Abstract
Introduction: As the most frequent type of birth defect in humans, congenital heart disease (CHD) leads to a large amount of morbidity and mortality as well as a tremendous socioeconomic burden. Accumulating studies have convincingly substantiated the pivotal roles of genetic defects in the occurrence of familial CHD, and deleterious variations in a great number of genes have been reported to cause various types of CHD. However, owing to pronounced genetic heterogeneity, the hereditary components underpinning CHD remain obscure in most cases. This investigation aimed to identify novel genetic determinants underlying CHD. Methods and results: A four-generation pedigree with high incidence of autosomal-dominant CHD was enrolled from the Chinese Han race population. Using whole-exome sequencing and Sanger sequencing assays of the family members available, a novel SOX7 variation in heterozygous status, NM_031439.4: c.310C>T; p.(Gln104*), was discovered to be in co-segregation with the CHD phenotype in the whole family. The truncating variant was absent in 500 unrelated healthy subjects utilized as control individuals. Functional measurements by dual-luciferase reporter analysis revealed that Gln104*-mutant SOX7 failed to transactivate its two important target genes, GATA4 and BMP2, which are both responsible for CHD. In addition, the nonsense variation invalidated the cooperative transactivation between SOX7 and NKX2.5, which is another recognized CHD-causative gene. Conclusion: The present study demonstrates for the first time that genetically defective SOX7 predisposes to CHD, which sheds light on the novel molecular mechanism underpinning CHD, and implies significance for precise prevention and personalized treatment in a subset of CHD patients.
Keywords: Congenital heart disease, medical genetics, transcriptional regulation, SOX7, dual-luciferase analysis
Introduction
Congenital heart disease (CHD) represents the most frequent classification of human developmental deformity with an estimated prevalence of 1% in live newborns, accounting for about 30% of all major birth malformations worldwide [1,2]. In the United States, CHD afflicts nearly 40,000 newborns per year [1,2]. Notably, when minor cardiovascular anomalies, such as right-sided aortic arch, aneurysm of the atrial septum and bicuspid aortic valve, the most prevalent type of CHD with an incidence of 1 to 2 per 100 of the population, are encompassed, the prevalence of CHD may be as high as ~5% [3]. In terms of specific anatomic and hemodynamic lesions, CHD is classified into over 21 distinct subtypes, such as ventricular septal defect (VSD), pulmonary stenosis (PS), atrial septal defect, patent ductus arteriosus (PDA), persistent truncus arteriosus, tetralogy of Fallot, single ventricle, endocardial cushion defect, double-outlet right ventricle, pulmonary atresia, anomalous pulmonary venous connection, valvular aortic stenosis, and hypoplastic left heart [1,2]. Although some mild cardiac anomalies can resolve spontaneously with little apparent clinical significance [4], severe CHD may give rise to reduced health-related quality of life [5,6], poor exercise performance [7-9], impaired neurodevelopment and structural brain abnormality [10-13], ischemic or hemorrhagic stroke [14,15], pulmonary arterial hypertension or Eisenmenger syndrome [16-18], abnormal kidney development or kidney injury [19,20], metabolic syndrome [21-24], infective endocarditis or central nervous system infection [25,26], congestive heart failure [27-29], cardiac arrhythmias [30-34], and even demise [35-37]. CHD remains the most common etiology of neonatal death caused by birth deformations, with ~24% of neonates who died of congenital anomalies suffering heart defects [4], and in the American children with congenital defects, CHD leads to approximately 40% of child death [38]. Although tremendous advances have been achieved recently in surgical procedures and perioperative intensive care of CHD, which allow up to 95% of infants affected with CHD to survive into adulthood reaching fertile age, the comorbidity, morbidity and mortality increased significantly in the increasing population of adult patients suffering from CHD [2]. Consequently, CHD inflicts a vast socioeconomic burden on humans [1]. In spite of the prevalence and clinical significance, the molecular pathogenesis underpinning CHD is still incompletely understood.
In vertebrates, during the embryogenesis the heart is the first functional organ formed, and cardiac development is an extremely complex biological process, which requires the accurate spatiotemporal cooperation of various cardiogenesis-related factors, involving the intricate cross talk amongst transcription factors, signaling molecules, epigenetic modifiers, and structural proteins [2]. Previous studies have substantiated that both environmental risk factors and inheritable pathogenic components may disturb this developmental process, leading to CHD [2,3,39-42]. The well-known non-genetic maternal risk factors predispose to offspring’s CHD include viral infections, nutritional deficiency, autoimmune disorder, diabetes mellitus, hyperhomocysteinemia, and administration of drugs as well as long-term exposures to toxicants and ionizing radiation during early gestation [39,40]. In addition, the nongenetic paternal risk factors, encompassing advanced age, wine drinking, cigarette smoking, and exposure to chemicals, also confer an increased risk of CHD [41]. However, accumulating research highlights a strong genetic basis of CHD, especially in familial CHD, where CHD is frequently inherited in an autosomal-dominant mode, though autosomal-recessive and X-linked inheritance patterns are also covered [2,3,42,43]. The earliest uncovered heritable causes of CHD are aneuploidies, the chromosomal anomalies that are preferentially associated with syndromic types of CHD, including trisomy 13 (Patau syndrome), trisomy 18 (Edwards syndrome) and monosomy X (Turner syndrome) [2,43]. Other chromosomal abnormalities underpinning CHD include chromosomal microdeletions and microduplications, such as 1p36 deletion syndrome, 22q11.2 deletion syndrome and 22q11.2 duplication syndrome [2]. To date, in addition to chromosomal copy number variations, an increasing number of deleterious variations in over 80 genes have been discovered to cause CHD in humans, among which the majority encode cardiac transcription factors, myocardial structural proteins, chromatin modifiers, cellular signal molecules and extracellular matrix proteins [2,3,42-70]. However, CHD is genetically heterogeneous, with less than 30% of CHD patients having established genetic defects [42], hence the hereditary culprit components underlying CHD remain to be elusive in a large proportion of cases.
Materials and methods
Recruitment and clinical investigation of study participants
A four-generation pedigree with high incidence of CHD (Family 1) was identified from the Chinese Han-ethnicity population, where CHD was inherited as an autosomal-dominant trait. All the family members available were enlisted for the present investigation. A total of 500 unrelated healthy volunteers without family history of CHD were recruited as control people. The control subjects and CHD patients were ethnically matched. All study participants underwent a comprehensive clinical assessment by cardiologists, encompassing a thorough review of individual medical records and familial disease histories, careful physical examination, echocardiography with color Doppler and 12-lead electrocardiographic measurements. In the family members suffering from CHD, cardiac catheterization procedures and/or open-heart surgeries were carried out when strongly indicated. Diagnosis of CHD was made as previously described [69]. Familial CHD was defined as the CHD occurring in a minimum of 2 family members from the same family. The current study was performed in conformity with the ethical tenets outlined in the Declaration of Helsinki. The protocols used in the present study were approved by the local institutional medical ethics committee (ethical approval number: LL(H)-09-07). Written specific informed consent was obtained after the interview procedures from the study subjects or the legally authorized guardians of subjects less than 18 years of age. Based on the appropriate informed assent and approval of the Medical Ethics Committee of local institution, clinical data and blood samples were collected from all study individuals.
Molecular genetic studies
Genomic deoxyribonucleic acid (DNA) was purified from the blood leukocytes of study participants by utilizing a genomic DNA extraction kit (Promega, USA). The quality as well as quantity of the DNA specimens was determined with a spectrophotometer (Thermo Fisher Scientific, USA). Whole exome sequencing (WES) were conducted on DNA samples of family members as previously described [71-75]. Briefly, for each family member subject to WES, 3 µg of genomic DNA sample was fragmented randomly into segments of 150-300 bp by sonication utilizing a sonicator (Covaris, USA) to generate an exome library. Exome libraries were enriched by ligation-mediated polymerase chain reaction (PCR) and captured employing the Human All Exon V6 Kit (Agilent Technologies, USA). Appropriate amounts of the captured exome libraries were sequenced on HiSeq 2000 Genome Analyzer (Illumina, USA) following the standard Illumina protocols. Bioinformatic analysis was made as described elsewhere [71-75]. In short, raw sequencing reads for each family member were aligned with human genome (Build GRCh37, also known as hg19) with the program BWA [76]. The GATK program was implemented to call sequence variants [77]. The ANNOVAR software was employed to make functional annotation of a genetic variant [78]. All common variants with minor allele frequencies greater than 0.1% in the population were filtered out. Variants occurring outside of coding exons and splicing donors/acceptors as well as exonic variants encoding synonymous single nucleotide polymorphisms were also excluded. Variations were further filtered according to the mode of inheritance revealed by examination of the pedigree (Family 1 was considered for autosomal dominant pattern of inheritance).
The variants that passed through the filters was further verified by Sanger sequencing and segregation assays in all available family members of Family 1. For a deleterious variation verified in a family affected with CHD, the gene carrying the variation were sequenced in 500 unrelated healthy persons, and the population genetics databases of the Human Gene Mutation Database (HGMD; http://www.hgmd.cf.ac.uk/ac/index.php), Single Nucleotide Polymorphism database (dbSNP; https://www.ncbi.nlm.nih.gov/snp/) and Genome Aggregation Database (gnomAD; http://exac.broadinstitute.org/) were retrieved to check its novelty.
Construction of expression plasmids
Total RNA was purified from human myocardial samples (collected from the discarded heart muscle tissues of the patients undergoing cardiac surgery) with TRIzol reagent (Invitrogen, USA), and cDNA was produced by reverse transcription-PCR with the OneStep RT-PCR Kit (Qiagen, Germany). The entire coding region (open read frame) of human SOX7 gene (GenBank accession no. NM_031439.4) was PCR-amplified from cDNA utilizing DNA polymerase (Stratagene, USA) and specific primers (forward: 5’-GAAGCTAGCGACCCGTGCGAGGGCCAGGT-3’; backward: 5’-TTCTCTAGAGGCGCGAGGGCTGACCGGAC-3’). The produced 1285-bp amplicons containing entire SOX7 cDNA was doubly cut with restriction endonucleases NheI (NEB, USA) and XbaI (NEB), and inserted into the plasmid pcDNA3.1 (Invitrogen) to generate the expression plasmid SOX7-pcDNA3.1. The Gln104*-mutant SOX7-pcDNA3.1 plasmid was created by site-directed mutagenesis of wild-type SOX7-pcDNA3.1 with the GeneArt® Site-Directed Mutagenesis System (Life Technologies, USA) with a complementary pair of primers (forward primer: 5’-GAGCGGCTGCGCCTGTAGCACATGCAGGACT-3’; backward primer: 5’-AGTCCTGCATGTGCTACAGGCGCAGCCGCTC-3’) as per manufacturer’s protocols, and was validated by Sanger sequencing. The NKX2.5-pEFSA plasmid expressing human NKX2.5 protein was generously given by Prof. Ichiro Shiojima at Chiba University, Japan [69]. The BMP2 promoter-driven firefly luciferase reporter plasmid (BMP2-luc) was produced as described elsewhere [79]. Another firefly luciferase reporter (GATA4-luc), where expression of firefly luciferase reporter was driven by the promoter of human GATA4 gene, was described elsewhere [69].
Cellular transfection and dual-luciferase assay
HeLa and COS-7 cells were seeded into wells of a 24-well plate (BD Biosciences, USA), and grown in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich, USA) containing 10% fetal bovine serum (Thermo Fisher Scientific, USA) as well as 1% penicillin-streptomycin (Thermo Fisher Scientific). Cells were cultured at 37°C in an incubator with an atmosphere of 5% CO2 and 95% air. At ~80% confluence, cells were transiently transfected with various plasmids as previously described in detail [69]. Cells were collected 24 h after transfection and subsequently lysed with 1 × lysis buffer. The luciferase activity of cellular lysates was determined with a dual-luciferase reporter assay system (Promega) on a microplate luminometer (Promega), following the manufacturers’ protocols. The ratio (fold activation) of firefly to renilla luciferase activity represented the activity of a given promoter [69].
Statistics
Promoter activity values were given as mean ± standard deviation. Student’s t test was applied when comparison was performed between two groups, and one-way analysis of variance accompanied by post hoc Fisher’s test was applied for comparison among multiple groups. A two-sided P value < 0.05 was considered to indicate a significant difference. All statistical calculations were completed with GraphPad Prism version 8.0 (GraphPad, USA).
Results
Clinical characteristic profiles of the study family
In this study, a four-generation pedigree afflicted with CHD (Figure 1A) was enrolled from the Chinese Han-race population, including 34 living family members (16 female members and 18 male members) with ages ranging from 2 years to 57 years. In the whole family, all affected members had echocardiogram-documented PDA, while the unaffected members had normal echocardiographic images. Genetic analysis of the pedigree unveiled that PDA was inherited as an autosomal-dominant trait. The index patient (IV-1), a 10-year-old boy with a family history of CHD, was diagnosed with PDA and VSD, and underwent surgical closure of the defects when he was six years old. Notably in the proband’s family, in addition to PDA, six affected family members (I-1, II-1, II-4, III-2, III-5 and IV-1) also suffered from VSD, and four affected members (I-1, II-4, II-7 and III-5) also suffered from PS. Besides, two affected family members (I-1 and II-4) died because of CHD-related severe heart failure in their fifties (aging 55 years and 53 years, respectively). The clinical characteristic information of the affected members is provided in Table 1.
Figure 1.
A SOX7 variation leading to familial congenital heart disease. A. Pedigree displaying autosomal dominant inheritance of patent ductus arteriosus in Family 1. Genotype of each family member is marked with + or -, of which + indicates a member carrying the heterozygous SOX7 mutation, while-indicates a member without the given SOX7 mutation. B. Sequence chromatograms of the family members. The heterozygous nucleotide change of c.310C>T in the SOX7 gene was proved by Sanger sequencing in the members affected with CHD including the proband (IV-1, mutant), predicted to yield a truncated SOX7 protein (Gln104*) as compared to the unaffected members including the proband’s father (III-1, wild type). Each codon of SOX7 is underlined with its encoded amino acid shown above. A black arrow points to the position of the altered nucleotide or the corresponding wild-type nucleotide in the SOX7 gene. C. Schematic representations illustrating the structural domains of human SOX7 proteins with deletion of 285 amino acids at the carboxyl-terminus of mutant SOX7 protein. TAD: transcriptional activation domain; HMG: high mobility group.
Table 1.
Clinical characteristic profiles of the affected pedigree members with congenital heart disease as well as the identified SOX7 variation
| Individual (Family 1) | Gender | Age (years) | Cardiac structural defects | SOX7 variation (Gln104*) |
|---|---|---|---|---|
| I-1 | Male | 55* | PDA, VSD, PS | NA |
| II-1 | Male | 57 | PDA, VSD | +/- |
| II-4 | Female | 53* | PDA, VSD, PS | NA |
| II-7 | Male | 50 | PDA, PS | +/- |
| III-2 | Female | 33 | PDA, VSD | +/- |
| III-5 | Male | 31 | PDA, VSD, PS | +/- |
| III-9 | Male | 26 | PDA | +/- |
| IV-1 | Male | 10 | PDA, VSD | +/- |
| IV-6 | Female | 2 | PDA | +/- |
PDA: patent ductus arteriosus; VSD: ventricular septal defect; PS: pulmonary stenosis; NA: not applicable or available; +/-: carrier for the heterozygous SOX7 variation.
Age at death.
Discovery of a new CHD-causative SOX7 mutation
WES was conducted on the DNA samples of six members affected with CHD (II-1, II-7, III-2, III-9, IV-1 and IV-6) and four healthy members without CHD (II-2, II-8, III-1 and III-10) from Family 1 (Figure 1A), yielding an average of 23-gigabase DNA sequence data per DNA sample, with an average of 98% of the DNA sequences mapped on the reference human genome (hg19). The mean read depth was ~310×, with a minimum of 78% of target regions covered to a depth greater than 20×. An average of 17,692 (ranging from 16,904 to 18,536) variations occurring in exons and splicing donors/acceptors per family member passed inheritance model filtering and had minor allele frequencies < 0.1%, among which 8 heterozygous missense and nonsense variations passed ANNOVAR filtering, and were present in the six affected family members (Table 2). Among the final 8 candidate CHD-causing variants (Table 2), merely the pathogenic variant chr8:10584105C>T (GRCh37: GenBank accession no. NC_000008.10), equal to chr8:10727684C>T (GRCh38: GenBank accession no. NC_000008.11) or NM_031439.4: c.310C>T; p.(Gln104*) in the SOX7 gene, was verified by Sanger sequencing using the designed primer pairs (Table 3), and shown to be in co-segregation with CHD in the family as a whole. The electropherograms exhibiting the heterozygous SOX7 variation as well as its homozygous wild-type base are illustrated in Figure 1B. The schematic drawings displaying pivotal structural domains of both wild-type and Gln104*-mutant SOX7 proteins are presented in Figure 1C. The nonsense variation was neither observed in 1000 control chromosomes nor found in the HGMD, gnomAD or dbSNP database, indicating a new CHD-causative variation.
Table 2.
Nonsynonymous variants in candidate genes for familial congenital heart disease discovered by whole-exome sequencing and bioinformatic analyses
| Chr | Position (GRCh37) | Ref | Alt | Gene | Variant |
|---|---|---|---|---|---|
| 1 | 11,883,887 | G | C | CLCN6 | NM_001286.5: c.577G>C; p.(Gly193Arg) |
| 2 | 77,746,721 | G | A | LRRTM4 | NM_001134745.3: c.277G>A; p.(Asp93Asn) |
| 3 | 114,057,953 | T | C | ZBTB20 | NM_001164342.2: c.1906T>C; p.(Cys636Arg) |
| 5 | 15,928,503 | G | T | FBXL7 | NM_012304.5: c.632G>T; p.(Cys211Phe) |
| 8 | 10,727,684 | C | T | SOX7 | NM_031439.4: c.310C>T; p.(Gln104*) |
| 12 | 65,460,453 | C | T | WIF1 | NM_007191.5: c.698C>T; p.(Pro233Leu) |
| 17 | 4,015,923 | A | T | ZZEF1 | NM_015113.4: c.1046A>T; p.(Asn349Ile) |
| 19 | 52,376,374 | G | T | ZNF577 | NM_032679.3: c.869G>T; p.(Arg290Ile) |
Chr: chromosome; Ref: reference; Alt: alteration.
Table 3.
Primers used for amplification of the coding regions and splicing donors/acceptors of the SOX7 gene
| Coding exon | Upstream (forward) primer (5’→3’) | Downstream (backward) primer (5’→3’) | Amplicon (bp) |
|---|---|---|---|
| 1 | GATAAATCAGGGGCCGGGTC | GTTTCACTTTGGACCGCGCC | 567 |
| 2-a | GGGAAGAGGGTGCAAGAGAT | CTACAGTGGAGAGGGCTTGG | 675 |
| 2-b | CCCACACCTCCTGAAATGTC | GTGGGAGGAAAGCTGGTGTG | 660 |
No transactivation of the BMP2 promoter by Gln104*-mutant SOX7
As illustrated in Figure 2, wild-type SOX7 (SOX7) properly transactivated the BMP2 promoter, with ~8-fold increase in luciferase activity relative to empty backbone pcDNA3.1 (pcDNA3.1) plasmid as a blank control; while Gln104*-mutant SOX7 (Gln104*) failed to transcriptionally activate the BMP2 promoter, with a similar reporter activity with blank control (SOX7 vs Gln104*: t = 9.72325, P = 0.00062). In the heterozygous status with an equimolar amount of SOX7 and Gln104* co-expressed, the induced transcriptional activation of the BMPP2 promoter was ~4-fold, a decrease by ~50% in reporter activity compared with that in homozygous status (SOX7 + pcDNA3.1 vs SOX7 + Gln104*: t = 4.68938, P = 0.00938).
Figure 2.

Nullified transactivation function of Gln104*-mutant SOX7. In cultured COS-7 cells transfected with eukaryotic expression plasmids, biologic analysis of transcriptional activation of the BMP2 promoter-driven firefly luciferase reporter by wild-type SOX7 (SOX7) or Gln104*-mutant SOX7 (Gln104*), singly or together, revealed that SOX7 normally transactivated the promoter of the target gene BMP2, whereas Gln104* failed to do so. Here unpaired Student’s t test was used. **Denotes P < 0.01, and *denotes P < 0.001, when compared wto an equal amount of SOX7.
Synergistic transcriptional activation between NKX2.5 and SOX7 abrogated by the mutation
As illustrated in Figure 3, SOX7 and Gln104* transactivated the GATA4 promoter by ~4-fold and ~1-fold, respectively (SOX7 vs Gln104*: t = 6.21049, P = 0.00342); while in combination with NKX2.5, SOX7 and Gln104* transactivated the GATA4 promoter by ~18-fold and ~2-fold, respectively (SOX7 + NKX2.5 vs Gln104* + NKX2.5: t = 9.31103, P = 0.00074).
Figure 3.

Synergistic transactivation between SOX7 and NKX2.5 abrogated by the variation. In transfected HeLa cells, measurement of activation of the GATA4 promoter-driven firefly luciferase reporter by wild-type SOX7 (SOX7) or Gln104*-mutant SOX7 (Gln104*), alone or together with NKX2.5, unveiled that the synergistic transcriptional activation between NKX2.5 and SOX7 was disrupted by the Gln104* mutation. Here unpaired Student’s t test was used. **Indicates P < 0.001, and *indicates P < 0.005, in comparison to their wild-type counterparts.
Discussion
The current study used whole exome sequencing (WES) and informatics analyses of a Chinese family afflicted with autosomal dominant CHD. A new variation in heterozygous status, NM_031439.4: c.310C>T; p.(Gln104*), was uncovered in the SOX7 gene, a key regulator for proper cardiovascular development [79]. The nonsense mutation was substantiated by Sanger sequencing analysis and shown to be in to co-segregation with the CHD phenotype in the whole family. The mutation was neither present in 1000 reference human chromosomes nor retrieved in such population genetics databases as HGMD, gnomAD and dbSNP. Functional studies revealed that the Gln104*-mutant SOX7 protein did not transactivate its two key downstream genes of GATA4 and BMPP2, which have been both substantiated to play an important role in cardiovascular morphogenesis, and loss-of-function mutations in both GATA4 and BMPP2 have been found to result in CHD [80,81].
Additionally, the mutation nullified the synergistic transcriptional activation between SOX7 and NKX2.5, another key gene for proper cardiovascular development where loss-of-function mutations have been causally linked to CHD [82]. Therefore, it is very likely that monoallelic SOX7 mutation predicted to result in haploinsufficiency leads to CHD in this Chinese family.
SOX7 maps to human chromosome 8p23.1, which codes for a member of the high-mobility-group transcription factor family, comprizing 388 amino acids. In mammals including mice and humans, SOX7 is amply expressed in the developing heart [79]. Previous investigations have demonstrated that SOX7 functions as a transcriptional mediator of several key target genes abundantly expressed in the developing heart, such as BMP2, GATA4 and GATA6 [79,83], alone or synergistically with such transcriptionally cooperated partner as NKX2.5 [69], and pathogenic variations in the genes NKX2.5, GATA4, GATA6 and BMP2 have been involved in the occurrence of CHD [80-82,84]. In the present study, the nonsense variation was anticipated to create a truncating SOX7 protein with no transactivation domain as well as partial high-mobility-group domain. Hence, the mutation was anticipated to abolish the transactivation function of SOX7, which was validated by reporter gene assays. Taken collectively, these findings support that SOX7 loss-of-function variation predisposes to CHD, probably by downregulating expression of downstream genes required for normal cardiovascular development.
Previous studies on experimental animal models have revealed that genetically compromised SOX7 leads to CHD. In Xenopus, knockdown of either Sox7 or Sox18 led to partial inhibition of cardiogenesis, while knockdown of both Sox7 and Sox18 strongly inhibited cardiogenesis [85]. Moreover, Sox7 RNA rescued the effects of the Sox18 morpholino and vice versa, suggesting that the two proteins share redundant functions [85]. In mice, global knockout of Sox7 caused embryonic death with developmentally retarded embryos characteristic of dilated pericardial sacs as well as failure of yolk sac remodeling, suggesting cardiovascular failure [86]. Similarly, endothelial-specific knockout of Sox7 led to murine embryonic lethality with cardiovascular failure and severely impaired angiogenesis [79]. In addition, conditional endocardial Sox7 deficiency in mice caused abnormal atrioventricular cushion formation and partial atrioventricular septal defect as well as defects in closure of the atrial septum and ventricular septum [79]. Furthermore, Sox7 was demonstrated to modulate the endothelial to mesenchymal transition process by WNT4-BMP2 signaling, essential for proper atrioventricular cushion formation [79]. In humans, both microdeletions of 8p23.1 that contains SOX7 and duplication of SOX7 have been associated with congenital cardiac septal defects [79,87,88]. Besides, as another member of the SOX-F gene family (SOX18, SOX17 and SOX7), SOX17 loss-of-function mutations have been discovered to give rise to CHD [69,89,90]. These observational results together with the present research data highlight compelling evidence suggesting that haploinsufficiency of SOX7 contributes to the occurrence of CHD in humans and animals.
Conclusion
In summary, the current investigation first indicates SOX7 as a causative gene of familial CHD, which sheds light on the novel molecular basis underlying CHD, and is instrumental to designing prevention and therapy for CHD.
Acknowledgements
This work was funded by grants from the Basic Research Project of Shanghai (grant number 20JC1418800), the Medicine Guided Program of Shanghai (grant number 19411971900) and the National Natural Science Foundation of China (grant number 81641014).
Disclosure of conflict of interest
None.
References
- 1.Virani SS, Alonso A, Aparicio HJ, Benjamin EJ, Bittencourt MS, Callaway CW, Carson AP, Chamberlain AM, Cheng S, Delling FN, Elkind MSV, Evenson KR, Ferguson JF, Gupta DK, Khan SS, Kissela BM, Knutson KL, Lee CD, Lewis TT, Liu J, Loop MS, Lutsey PL, Ma J, Mackey J, Martin SS, Matchar DB, Mussolino ME, Navaneethan SD, Perak AM, Roth GA, Samad Z, Satou GM, Schroeder EB, Shah SH, Shay CM, Stokes A, Van Wagner LB, Wang NY, Tsao CW American Heart Association Council on Epidemiology and Prevention Statistics Committee and Stroke Statistics Subcommittee. Heart disease and stroke statistics - 2021 update: a report from the American Heart Association. Circulation. 2021;143:e254–e743. doi: 10.1161/CIR.0000000000000950. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Saliba A, Figueiredo ACV, Baroneza JE, Afiune JY, Pic-Taylor A, Oliveira SF, Mazzeu JF. Genetic and genomics in congenital heart disease: a clinical review. J Pediatr (Rio J) 2020;96:279–288. doi: 10.1016/j.jped.2019.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Martin LJ, Benson DW. Focused strategies for defining the genetic architecture of congenital heart defects. Genes (Basel) 2021;12:827. doi: 10.3390/genes12060827. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Virani SS, Alonso A, Benjamin EJ, Bittencourt MS, Callaway CW, Carson AP, Chamberlain AM, Chang AR, Cheng S, Delling FN, Djousse L, Elkind MSV, Ferguson JF, Fornage M, Khan SS, Kissela BM, Knutson KL, Kwan TW, Lackland DT, Lewis TT, Lichtman JH, Longenecker CT, Loop MS, Lutsey PL, Martin SS, Matsushita K, Moran AE, Mussolino ME, Perak AM, Rosamond WD, Roth GA, Sampson UKA, Satou GM, Schroeder EB, Shah SH, Shay CM, Spartano NL, Stokes A, Tirschwell DL, Van Wagner LB, Tsao CW American Heart Association Council on Epidemiology and Prevention Statistics Committee and Stroke Statistics Subcommittee. Heart disease and stroke statistics - 2020 update: a report from the American Heart Association. Circulation. 2020;141:e139–e596. doi: 10.1161/CIR.0000000000000757. [DOI] [PubMed] [Google Scholar]
- 5.Moons P, Luyckx K, Thomet C, Budts W, Enomoto J, Sluman MA, Lu CW, Jackson JL, Khairy P, Cook SC, Chidambarathanu S, Alday L, Eriksen K, Dellborg M, Berghammer M, Johansson B, Mackie AS, Menahem S, Caruana M, Veldtman G, Soufi A, Fernandes SM, White K, Callus E, Kutty S, Ombelet F, Apers S, Kovacs AH APPROACH-IS Consortium and the International Society for Adult Congenital Heart Disease (ISACHD) Physical functioning, mental health, and quality of life in different congenital heart defects: comparative analysis in 3538 patients from 15 countries. Can J Cardiol. 2021;37:215–223. doi: 10.1016/j.cjca.2020.03.044. [DOI] [PubMed] [Google Scholar]
- 6.Truong TH, Kim NT, Nguyen MT, Do DL, Nguyen HT, Le TT, Le HA. Quality of life and health status of hospitalized adults with congenital heart disease in Vietnam: a cross-sectional study. BMC Cardiovasc Disord. 2021;21:229. doi: 10.1186/s12872-021-02026-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Spiesshoefer J, Orwat S, Henke C, Kabitz HJ, Katsianos S, Borrelli C, Baumgartner H, Nofer JR, Spieker M, Bengel P, Giannoni A, Dreher M, Boentert M, Diller GP. Inspiratory muscle dysfunction and restrictive lung function impairment in congenital heart disease: association with immune inflammatory response and exercise intolerance. Int J Cardiol. 2020;318:45–51. doi: 10.1016/j.ijcard.2020.06.055. [DOI] [PubMed] [Google Scholar]
- 8.Hayama Y, Ohuchi H, Negishi J, Iwasa T, Sakaguchi H, Miyazaki A, Tsuda E, Kurosaki K. Effect of stiffened and dilated ascending aorta on aerobic exercise capacity in repaired patients with complex congenital heart disease. Am J Cardiol. 2020;129:87–94. doi: 10.1016/j.amjcard.2020.05.028. [DOI] [PubMed] [Google Scholar]
- 9.Meyer M, Brudy L, García-Cuenllas L, Hager A, Ewert P, Oberhoffer R, Müller J. Current state of home-based exercise interventions in patients with congenital heart disease: a systematic review. Heart. 2020;106:333–341. doi: 10.1136/heartjnl-2019-315680. [DOI] [PubMed] [Google Scholar]
- 10.Asschenfeldt B, Evald L, Heiberg J, Salvig C, Østergaard L, Dalby RB, Eskildsen SF, Hjortdal VE. Neuropsychological status and structural brain imaging in adults with simple congenital heart defects closed in childhood. J Am Heart Assoc. 2020;9:e015843. doi: 10.1161/JAHA.120.015843. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kessler N, Feldmann M, Schlosser L, Rometsch S, Brugger P, Kottke R, Knirsch W, Oxenius A, Greutmann M, Latal B. Structural brain abnormalities in adults with congenital heart disease: prevalence and association with estimated intelligence quotient. Int J Cardiol. 2020;306:61–66. doi: 10.1016/j.ijcard.2020.02.061. [DOI] [PubMed] [Google Scholar]
- 12.Rettenmaier LA, Kirby PA, Reinking BE, Viaene AN, Hefti MM. Neuropathology of congenital heart disease in an inpatient autopsy cohort 2000-2017. J Am Heart Assoc. 2020;9:e013575. doi: 10.1161/JAHA.119.013575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Barkhuizen M, Abella R, Vles JSH, Zimmermann LJI, Gazzolo D, Gavilanes AWD. Antenatal and perioperative mechanisms of global neurological injury in congenital heart disease. Pediatr Cardiol. 2021;42:1–18. doi: 10.1007/s00246-020-02440-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Pedersen MGB, Olsen MS, Schmidt M, Johnsen SP, Learn C, Laursen HB, Madsen NL. Ischemic stroke in adults with congenital heart disease: a population-based cohort study. J Am Heart Assoc. 2019;8:e011870. doi: 10.1161/JAHA.118.011870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Giang KW, Mandalenakis Z, Dellborg M, Lappas G, Eriksson P, Hansson PO, Rosengren A. Long-term risk of hemorrhagic stroke in young patients with congenital heart disease. Stroke. 2018;49:1155–1162. doi: 10.1161/STROKEAHA.117.020032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Kaemmerer H, Gorenflo M, Huscher D, Pittrow D, Apitz C, Baumgartner H, Berger F, Bruch L, Brunnemer E, Budts W, Claussen M, Coghlan G, Dähnert I, D’Alto M, Delcroix M, Distler O, Dittrich S, Dumitrescu D, Ewert R, Faehling M, Germund I, Ghofrani HA, Grohé C, Grossekreymborg K, Halank M, Hansmann G, Harzheim D, Nemes A, Havasi K, Held M, Hoeper MM, Hofbeck M, Hohenfrost-Schmidt W, Jurevičienė E, Gumbienè L, Kabitz HJ, Klose H, Köhler T, Konstantinides S, Köestenberger M, Kozlik-Feldmann R, Kramer HH, Kropf-Sanchen C, Lammers A, Lange T, Meyn P, Miera O, Milger-Kneidinger K, Neidenbach R, Neurohr C, Opitz C, Perings C, Remppis BA, Riemekasten G, Scelsi L, Scholtz W, Simkova I, Skowasch D, Skride A, Stähler G, Stiller B, Tsangaris I, Vizza CD, Vonk Noordegraaf A, Wilkens H, Wirtz H, Diller GP, Grünig E, Rosenkranz S. Pulmonary hypertension in adults with congenital heart disease: real-world data from the international COMPERA-CHD registry. J Clin Med. 2020;9:1456. doi: 10.3390/jcm9051456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Brida M, Nashat H, Gatzoulis MA. Pulmonary arterial hypertension: closing the gap in congenital heart disease. Curr Opin Pulm Med. 2020;26:422–428. doi: 10.1097/MCP.0000000000000695. [DOI] [PubMed] [Google Scholar]
- 18.Rosenzweig EB, Krishnan U. Congenital heart disease-associated pulmonary hypertension. Clin Chest Med. 2021;42:9–18. doi: 10.1016/j.ccm.2020.11.005. [DOI] [PubMed] [Google Scholar]
- 19.Scholes GB, Zannino D, Kausman JY, Cheung MMH. Altered in utero kidney development in newborns with congenital heart disease. Pediatr Res. 2019;85:644–649. doi: 10.1038/s41390-018-0163-0. [DOI] [PubMed] [Google Scholar]
- 20.Xie Y, Jiang W, Cao J, Xie H. Dexmedetomidine attenuates acute kidney injury in children undergoing congenital heart surgery with cardiopulmonary bypass by inhibiting the TLR3/NF-kappaB signaling pathway. Am J Transl Res. 2021;13:2763–2773. [PMC free article] [PubMed] [Google Scholar]
- 21.Liu Y, Luo Q, Su Z, Xing J, Wu J, Xiang L, Huang Y, Pan H, Wu X, Zhang X, Li J, Yan F, Zhang H. Suppression of myocardial hypoxia-inducible factor-1alpha compromises metabolic adaptation and impairs cardiac function in patients with cyanotic congenital heart disease during puberty. Circulation. 2021;143:2254–2272. doi: 10.1161/CIRCULATIONAHA.120.051937. [DOI] [PubMed] [Google Scholar]
- 22.He GW, Hou HT, Xuan C, Wang J, Liu LX, Zhang JF, Liu XC, Yang Q. Corrective surgery alters plasma protein profiling in congenital heart diseases and clinical perspectives. Am J Transl Res. 2020;12:1319–1337. [PMC free article] [PubMed] [Google Scholar]
- 23.Dong S, Wu L, Duan Y, Cui H, Chen K, Chen X, Sun Y, Du C, Ren J, Shu S, Yan X, Wan X, Song J, Yan J. Metabolic profile of heart tissue in cyanotic congenital heart disease. Am J Transl Res. 2021;13:4224–4232. [PMC free article] [PubMed] [Google Scholar]
- 24.Niwa K. Metabolic syndrome and coronary artery disease in adults with congenital heart disease. Cardiovasc Diagn Ther. 2021;11:563–576. doi: 10.21037/cdt-20-781. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Cahill TJ, Jewell PD, Denne L, Franklin RC, Frigiola A, Orchard E, Prendergast BD. Contemporary epidemiology of infective endocarditis in patients with congenital heart disease: a UK prospective study. Am Heart J. 2019;215:70–77. doi: 10.1016/j.ahj.2019.05.014. [DOI] [PubMed] [Google Scholar]
- 26.Bagge CN, Smit J, Madsen NL, Olsen M. Congenital heart disease and risk of central nervous system infections: a nationwide cohort study. Pediatr Cardiol. 2020;41:869–876. doi: 10.1007/s00246-020-02324-z. [DOI] [PubMed] [Google Scholar]
- 27.Menachem JN, Schlendorf KH, Mazurek JA, Bichell DP, Brinkley DM, Frischhertz BP, Mettler BA, Shah AS, Zalawadiya S, Book W, Lindenfeld J. Advanced heart failure in adults with congenital heart disease. JACC Heart Fail. 2020;8:87–99. doi: 10.1016/j.jchf.2019.08.012. [DOI] [PubMed] [Google Scholar]
- 28.Vaikunth SS, Lui GK. Heart failure with reduced and preserved ejection fraction in adult congenital heart disease. Heart Fail Rev. 2020;25:569–581. doi: 10.1007/s10741-019-09904-z. [DOI] [PubMed] [Google Scholar]
- 29.Zengin E, Sinning C, Blaum C, Blankenberg S, Rickers C, von Kodolitsch Y, Kirchhof P, Drury NE, Stoll VM. Heart failure in adults with congenital heart disease: a narrative review. Cardiovasc Diagn Ther. 2021;11:529–537. doi: 10.21037/cdt-20-632. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Casteigt B, Samuel M, Laplante L, Shohoudi A, Apers S, Kovacs AH, Luyckx K, Thomet C, Budts W, Enomoto J, Sluman MA, Lu CW, Jackson JL, Cook SC, Chidambarathanu S, Alday L, Eriksen K, Dellborg M, Berghammer M, Johansson B, Mackie AS, Menahem S, Caruana M, Veldtman G, Soufi A, Fernandes SM, White K, Callus E, Kutty S, Brouillette J, Moons P, Khairy P of the APPROACH-IS Consortium and the International Society for Adult Congenital Heart Disease (ISACHD) Atrial arrhythmias and patient-reported outcomes in adults with congenital heart disease: an international study. Heart Rhythm. 2021;18:793–800. doi: 10.1016/j.hrthm.2020.09.012. [DOI] [PubMed] [Google Scholar]
- 31.Waldmann V, Amet D, Zhao A, Ladouceur M, Otmani A, Karsenty C, Maltret A, Soulat G, Mousseaux E, Lavergne T, Jouven X, Iserin L, Marijon E. Catheter ablation of intra-atrial reentrant/focal atrial tachycardia in adult congenital heart disease: value of final programmed atrial stimulation. Heart Rhythm. 2020;17:1953–1959. doi: 10.1016/j.hrthm.2020.05.039. [DOI] [PubMed] [Google Scholar]
- 32.Moore JP, Gallotti RG, Chiriac A, McLeod CJ, Stephenson EA, Maghrabi K, Fish FA, Kilinc OU, Bradley D, Krause U, Balaji S, Shannon KM. Catheter ablation of supraventricular tachycardia after tricuspid valve surgery in patients with congenital heart disease: a multicenter comparative study. Heart Rhythm. 2020;17:58–65. doi: 10.1016/j.hrthm.2019.07.020. [DOI] [PubMed] [Google Scholar]
- 33.Sakhi R, Kauling RM, Theuns DA, Szili-Torok T, Bhagwandien RE, van den Bosch AE, Cuypers JAAE, Roos-Hesselink JW, Yap SC. Early detection of ventricular arrhythmias in adults with congenital heart disease using an insertable cardiac monitor (EDVA-CHD study) Int J Cardiol. 2020;305:63–69. doi: 10.1016/j.ijcard.2020.02.009. [DOI] [PubMed] [Google Scholar]
- 34.Sathananthan G, Harris L, Nair K. Ventricular arrhythmias in adult congenital heart disease: mechanisms, diagnosis, and clinical aspects. Card Electrophysiol Clin. 2017;9:213–223. doi: 10.1016/j.ccep.2017.02.004. [DOI] [PubMed] [Google Scholar]
- 35.Khairy P. Ventricular arrhythmias and sudden cardiac death in adults with congenital heart disease. Heart. 2016;102:1703–1709. doi: 10.1136/heartjnl-2015-309069. [DOI] [PubMed] [Google Scholar]
- 36.Vehmeijer JT, Koyak Z, Leerink JM, Zwinderman AH, Harris L, Peinado R, Oechslin EN, Robbers-Visser D, Groenink M, Boekholdt SM, de Winter RJ, Oliver JM, Bouma BJ, Budts W, Van Gelder IC, Mulder BJM, de Groot JR. Identification of patients at risk of sudden cardiac death in congenital heart disease: the prospective study on implantable cardioverter defibrillator therapy and sudden cardiac death in adults with congenital heart disease (PREVENTION-ACHD) Heart Rhythm. 2021;18:785–792. doi: 10.1016/j.hrthm.2021.01.009. [DOI] [PubMed] [Google Scholar]
- 37.Mishra V, Zaidi S, Axiaq A, Harky A. Sudden cardiac death in children with congenital heart disease: a critical review of the literature. Cardiol Young. 2020;30:1559–1565. doi: 10.1017/S1047951120003613. [DOI] [PubMed] [Google Scholar]
- 38.Lopez KN, Morris SA, Sexson Tejtel SK, Espaillat A, Salemi JL. US mortality attributable to congenital heart disease across the lifespan from 1999 through 2017 exposes persistent racial/ethnic disparities. Circulation. 2020;142:1132–1147. doi: 10.1161/CIRCULATIONAHA.120.046822. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Kalisch-Smith JI, Ved N, Sparrow DB. Environmental risk factors for congenital heart disease. Cold Spring Harb Perspect Biol. 2020;12:a037234. doi: 10.1101/cshperspect.a037234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Patel SS, Burns TL. Nongenetic risk factors and congenital heart defects. Pediatr Cardiol. 2013;34:1535–1555. doi: 10.1007/s00246-013-0775-4. [DOI] [PubMed] [Google Scholar]
- 41.Peng J, Meng Z, Zhou S, Zhou Y, Wu Y, Wang Q, Wang J, Sun K. The non-genetic paternal factors for congenital heart defects: a systematic review and meta-analysis. Clin Cardiol. 2019;42:684–691. doi: 10.1002/clc.23194. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Pierpont ME, Brueckner M, Chung WK, Garg V, Lacro RV, McGuire AL, Mital S, Priest JR, Pu WT, Roberts A, Ware SM, Gelb BD, Russell MW American Heart Association Council on Cardiovascular Disease in the Young; Council on Cardiovascular and Stroke Nursing; and Council on Genomic and Precision Medicine. Genetic basis for congenital heart disease: revisited: a scientific statement from the American Heart Association. Circulation. 2018;138:e653–e711. doi: 10.1161/CIR.0000000000000606. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Zaidi S, Brueckner M. Genetics and genomics of congenital heart disease. Circ Res. 2017;120:923–940. doi: 10.1161/CIRCRESAHA.116.309140. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Liu X, Chen W, Li W, Priest JR, Fu Y, Pang K, Ma B, Han B, Liu X, Hu S, Zhou Z. Exome-based case-control analysis highlights the pathogenic role of ciliary genes in transposition of the great arteries. Circ Res. 2020;126:811–821. doi: 10.1161/CIRCRESAHA.119.315821. [DOI] [PubMed] [Google Scholar]
- 45.Palencia-Campos A, Aoto PC, Machal EMF, Rivera-Barahona A, Soto-Bielicka P, Bertinetti D, Baker B, Vu L, Piceci-Sparascio F, Torrente I, Boudin E, Peeters S, Van Hul W, Huber C, Bonneau D, Hildebrand MS, Coleman M, Bahlo M, Bennett MF, Schneider AL, Scheffer IE, Kibæk M, Kristiansen BS, Issa MY, Mehrez MI, Ismail S, Tenorio J, Li G, Skålhegg BS, Otaify GA, Temtamy S, Aglan M, Jønch AE, De Luca A, Mortier G, Cormier-Daire V, Ziegler A, Wallis M, Lapunzina P, Herberg FW, Taylor SS, Ruiz-Perez VL. Germline and mosaic variants in PRKACA and PRKACB cause a multiple congenital malformation syndrome. Am J Hum Genet. 2020;107:977–988. doi: 10.1016/j.ajhg.2020.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Alzahrani F, Kuwahara H, Long Y, Al-Owain M, Tohary M, AlSayed M, Mahnashi M, Fathi L, Alnemer M, Al-Hamed MH, Lemire G, Boycott KM, Hashem M, Han W, Al-Maawali A, Al Mahrizi F, Al-Thihli K, Gao X, Alkuraya FS. Recessive, deleterious variants in SMG8 expand the role of nonsense-mediated decay in developmental disorders in humans. Am J Hum Genet. 2020;107:1178–1185. doi: 10.1016/j.ajhg.2020.11.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Izarzugaza JMG, Ellesøe SG, Doganli C, Ehlers NS, Dalgaard MD, Audain E, Dombrowsky G, Banasik K, Sifrim A, Wilsdon A, Thienpont B, Breckpot J, Gewillig M Competence Network for Congenital Heart Defects, Germany. Brook JD, Hitz MP, Larsen LA, Brunak S. Systems genetics analysis identifies calcium-signaling defects as novel cause of congenital heart disease. Genome Med. 2020;12:76. doi: 10.1186/s13073-020-00772-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Hsieh A, Morton SU, Willcox JAL, Gorham JM, Tai AC, Qi H, DePalma S, McKean D, Griffin E, Manheimer KB, Bernstein D, Kim RW, Newburger JW, Porter GA Jr, Srivastava D, Tristani-Firouzi M, Brueckner M, Lifton RP, Goldmuntz E, Gelb BD, Chung WK, Seidman CE, Seidman JG, Shen Y. EM-mosaic detects mosaic point mutations that contribute to congenital heart disease. Genome Med. 2020;12:42. doi: 10.1186/s13073-020-00738-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Sevim Bayrak C, Zhang P, Tristani-Firouzi M, Gelb BD, Itan Y. De novo variants in exomes of congenital heart disease patients identify risk genes and pathways. Genome Med. 2020;12:9. doi: 10.1186/s13073-019-0709-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Morton SU, Agarwal R, Madden JA, Genetti CA, Brownstein CA, López-Giráldez F, Choi J, Seidman CE, Seidman JG, Lyon GJ, Agrawal PB. Congenital heart defects due to TAF1 missense variants. Circ Genom Precis Med. 2020;13:e002843. doi: 10.1161/CIRCGEN.119.002843. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Boskovski MT, Homsy J, Nathan M, Sleeper LA, Morton S, Manheimer KB, Tai A, Gorham J, Lewis M, Swartz M, Alfieris GM, Bacha EA, Karimi M, Meyer D, Nguyen K, Bernstein D, Romano-Adesman A, Porter GA Jr, Goldmuntz E, Chung WK, Srivastava D, Kaltman JR, Tristani-Firouzi M, Lifton R, Roberts AE, Gaynor JW, Gelb BD, Kim R, Seidman JG, Brueckner M, Mayer JE Jr, Newburger JW, Seidman CE. De novo damaging variants, clinical phenotypes, and post-operative outcomes in congenital heart disease. Circ Genom Precis Med. 2020;13:e002836. doi: 10.1161/CIRCGEN.119.002836. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Zhou S, Wang Q, Meng Z, Peng J, Zhou Y, Song W, Wang J, Chen S, Sun K. Mutations in fibroblast growth factor (FGF8) and FGF10 identified in patients with conotruncal defects. J Transl Med. 2020;18:283. doi: 10.1186/s12967-020-02445-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Alharatani R, Ververi A, Beleza-Meireles A, Ji W, Mis E, Patterson QT, Griffin JN, Bhujel N, Chang CA, Dixit A, Konstantino M, Healy C, Hannan S, Neo N, Cash A, Li D, Bhoj E, Zackai EH, Cleaver R, Baralle D, McEntagart M, Newbury-Ecob R, Scott R, Hurst JA, Au PYB, Hosey MT, Khokha M, Marciano DK, Lakhani SA, Liu KJ. Novel truncating mutations in CTNND1 cause a dominant craniofacial and cardiac syndrome. Hum Mol Genet. 2020;29:1900–1921. doi: 10.1093/hmg/ddaa050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Alankarage D, Szot JO, Pachter N, Slavotinek A, Selleri L, Shieh JT, Winlaw D, Giannoulatou E, Chapman G, Dunwoodie SL. Functional characterization of a novel PBX1 de novo missense variant identified in a patient with syndromic congenital heart disease. Hum Mol Genet. 2020;29:1068–1082. doi: 10.1093/hmg/ddz231. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Chapman G, Moreau JLM, I P E, Szot JO, Iyer KR, Shi H, Yam MX, O’Reilly VC, Enriquez A, Greasby JA, Alankarage D, Martin EMMA, Hanna BC, Edwards M, Monger S, Blue GM, Winlaw DS, Ritchie HE, Grieve SM, Giannoulatou E, Sparrow DB, Dunwoodie SL. Functional genomics and gene-environment interaction highlight the complexity of congenital heart disease caused by Notch pathway variants. Hum Mol Genet. 2020;29:566–579. doi: 10.1093/hmg/ddz270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Liu H, Giguet-Valard AG, Simonet T, Szenker-Ravi E, Lambert L, Vincent-Delorme C, Scheidecker S, Fradin M, Morice-Picard F, Naudion S, Ciorna-Monferrato V, Colin E, Fellmann F, Blesson S, Jouk PS, Francannet C, Petit F, Moutton S, Lehalle D, Chassaing N, El Zein L, Bazin A, Bénéteau C, Attié-Bitach T, Hanu SM, Brechard MP, Chiesa J, Pasquier L, Rooryck-Thambo C, Van Maldergem L, Cabrol C, El Chehadeh S, Vasiljevic A, Isidor B, Abel C, Thevenon J, Di Filippo S, Vigouroux-Castera A, Attia J, Quelin C, Odent S, Piard J, Giuliano F, Putoux A, Khau Van Kien P, Yardin C, Touraine R, Reversade B, Bouvagnet P. Next-generation sequencing in a series of 80 fetuses with complex cardiac malformations and/or heterotaxy. Hum Mutat. 2020;41:2167–2178. doi: 10.1002/humu.24132. [DOI] [PubMed] [Google Scholar]
- 57.Al-Hamed MH, Alsahan N, Tulbah M, Kurdi W, Ali W, Sayer JA, Imtiaz F. Fetal anomalies associated with novel pathogenic variants in TMEM94. Genes (Basel) 2020;11:967. doi: 10.3390/genes11090967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Alanzi T, Alhashem A, Dagriri K, Alzahrani F, Alkuraya FS. A de novo splicing variant supports the candidacy of TLL1 in ASD pathogenesis. Eur J Hum Genet. 2020;28:525–528. doi: 10.1038/s41431-019-0524-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Maran S, Ee R, Faten SA, Sy Bing C, Khaw KY, Erin Lim SH, Lai KS, Wan Ibrahim WP, Mohd Zain MR, Chan KG, Gan SH, Tan HL. Mutations in the tail domain of MYH3 contributes to atrial septal defect. PLoS One. 2020;15:e0230982. doi: 10.1371/journal.pone.0230982. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Debiec R, Hamby SE, Jones PD, Coolman S, Asiani M, Kharodia S, Skinner GJ, Samani NJ, Webb TR, Bolger A. Novel loss of function mutation in NOTCH1 in a family with bicuspid aortic valve, ventricular septal defect, thoracic aortic aneurysm, and aortic valve stenosis. Mol Genet Genomic Med. 2020;8:e1437. doi: 10.1002/mgg3.1437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Wang Y, Jiang T, Tang P, Wu Y, Jiang Z, Dai J, Gu Y, Xu J, Da M, Ma H, Jin G, Mo X, Li Q, Wang X, Hu Z. Family-based whole-genome sequencing identifies compound heterozygous protein-coding and noncoding mutations in tetralogy of Fallot. Gene. 2020;741:144555. doi: 10.1016/j.gene.2020.144555. [DOI] [PubMed] [Google Scholar]
- 62.Zhang Y, Sun YM, Xu YJ, Zhao CM, Yuan F, Guo XJ, Guo YH, Yang CX, Gu JN, Qiao Q, Wang J, Yang YQ. A new TBX5 loss-of-function mutation contributes to congenital heart defect and atrioventricular block. Int Heart J. 2020;61:761–768. doi: 10.1536/ihj.19-650. [DOI] [PubMed] [Google Scholar]
- 63.Jiang WF, Xu YJ, Zhao CM, Wang XH, Qiu XB, Liu X, Wu SH, Yang YQ. A novel TBX5 mutation predisposes to familial cardiac septal defects and atrial fibrillation as well as bicuspid aortic valve. Genet Mol Biol. 2020;43:e20200142. doi: 10.1590/1678-4685-GMB-2020-0142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Kalayinia S, Maleki M, Mahdavi M, Mahdieh N. A novel de novo dominant mutation of NOTCH1 gene in an Iranian family with non-syndromic congenital heart disease. J Clin Lab Anal. 2020;34:e23147. doi: 10.1002/jcla.23147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Ekure EN, Adeyemo A, Liu H, Sokunbi O, Kalu N, Martinez AF, Owosela B, Tekendo-Ngongang C, Addissie YA, Olusegun-Joseph A, Ikebudu D, Berger SI, Muenke M, Han Z, Kruszka P. Exome sequencing and congenital heart disease in sub-Saharan Africa. Circ Genom Precis Med. 2021;14:e003108. doi: 10.1161/CIRCGEN.120.003108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Li Y, Fang M, Yang J, Yu C, Kuang J, Sun T, Fan R. Analysis of the contribution of 129 candidate genes to thoracic aortic aneurysm or dissection of a mixed cohort of sporadic and familial cases in South China. Am J Transl Res. 2021;13:4281–4295. [PMC free article] [PubMed] [Google Scholar]
- 67.Fu F, Li R, Lei TY, Wang D, Yang X, Han J, Pan M, Zhen L, Li J, Li FT, Jing XY, Li DZ, Liao C. Compound heterozygous mutation of the ASXL3 gene causes autosomal recessive congenital heart disease. Hum Genet. 2021;140:333–348. doi: 10.1007/s00439-020-02200-z. [DOI] [PubMed] [Google Scholar]
- 68.Massadeh S, Albeladi M, Albesher N, Alhabshan F, Kampe KD, Chaikhouni F, Kabbani MS, Beetz C, Alaamery M. Novel autosomal recessive splice-altering variant in PRKD1 is associated with congenital heart disease. Genes (Basel) 2021;12:612. doi: 10.3390/genes12050612. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Zhao L, Jiang WF, Yang CX, Qiao Q, Xu YJ, Shi HY, Qiu XB, Wu SH, Yang YQ. SOX17 loss-of-function variation underlying familial congenital heart disease. Eur J Med Genet. 2021;64:104211. doi: 10.1016/j.ejmg.2021.104211. [DOI] [PubMed] [Google Scholar]
- 70.Basel-Salmon L, Ruhrman-Shahar N, Barel O, Hagari O, Marek-Yagel D, Azulai N, Bazak L, Svirsky R, Reznik-Wolf H, Lidzbarsky GA, Shohat M. Biallelic variants in ETV2 in a family with congenital heart defects, vertebral abnormalities and preaxial polydactyly. Eur J Med Genet. 2021;64:104124. doi: 10.1016/j.ejmg.2020.104124. [DOI] [PubMed] [Google Scholar]
- 71.Li RG, Xu YJ, Ye WG, Li YJ, Chen H, Qiu XB, Yang YQ, Bai D. Connexin45 (GJC1) loss-of-function mutation contributes to familial atrial fibrillation and conduction disease. Heart Rhythm. 2021;18:684–693. doi: 10.1016/j.hrthm.2020.12.033. [DOI] [PubMed] [Google Scholar]
- 72.Wang C, Du R, Jin J, Dong Y, Liu J, Fan L, Xiang R. Use of whole-exome sequencing to identify a novel ADCY10 mutation in a patient with nephrolithiasis. Am J Transl Res. 2020;12:4576–4581. [PMC free article] [PubMed] [Google Scholar]
- 73.Di RM, Yang CX, Zhao CM, Yuan F, Qiao Q, Gu JN, Li XM, Xu YJ, Yang YQ. Identification and functional characterization of KLF5 as a novel disease gene responsible for familial dilated cardiomyopathy. Eur J Med Genet. 2020;63:103827. doi: 10.1016/j.ejmg.2019.103827. [DOI] [PubMed] [Google Scholar]
- 74.Shi W, Yang K, Sun Y, Chu Y, Zhang Y, Hao B, Liao S. A novel c.2326G>A KIT pathogenic variant in piebaldism. Am J Transl Res. 2020;12:6501–6508. [PMC free article] [PubMed] [Google Scholar]
- 75.Tang D, Xu C, Geng H, Gao Y, Cheng H, Ni X, He X, Cao Y. A novel homozygous mutation in the meiotic gene MSH4 leading to male infertility due to non-obstructive azoospermia. Am J Transl Res. 2020;12:8185–8191. [PMC free article] [PubMed] [Google Scholar]
- 76.Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25:1754–1760. doi: 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M, De Pristo MA. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010;20:1297–1303. doi: 10.1101/gr.107524.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 2010;38:e164. doi: 10.1093/nar/gkq603. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Hong N, Zhang E, Xie H, Jin L, Zhang Q, Lu Y, Chen AF, Yu Y, Zhou B, Chen S, Yu Y, Sun K. The transcription factor Sox7 modulates endocardiac cushion formation contributed to atrioventricular septal defect through Wnt4/Bmp2 signaling. Cell Death Dis. 2021;12:393. doi: 10.1038/s41419-021-03658-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Tan TY, Gonzaga-Jauregui C, Bhoj EJ, Strauss KA, Brigatti K, Puffenberger E, Li D, Xie L, Das N, Skubas I, Deckelbaum RA, Hughes V, Brydges S, Hatsell S, Siao CJ, Dominguez MG, Economides A, Overton JD, Mayne V, Simm PJ, Jones BO, Eggers S, Le Guyader G, Pelluard F, Haack TB, Sturm M, Riess A, Waldmueller S, Hofbeck M, Steindl K, Joset P, Rauch A, Hakonarson H, Baker NL, Farlie PG. Monoallelic BMP2 variants predicted to result in haploinsufficiency cause craniofacial, skeletal, and cardiac features overlapping those of 20p12 deletions. Am J Hum Genet. 2017;101:985–994. doi: 10.1016/j.ajhg.2017.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Garg V, Kathiriya IS, Barnes R, Schluterman MK, King IN, Butler CA, Rothrock CR, Eapen RS, Hirayama-Yamada K, Joo K, Matsuoka R, Cohen JC, Srivastava D. GATA4 mutations cause human congenital heart defects and reveal an interaction with TBX5. Nature. 2003;424:443–447. doi: 10.1038/nature01827. [DOI] [PubMed] [Google Scholar]
- 82.Schott JJ, Benson DW, Basson CT, Pease W, Silberbach GM, Moak JP, Maron BJ, Seidman CE, Seidman JG. Congenital heart disease caused by mutations in the transcription factor NKX2-5. Science. 1998;281:108–111. doi: 10.1126/science.281.5373.108. [DOI] [PubMed] [Google Scholar]
- 83.Futaki S, Hayashi Y, Emoto T, Weber CN, Sekiguchi K. Sox7 plays crucial roles in parietal endoderm differentiation in F9 embryonal carcinoma cells through regulating Gata-4 and Gata-6 expression. Mol Cell Biol. 2004;24:10492–10503. doi: 10.1128/MCB.24.23.10492-10503.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Kodo K, Nishizawa T, Furutani M, Arai S, Yamamura E, Joo K, Takahashi T, Matsuoka R, Yamagishi H. GATA6 mutations cause human cardiac outflow tract defects by disrupting semaphorin-plexin signaling. Proc Natl Acad Sci U S A. 2009;106:13933–13938. doi: 10.1073/pnas.0904744106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Zhang C, Basta T, Klymkowsky MW. SOX7 and SOX18 are essential for cardiogenesis in Xenopus. Dev Dyn. 2005;234:878–891. doi: 10.1002/dvdy.20565. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Wat MJ, Beck TF, Hernández-García A, Yu Z, Veenma D, Garcia M, Holder AM, Wat JJ, Chen Y, Mohila CA, Lally KP, Dickinson M, Tibboel D, de Klein A, Lee B, Scott DA. Mouse model reveals the role of SOX7 in the development of congenital diaphragmatic hernia associated with recurrent deletions of 8p23.1. Hum Mol Genet. 2012;21:4115–4125. doi: 10.1093/hmg/dds241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Wat MJ, Shchelochkov OA, Holder AM, Breman AM, Dagli A, Bacino C, Scaglia F, Zori RT, Cheung SW, Scott DA, Lee Kang SH. Chromosome 8p23.1 deletions as a cause of complex congenital heart defects and diaphragmatic hernia. Am J Med Genet A. 2009;149A:1661–1677. doi: 10.1002/ajmg.a.32896. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Long F, Wang X, Fang S, Xu Y, Sun K, Chen S, Xu R. A potential relationship among beta-defensins haplotype, SOX7 duplication and cardiac defects. PLoS One. 2013;8:e72515. doi: 10.1371/journal.pone.0072515. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Zhu N, Welch CL, Wang J, Allen PM, Gonzaga-Jauregui C, Ma L, King AK, Krishnan U, Rosenzweig EB, Ivy DD, Austin ED, Hamid R, Pauciulo MW, Lutz KA, Nichols WC, Reid JG, Overton JD, Baras A, Dewey FE, Shen Y, Chung WK. Rare variants in SOX17 are associated with pulmonary arterial hypertension with congenital heart disease. Genome Med. 2018;10:56. doi: 10.1186/s13073-018-0566-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Wang TM, Wang SS, Xu YJ, Zhao CM, Qiao XH, Yang CX, Liu XY, Yang YQ. SOX17 loss-of-function mutation underlying familial pulmonary arterial hypertension. Int Heart J. 2021;62:566–574. doi: 10.1536/ihj.20-711. [DOI] [PubMed] [Google Scholar]

