. doi: 10.1002/jsfa.6273. [DOI] [PubMed] [Google Scholar]
  17. Jilian F, Yan C, Shanklin J, Xu C. Phospholipid: diacylglycerol acyltransferase -mediated triacylglycerol biosynthesis is crucial for protection against fatty acid-induced cell death in growing tissues of Arabidopsis. Plant J. 2013;76(6):930–942. doi: 10.1111/tpj.12343. [DOI] [PubMed] [Google Scholar]
  18. Kalscheuer R, Steinbuchel A. A novel bifunctional wax ester synthase/ acyl-CoA: diacylglycerol acyltransferase mediates wax ester and triacylglycerol biosynthesis in Acinetobacter calcoaceticus ADP1. J Biol Chem. 2003;278(10):8075–8082. doi: 10.1074/jbc.M210533200. [DOI] [PubMed] [Google Scholar]
  19. Kelly AA, van Erp H, Quettier AL, Shaw E, Menard G, Kurup S, Eastmond PJ. The sugar-dependent1 lipase limits triacylglycerol accumulation in vegetative tissues of Arabidopsis. Plant Physiol. 2013;162(3):1282–1289. doi: 10.1104/pp.113.219840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim HU, Lee KR, Go YS, Jung JH, Suh MC, Kim JB. Endoplasmic reticulum-located PDAT1-2 from castor bean enhances hydroxy fatty acid accumulation in transgenic plants. Plant Cell Physiology. 2011;52(6):983–993. doi: 10.1093/pcp/pcr051. [DOI] [PubMed] [Google Scholar]
  21. Knittelfelder OL, Kohlwein SD (2017) Lipid Extraction from Yeast Cells. Cold Spring Harbor Protocols:085449 [DOI] [PubMed]
  22. Leber R, Zinser E, Zellnig G, Paltauf F, Daum G. Characterization of lipid particles of the yeast, Saccharomyces cerevisiae. Yeast. 1994;10(11):1421–1428. doi: 10.1002/yea.320101105. [DOI] [PubMed] [Google Scholar]
  23. Letunic I, Doerks T, Bork P. SMART: recent updates, new developments and status in 2015. Nucleic Acids Res. 2015;43:257–260. doi: 10.1093/nar/gku949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li F, Wu X, Lam P, Bird D, Zheng H, et al. Identification of the wax ester synthase/acyl-coenzyme A: Diacylglycerol acyltransferase WSD1 required for stem wax ester biosynthesis in Arabidopsis. Plant Physiol. 2008;148(1):97–107. doi: 10.1104/pp.108.123471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li RZ, Yu KS, Hildebrand DF. DGAT1, DGAT2 and PDAT expression in seed and other tissues of epoxy and hydroxyl fatty acid accumulating plants. Lipids. 2010;45(2):145–157. doi: 10.1007/s11745-010-3385-4. [DOI] [PubMed] [Google Scholar]
  26. Lim JM, Vikramathithan J, Hwangbo K, Ahn JW, Park YI, Choi DW, Jeong WJ. Threonine 286 of fatty acid desaturase 7 is essential for ω-3 fatty acid desaturation in the green microalga Chlamydomonas reinhardtii. Front Microbiol. 2015;6:66. doi: 10.3389/fmicb.2015.00066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Liu HL, Yin ZJ, Xiao L, Xu YN, Qu LQ. Identification and evaluation of ω-3 fatty acid desaturase genes for hyperfortifying α-linolenic acid in transgenic rice seed. J Exp Bot. 2012;63(8):3279–3287. doi: 10.1093/jxb/ers051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lock YY, Snyder CL, Zhu W, Siloto RM, Weselake RJ, Shah S. Antisense suppression of type 1 diacylglycerol acyltransferase adversely affects plant development in Brassica napus. Plant Physiol. 2009;137(1):61–71. doi: 10.1111/j.1399-3054.2009.01258.x. [DOI] [PubMed] [Google Scholar]
  29. Lu Y (2011) Making yeast competent cells and yeast cell transformation.Bio-Protocol 101:e96. 10.21769/BioProtoc.96
  30. Murphy DJ. Plant lipids: biology, utilization and manipulation. Oxford, UK: Blackwell Publishing; 2005. [Google Scholar]
  31. Nakano T, Suzuki K, Fujimura T, Shinshi H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol. 2006;140:411–432. doi: 10.1104/pp.105.073783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Oelkers PD, Cromley M, Padamsee J, Billheimer T, Sturley SL. The DGA1 gene determines a second triglyceride synthetic pathway in yeast. J Biol Chem. 2002;277(11):8877–8881. doi: 10.1074/jbc.M111646200. [DOI] [PubMed] [Google Scholar]
  33. Pan X, Peng FY, Weselake RJ. Genome-wide analysis of phospholipid: diacylglycerol acyltransferase (PDAT) genes in plants reveal the eudicot-wide PDAT gene expansion and altered selective pressures acting on the core eudicot PDAT paralogs. Plant Physiol. 2015;167(3):887–904. doi: 10.1104/pp.114.253658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Pan X, Siloto RMP, Wickramarathna AD, Mietkiewska E, Weselake RJ. Identification of a Pair of Phospholipid: Diacylglycerol Acyltransferases from Developing Flax (Linum usitatissimum L.) seed catalyzing the Selective Production of Trilinolenin. J Biol Chem. 2013;288(33):24173–24188. doi: 10.1074/jbc.M113.475699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Peng D, Zhang L, Tan X, Yuan D, Liu X, Zhou B (2016) Increasing seed oil content and altering oil quality of Brassica napus L. by over-expression of diacylglycerol acyltransferase 1 (SsDGAT1) from Sapium sebiferum (L.) Roxb. Molecular Breeding.36 (10).1–14
  36. Roman A, Andreu V, Hernandez ML, Lagunas B, Picorel R, Martinez-Rivas JM, et al. Contribution of the different omega-3 fatty acid desaturase genes to the cold response in soybean. J Exp Bot. 2012;63(13):4973–4982. doi: 10.1093/jxb/ers174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Shockey JM, Dhanoa PK, Dupuy T, Chapitala DC, Mullen RT. Cloning, functional analysis, and subcellular localization of two isoforms of NADH: cytochrome b5 reductase from developing seeds of tung (Vernicia fordii) Plant Sci. 2005;169(2):375–385. [Google Scholar]
  38. Simopoulos AP. An increase in the omega-6/omega-3 fatty acid ratio increases the risk for obesity. Nutrients. 2016;8(3):128. doi: 10.3390/nu8030128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Stahl U, Carlsson AS, Lenman M, Dahlqvist A, Huang B, Banas W, Banas A, Stymne S. Cloning and functional characterization of a phospholipid: diacylglycerol acyltransferase from Arabidopsis. Plant Physiol. 2004;135(3):1324–1335. doi: 10.1104/pp.104.044354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tomiyama T, Kurihara K, Ogawa T, Maruta T, Ogawa T, Ohta D, Sawa Y, Ishikawa T. Wax ester synthase/diacylglycerol acyltransferase isoenzymes play a pivotal role in wax ester biosynthesis in Euglena gracilis. Sci Rep. 2017;7(1):1–13. doi: 10.1038/s41598-017-14077-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Troncoso-Ponce MA, Kilaru A, Cao X, Durrett TP, Fan J, Jensen JK, Thrower NA, Pauly M, Wilkerson C, Ohlrogge JB. Comparative deep transcriptional profiling of four developing oilseeds. Plant J. 2011;68(6):1014–1027. doi: 10.1111/j.1365-313X.2011.04751.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Turchetto-Zolet AC, Maraschin FS, de Morais GL, Cagliari A, Andrade CM, et al. Evolutionary view of acyl-CoA diacylglycerol acyltransferase (DGAT), a key enzyme in neutral lipid biosynthesis. BMC Evol Biol. 2011;11(1):1–14. doi: 10.1186/1471-2148-11-263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Van EH, Bates PD, Burgal J, Shockey J, Browse J. Castor phospholipid: diacylglycerol acyltransferase facilitates efficient metabolism of hydroxyl fatty acids in transgenic Arabidopsis. Plant Physiol. 2011;155(2):683–693. doi: 10.1104/pp.110.167239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Vrinten P, Hu ZY, Munchinsky MA, Rowland G, Qiu X. Two FAD3 desaturase genes control the level of linolenic acid in flax seed. Plant Physiol. 2005;139(1):79–87. doi: 10.1104/pp.105.064451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wagner M, Hoppe K, Czabany T, Heilmann M, Daum G, Feussner I, Fulda M. Identification and characterization of an acyl-CoA: diacylglycerol acyltransferase 2 (DGAT2) gene from the microalga O. tauri. Plant Physiol Biochem. 2010;48(6):407–416. doi: 10.1016/j.plaphy.2010.03.008. [DOI] [PubMed] [Google Scholar]
  46. Wei X, Liu K, Zhang Y, et al. Genetic discovery for oil production and quality in sesame. Nat Commun. 2015;6:8609. doi: 10.1038/ncomms9609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Xue Y, Chen B, Win AN, Fu C, Lian J, Liu X, et al. Omega-3 fatty acid desaturase gene family from two ω-3 sources, Salvia hispanica and Perilla frutescens: Cloning, characterization and expression. PLoS ONE. 2018;13(1):e0191432. doi: 10.1371/journal.pone.0191432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Xue Y, Yin N, Chen B, Liao F, Win AN, Jiang J, et al. Molecular cloning and expression analysis of two FAD2 genes from chia (Salvia hispanica) Acta Physiol Plant. 2017;39(4):95. [Google Scholar]
  49. Yang Q, Fan C, Guo Z, Qin J, Wu J, Li Q, et al. Identification of FAD2 and FAD3 genes in Brassica napus genome and development of allele-specific markers for high oleic and low linolenic acid contents. Theor Appl Genet. 2012;125(4):715–729. doi: 10.1007/s00122-012-1863-1. [DOI] [PubMed] [Google Scholar]
  50. Yoon K, Han D, Li Y, Sommerfeld M, Hu Q. Phospholipid: diacylglycerol acyltransferase is a multifunctional enzyme involved in membrane lipid turnover and degradation while synthesizing triacylglycerol in the unicellular green microalga Chlamydomonas reinhardtii. Plant Cell. 2012;24(9):3708–3724. doi: 10.1105/tpc.112.100701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Yuan L, Mao X, Zhao K, Ji X, Ji C, Xue J, Li R. Characterisation of phospholipid: diacylglycerol acyltransferases (PDATs) from Camelina sativa and their roles in stress responses. Biology open. 2017;6(7):1024–1034. doi: 10.1242/bio.026534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zou J, Wei Y, Jako C, Kumar A, Selvaraj G, et al. The Arabidopsis thaliana TAG1 mutant has a mutation in a diacylglycerol acyltransferase gene. Plant J. 1999;19(6):645–653. doi: 10.1046/j.1365-313x.1999.00555.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 2 (52.9KB, docx)
Supplementary Material 3 (166.6KB, docx)
Supplementary Material 4 (496.2KB, docx)
Supplementary Material 5 (324.9KB, docx)

Data Availability Statement

All the appropriate information is provided in the manuscript and supplementary files.


Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer

RESOURCES